Name:______________________
Biology A - DNA and RNA Review Guide
1. Where is the DNA in eukaryotic cells located? ________________________________________
2. What does DNA stand for?
________________________________________
3. What is the function of DNA?
Matching: Match the statement to the scientist
4. Made the first model of DNA.
5. Figured out which base pairs bonded together based on their quantity.
6. Used x-ray diffraction to find the shape and structure of DNA.
7. Experimented with mice to discover a transformation ability in bacteria
8. Helped confirm DNA is the genetic material in cells
9. Discovered DNA in pus cells
A. Chargaff
B. Hershey & Chase
C. Watson & Crick
D. Franklin & Wilkins
E. Meischer
F. Avery
10. The monomer of DNA is ______________________________ and it is made up of
_______________, deoxyribose sugar, and __________________.
11. Label the components that make up a monomer of DNA.
12. List some major characteristics of DNA that we discussed in class.
Name:______________________
Biology A - DNA and RNA Review Guide
13. Use the chart provided to compare purines and pyrimidines. Make sure that you
mention:
a- Which nitrogenous bases are purines or pyrimidines in both DNA and RNA.
b- How many carbon rings are present.
c- How the purines and pyrimidines pair up.
Purines
Pyrimidines
a.
a.
b.
b.
c.
c.
14. What are the steps in DNA replication? (Include the 2 enzymes that are used in this process.)
15. How does DNA replicate in a semi-conservative manner?
16. Label the DNA double helix:
a.___________________________________
(In between the rungs of the ladder… the stepping stone)
b._______________________
(The part of the backbone that is attached to the
‘rungs’ of the ladder)
c.____________________________
(‘Rungs’ of the ladder)
Name:______________________
Biology A - DNA and RNA Review Guide
17. Provide the matching nitrogen bases in DNA replication and draw the number of hydrogen
bonds that exist between them.
TACAAAAACAAGGTACACACCATC
A____________________________
18. Why are micropipettes readily used in the science field?
19. When delivering DNA to individual wells in a gel, why is it important to change the micropipette
tip after every injection?
20. What is the overall charge of DNA, how do you know this?
21. In a criminal case, how is it possible to compare DNA fragments of two different individuals?
22. How does a restriction enzyme work? What are sticky ends?
23. Why is DNA fingerprinting used in criminal investigations?
24. What project allowed the mapping of human genes and there location within our chromosomal
DNA?
25. If you have a radioactive probe with the sequence GTA, what sequence will it label?
26. What is the purpose of RNA?
Name:______________________
Biology A - DNA and RNA Review Guide
27. Name the three types of RNA and explain each role.
28. DNA ______________________  RNA __________________________ amino acids.
29. Name three differences and three similarities between DNA and RNA?
30. What is a codon?
31. Where does transcription take place? What about translation?
32. In the picture below, label the appropriate parts with the following terms:
-Ribosome
-mRNA sequence
-CGG
-Amino acid
- Codon
-Anticodon
-tRNA molecule
-UUC
Name:______________________
Biology A - DNA and RNA Review Guide
33. Transcribe and translate the DNA sequence to amino acids. (You will need to show the mRNA
sequence in order to find the amino acids.)
DNA -
TACAAAAACAAGGTACACACCATC
mRNA(Separate into codons)
Amino Acids-
34. What is the start codon in the mRNA strand?
35. What is a mutation?
36. True or false: a mutation can have a positive effect on an organism?
37. How do mutations affect entire populations?
38. What type of mutations will shift the codons so that the amino acid sequence changes?