Down-regulation of adipogenesis of mesenchymal stem cells by
oscillating high-gradient magnetic fields and mechanical vibration
Supplementary Information
Cell culture. Mesenchymal stem cells (MSCs) were obtained from Wistar rats.1 MSC
isolation was carried out using a standard procedure. The animals were deeply anesthetized,
the femurs and tibias were dissected and the bone marrow was plated on Petri dishes in
medium containing DMEM (PAA Laboratories GmbH,Pasching,Austria), 10% FBS (PAA
Laboratories GmbH, Pasching, Austria), and PrimocinTM (100μg/ml) (Lonza Cologne AG,
Koln, Germany). Cells were allowed to adhere; non-adherent cells were removed after 48
days by replacing the medium. Adherent cells were cultivated at 37 °C in a humidified
atmosphere containing 5% CO2, and the medium was changed twice a week. After reaching
near-confluency, the cells were harvested by a trypsin/EDTA solution. To study the effect of
HGMF, cells were seeded on the 35 mm ibidi -Dishes (ibidi GmbH, Munich, Germany)
coated with laminin (100 g/ml) (Sigma-Aldrich, St. Louis, MO, USA) and were allowed to
adhere for 24 h. To induce adipogenic differentiation, 40,000 cells were seeded per each dish.
The adipogenic medium contained DMEM, 10% FBS, dexamethasone (1 M), 3-isobutyl-1methylxanthine (0.5 mM), indomethacine (0.1 mM), and insulin (10 g/mL) (all from Sigma).
Measurement of cellular proliferation. Cell proliferation was analyzed by WST-1 assay
(Roche Diagnostics, Mannheim, Germany), which is based on the cleavage of the tetrazolium
salt WST-1 by cellular mitochondrial dehydrogenases, producing a soluble formazan salt; this
conversion only occurs in proliferating cells, thus allowing the accurate spectrophotometric
quantification of the number of metabolically active cells in the culture. 20,000 cells were
seeded per each dish; 24 h after the seeding cells were exposed to HGMF for two or seven
1
days. The absorbance was measured using a Tecan-Spectra ELISA plate reader (Mannedorf,
Switzerland) at 450 nm.
Gene expression. Cells were exposed to HGMF for two or seven days; after seven days of
differentiation, expression of adipose specific genes, adiponectin, PPAR6 and AP2, were
determined by real-time qPCR. In brief, the total RNA was extracted from the cells using TRI
reagent (Molecular Research Center, Cincinnati, OH). One μg of the total RNA was used for
subsequent reverse transcription. Quantitative real-time PCR was performed using an iCycler
(BioRad,Hercules, CA). The following primers were used for amplification: Adiponectin: L –
AATCCTGCCCAGTCATGAAG; R – TCTCCAGGAGTGCCATCTCT; Pparg:
L –
CCCAATGGTTGCTGATTACA; R – GGACGCAGGCTCTACTTTGA; Ap2:
L –
AATGTGCGACGCCTTTGT;
R
–
TGATGATCAAGTTGGGCTTG;
Actin:
L
–
CCCGCGAGTACAACCTTCT; R – CGTCATCCATGGCGAACT.
Each single experiment was done in duplicate. The gene expression level was normalized
based on actin as a reference gene; control samples were used as a calibrator. Relative
quantification of gene expression was determined using the ΔΔCT method.
Single cell gel electrophoresis (‘Comet assay’). The genotoxic effects of HGMF were
analyzed using an alkaline version of single cell gel electrophoresis (comet assay) with an
analog of mammalian OGG1-formamidopyrimidine DNA glycosylase (FPG) and
endonuclease III (ENDO III).2,3 This approach enables the detection of single- and doublestrand breaks in DNA (DNA-SB), transient gaps arising as intermediates during base excision
repair, alkali-labile sites, apoptotic DNA fragmentation, and a broad spectrum of oxidized
purines and pyrimidines.3,4 Cells harvested after 2-, 3-, or 5-day-long exposures were diluted
with PBS to a concentration of 0.6-0.8×103 cells/ml, and four slides were prepared per treated
culture.5,6 Following this, the slides were submerged for 1 h in a lysing solution (2.5 M NaCl,
2
100 mM EDTA, 10 mM Tris, 0.16 M DMSO, 0.016 mM Triton X-100, all Sigma–Aldrich,
Germany) at pH 10. After washing with PBS, two slides per sample were treated with 45 l of
FPG and ENDO III in a 1:1 mixture (final concentration of both enzymes was 2.5 l/ml;
Sigma–Aldrich, Germany) for 1 h at 37°C. In parallel, two slides were treated with the same
volume of buffer used for the dilution of enzymes (0.1 M KCl, 4 mM EDTA, 2.5 mM
HEPES, 2% BSA, all Sigma–Aldrich, Germany). Subsequently, the slides were equilibrated
for 40 min in alkaline buffer (0.3 M NaOH, 1 mM EDTA, pH 13) to allow the DNA to
unwind. Electrophoresis was performed in fresh alkaline buffer (20 min, 1.2 V/cm, 300 mA).
Finally, the slides were neutralized in 0.4 M Tris (pH 7.5), stained with 0.005% ethidium
bromide (Sigma-Aldrich) for 7 min, washed with distilled water (7 min), fixed in methanol
(15 min), dried at room temperature, and stored. To avoid artificial damage to the DNA, all
manipulations with the cells until the treatment in lysing solution were performed under a
yellow light.
Before analysis, the slides were rehydrated in distilled water, and images were captured with a
CCD-1300B camera (VDS, Vosskuhler, Germany) attached to a BX51 fluorescence
microscope (Olympus, Japan). The extent of DNA migration was quantified using Lucia
Comet Assay 7.00 software (Laboratory Imaging, Czech Republic), and the results were
expressed as the percentage of DNA in the tail (Tail DNA %). Both total DNA damage (with
enzymes) and DNA strand breaks (DNA-SB; without enzymes) were measured in 200
randomly selected cells per treated cell culture, i.e. the culture exposed to either mechanical
vibrations or an oscillating HGMF, static HGMF and an untreated culture as a negative
control. Medians were calculated from every group of 200 cells and the level of oxidative
DNA damage was assessed as the difference between the median of total DNA damage and
the median of DNA-SB.
3
Immunofluorescence. After mechanical vibration or oscillating HGMF treatment, cells were
fixed in paraformaldehyde in PBS for 15 min, washed with 0.1M PBS, treated with Triton X100 (0.5%) in PBS, and incubated with Alexa-Fluor 568 Phalloidin (1:300) (Invitrogen,
Paisley, UK). Nuclei were counterstained with DAPI. Images were digitally recorded using
either Zeiss LSM 510 confocal system (Carl Zeiss Ag) or Zeiss Axioscope 2 microscope (Carl
Zeiss AG). ImageJ software was used for image processing and fluorescent micrograph
quantification. Image analysis in terms of cell area, calculation of mean fluorescence
intensity, length of filaments, and anisotropy score has been performed by using special
plugins for ImageJ: for cytoskeleton analysis – AnalyzeSkeleton7; for anisotropy analysis –
FibrilTool.8
Statistical analysis. Quantitative results are expressed as mean ± SD. Results were analyzed
by multi-group comparison Mann Whitney and Newman-Keuls tests. Differences were
considered statistically significant at *P < 0.05.
Figure S1. DNA damage in rat mesenchymal stem cells exposed to either mechanical
vibrations or oscillating HGMF.
Cells were exposed to either mechanical vibrations or an oscillating HGMF for indicated
periods of time. The genotoxic effects of the vibrating magnetic field on the cells were
4
analyzed using an alkaline version of single cell gel electrophoresis (comet assay). Both total
DNA damage (with enzymes) and DNA strand breaks (DNA-SB; without enzymes) were
measured in 200 randomly selected cells.
Figure S2. F-actin remodeling upon magnetic vibrations.
(a) MSCs were exposed to either mechanical vibrations or an oscillating HGMF for indicated
periods of time. After treatment cells were fixed and stained for F-actin (Phalloidin). Nuclei
were counterstained with DAPI. ImageJ software was used for image processing and
fluorescent micrographs quantification (b).
5
References
1
S. Kubinova, D. Horak, and E. Sykova, Biomaterials 30, 4601 (2009).
A. R. Collins and A. Azqueta, Single-cell gel electrophoresis combined with lesion-specific
enzymes to measure oxidative damage to DNA, in Laboratory Methods in Cell Biology P.M.
Conn, Editor (Academic Press, Elsevier, 2012) p. 69-92.
3
A. Azqueta and A. R. Collins, Arch. Toxicol. 87, 949 (2013).
4
R. R. Tice, E. Agurell, D. Anderson, B. Burlinson, A. Hartmann, H. Kobayashi, Y. Miyamae,
E. Rojas, J. C. Ryu, and Y. F. Sasaki, Environ. Mol. Mutagen. 35, 206 (2000).
5
N. P. Singh, M. T. McCoy, R. R. Tice, and E. L. Schneider, Exp. Cell Res. 175, 184 (1988).
6
B. Novotna, J. Topinka, I. Solansky, I. Chvatalova, Z. Lnenickova, and R. J. Sram, Toxicol.
Lett. 172, 37 (2007).
7
I. Arganda-Carreras, R. Fernandez-Gonzalez, A. Munoz-Barrutia, and C. Ortiz-DeSolorzano, Microsc. Res. Tech. 73, 1019 (2010).
8
A. Boudaoud, A. Burian, D. Borowska-Wykret, M. Uyttewaal, R. Wrzalik, D. Kwiatkowska,
and O. Hamant, Nat. Prot. 9, 457 (2014).
2
6