SCCS Honors Biology
EXTRA CREDIT: 4th quarter
You may earn extra credit applicable toward the Final Exam by completing all parts of
this assignment
Answer all questions on a separate sheet of paper. Use complete sentences.
Extra Credit assignments are due by Tuesday, May 15, NO EXCEPTION. Hard copies
only. (No emailed assignments accepted.)
Part 1: BLAST
You can identify nucleotide sequences directly using the BLAST server, and then use
the gene name to find the associated disease. See if you can identify the disease
associated with the following nucleotide sequence:
ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGTCCTTCC
AGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC
Using the BLAST Website, provide the following information:
1. Abbreviation of gene
2. Genetic disease associated with defective gene
3. Chromosome number (location of gene)
4. Describe the effects/symptoms (phenotype) of the genetic disease
Part 2: GENETIC ENGINEERING
Watch Dawn of the Clone Age, available from
http://www.youtube.com/watch?v=lI9z716z2aM
Answer the following questions. Use a separate sheet of paper for your responses.
1. What difference is there between the first successful cloning experiments of the
1950s and the more recent cloning of Dolly, the sheep?
2. Explain why some people feel that the development of human cloning is like the
development of nuclear weapons.
3. Why would a clone be a good source for a blood, organ, or bone marrow transplant?
4. Describe the cloning process known as nuclear transfer.
5. What is the benefit of putting human genes into an animal’s DNA?
6. Would a human clone be an exact duplicate - in every way - of the human it was
cloned from? Why or why not?
(continued on back )
7. Why do you think many world leaders have imposed a ban on human cloning
experiments?
8. What might be some of the beneficial applications of cloning?
(These last 3 responses should be comprehensive, well thought-out answers.)
9. Medical advances save lives, but does technology go too far? Discuss whether
anything and everything should be done to save a person’s life.
10. Debate the ethics of cloning only the best and brightest of the human race. If you
were in charge of undertaking such a project, which qualities would you look for when
selecting your cloning subjects? Would you be doing a disservice to the human race by
undertaking this project? Would you be honoring the Lord? Why or why not?
11. Medical procedures that were once thought unethical, such as transplanting hearts
and fertilizing babies in test tubes, are now relatively common. On the other hand, some
scientific projects that seemed clear-cut at first, like the development of the nuclear
bomb, are now subject to ethical debates. Compare the ethics of cloning with the ethics
of earlier scientific developments.