A guide to bioengineering
Instructions: You will be completing a series of questions and labs to help you
understand the techniques used in bioengineering. Questions will be completed on
your own. Labs will be given to you by the teacher and completed in class.
I. DNA Extraction:
In order to study DNA, we need to be able to extract it from living cells. DNA can be
extracted from any living organism, including bacteria. In order to understand what
is needed for a DNA extraction, answer the questions below.
1. Where is DNA found in a eukaryotic cell?
2. Where is DNA found in a prokaryotic cell?
3. Do you think it is easier to extract DNA from a eukaryotic cell or a
prokaryotic cell? Explain. (there is not one correct answer)
4. In order to get DNA out of a cell, what needs to happen to the cell wall and/or
cell membrane first? Explain.
5. Chromosomes contain DNA. In order to extract just DNA, what other organic
molecules will need to be removed from the chromosome in order to isolate
the DNA?
6. What makes up the cell membrane and nuclear membrane (if eukaryotic) of a
cell?
Using your answers to the questions and prior knowledge of cells and DNA,
explain the purpose of each step below in the extraction of DNA from cells
and then put them in order. For example, if you think a step occurs first, put
a “1” in the order of steps column. This table does not include all the steps of
a DNA extraction.
Step of DNA extraction
(steps are not in order)
Mix cells with soap and
water
Crush the sample you want
to extract DNA from
(strawberries, banana, etc)
Add meat tenderizer which
contains proteases
Purpose of step
Order of steps
7. Perform a DNA extraction using teacher instructions and supplementary
lab.
II. Restriction Enzymes and Gel Electrophoresis:
Gel Electrophoresis is the process of separating DNA fragments based on their size.
One way to get fragments of DNA is to take extracted DNA and expose it to
restriction enzymes. This is called a restriction digest. Restriction enzymes cut DNA
at particular nucleotide sequences. For example, HaeIII will cut a DNA sequence
every time it encounters a
5'GGCC3'
3'CCGG5'
*see the chart to the right for where the cut occurs for HaeIII
and other restriction enzymes.
So, if the following DNA segment were exposed to restriction
enzyme HaeIII (restriction digest), the result would be 4
fragments of DNA. NOTE: The two complimentary sides
count as one fragment, not two separate fragments.
5’ATCGAGGCCTTTACCCCGGCCAAAATCGCAGGCCTTCACAG3’
3’TAGCTCCGGAAATGGGGCCGGTTTTAGCGTCCGGAAGTGTC5’
DRAW WHERE THE CUTS WOULD OCCUR SO YOU CAN SEE
WHY YOU WOULD GET 4 FRAGMENTS!
Using the chart to the right and information about restriction enzymes, answer the
following questions.
1. Based on the pictures, what is a blunt cut?
2. Based on the pictures, what is a cut that produces “sticky” ends?
3. Would restriction enzyme Alul make any cuts on the example DNA segment
above? Explain.
4. Using the example DNA segment above, how many nucleotide base pairs would
each of the 4 fragments be? (hint: the first fragment would be 7 base pairs long)
5. How many fragments would result in a restriction digest of the DNA segment
below using Alul and HaeIII? (draw a line where the cuts will occur to help you
solve this)
5’ATCGAGGCCTTTACCCCGGCCAGCTTCGCAGGCCTTCACAG3’
3’TAGCTCCGGAAATGGGGCCGGTCGAAGCGTCCGGAAGTGTC5’
6. How many base pairs will each fragment from number 5 be?
In most cases, scientists do not know the fragment sizes of a restriction digest, so they
must use a technique called a gel electrophoresis to help determine the fragment sizes.
To learn about Gel electrophoresis, click on the link below from the DNA learning
center.
http://www.dnalc.org/resources/animations/gelelectrophoresis.html
Answer the following questions using the information from the video.
1. What would happen if you used a solution with no ions (such as distilled water)
in the electrophoresis tank instead of a salt solution?
2. Why does DNA travel in the gel toward the positive end of the chamber?
3. Using the picture to the right, answer the following questions:
a. Sample A is the marker (also known as the
standard or ladder). What is the purpose of
the marker?
b. What does each band on the gel represent?
c. Which sample contains the
smallest fragment of DNA? How
do you know?
d. In this particular lab, a student took the same
DNA segment for each sample (B through G)
and did a restriction digest on each. Did he
use the same or different restriction enzyme
for each sample? How do you know?
e. Approximately how many base pairs is the
third DNA band in sample B? (count bands
starting from the well)
f. What would have happened if a restriction
enzyme were not used first for all the
samples? What would the gel look like?
A marker fragment lengths starting
from well: 100bp, 150bp, 200bp,
250bp, 300bp, 390bp, 480bp, 600bp
So what is the importance of restriction enzymes and gel electrophoresis? In science
there are many uses, but one particular use has become very popular in forensics- DNA
Fingerprinting.
1. In order to understand DNA Fingerprinting; complete the DNA fingerprinting activity
given to you by the teacher. (Some of the information on this activity will be a review of
the process of gel electrophoresis and will help you understand it better)
2. Once you have finished the DNA fingerprinting activity, follow teacher instructions
on completing a DNA fingerprint in class.
Why else would scientists want to use restriction enzymes? The
picture to the right demonstrates how we use restriction enzymes to
make copies of genes or sections of DNA.
1. In what two steps do you think restriction enzymes are
needed? Explain.
2. A plasmid is circular DNA found in bacteria. Why do you think
we use bacteria to make copies of a gene? (Hint: think of the
time it takes to replicate)
III. PCR (polymerase chain reaction)
PCR is another method of amplifying, or copying, a section of DNA
(not the entire DNA strand). It is almost like DNA replication, but it
is done in a lab. Answer the following about DNA replication below.
1. What enzyme is needed to break hydrogen bonds between
base pairs in DNA?
2. What enzyme binds the free nucleotides to the template strands?
Watch the video below about PCR. Be ready to compare it to cellular DNA replication.
http://www.dnalc.org/resources/3d/19-polymerase-chain-reaction.html
1. What step of PCR replaces the enzyme helicase?
2. What is the purpose of the primers that are added?
3. What molecule replaces DNA polymerase in PCR?
4. What step would be affected if the temperature during the PCR process did not
drop to 55 degrees Celsius?
5. Why is it important for the temperature to change during PCR?
6. How many target DNA sequences will there be after 30 cycles?
7. Why do you think scientists may want to make MANY copies of particular
segment of DNA? (hint: in many cases, the segment they want to make copies of
is a gene of interest)
8. Practice PCR by completing a mini-lab. You will use a supplementary lab given
by the teacher.
IV: Using BLAST to compare DNA sequences.
BLAST stands for Basic Alignment Search Tool. It is a huge database of DNA, protein,
and RNA sequences online. There are many features of BLAST, but one thing you can do
is compare and align DNA sequences of the same or different species. Below are two
sequences of DNA from a segment of DNA found on the mitochondria. You are only
given one side of the DNA strand from each organism (the compliment side is not
given). Using BLAST, align the sequences below and answer the questions that follow.
ATNNNTATTCTCTGTTCTTTCNTGGGGAAACAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCG
TACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAA
CCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTCACCCAC
TAGGATACCAACAAACCTACCCACCCTTAACAGCACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTT
CTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCANNNNCATCCTGATCTGAATTTTCCGCNTGTTGANANNAGG
AAAAAGNGNNANAGNTNNGAANNANTNTACAANNTGN
TTAACTATTCTCTGTTCTTTCNTGGGGAAACAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCG
TACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAACC
CCCCCCCCCCCGGGTTAAAAAAAAAAAAAGAAATAAACCCCCAAATTTTAAAAATTAANTGGAANTCCAAAACCCCCCCCCCCCCC
NAANAAAACCAAAAAACCCACCCCTTTTTNAAAAAAAAAAANAAAAAAANCCTTTTTCCGNAAAAAANAAATTAAANNNAAATC
CCTTTTCNNCCCCAGGGNNNANCCCCCCCAAAAANGGGGCCCTTGNNCCCNCCANNNNAAAAAAGGAAGGNTTCTGACATCTC
CTCTTGCTTTGNAGTGGNNATANNGAANANNGNNNTGGANNTTATGCAGTATGGNNGANCTNNNATATGGATNNNTTTGNNN
TTGAAATNTGTCTCTGCCTNTTACTTNGN
1.
2.
3.
4.
5.
What are the bases that are found in DNA?
Why do you think there are “Ns” in the DNA sequences above?
Do prokaryotes have mitochondrial DNA?
In humans, who passes on mitochondrial DNA (mother or father)? Explain.
How many differences are there in the nucleotide sequences between these two
organisms using the alignment tool?
6. Do you think these two organisms belong to the same species? Why?
7. How do you think scientists use the alignment tool to see if someone has a
genetic mutation at a particular gene?
Resources:





Restriction enzymes. 12 March 2011
http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/R/RestrictionEnzy
mes.html
Gel Electrophoresis Figure S.2.
http://www.google.com/imgres?q=gel+electrophoresis&um=1&hl=en&clien
t=safari&sa=N&rls=en&biw=1154&bih=731&tbm=isch&tbnid=GwMzyNC2t3
1OAM:&imgrefurl=http://access.aasd.k12.wi.us/wp/bartelbrian/2011/09/2
6/physical-vs-chemicalchange/gelelectrophoresis/&docid=SyY3SK79Nw_knM&imgurl=http://acces
s.aasd.k12.wi.us/wp/bartelbrian/files/2011/09/GelElectrophoresis.gif&w=
455&h=450&ei=3XoFUPHPGca40QHszenoCA&zoom=1&iact=hc&vpx=725&v
py=81&dur=364&hovh=217&hovw=220&tx=147&ty=108&sig=1070950317
45811268909&page=1&tbnh=154&tbnw=156&start=0&ndsp=15&ved=1t:4
29,r:3,s:0,i:150
DNA learning Center. Cold Spring Harbor Laboratory.
http://www.dnalc.org/resources/3d/19-polymerase-chain-reaction.html
Create a DNA Fingerprint. Nova. WGBH Educational Foundation.
http://www.pbs.org/wgbh/nova/teachers/body/create-dnafingerprint.html
The Science behind our food. DNA Extraction from Strawberry lesson plan.
http://gemsclub.org/yahoo_site_admin/assets/docs/StrawberryDNAExtra.4
395135.pdf