Single Nucleotide Polymorphisms of SOX10 in Thai Patients with sporadic
Hirschsprung Disease
Karun Eadyow1, Theerawut Phusantisampan2, Wanwisa Maneechay3, Surasak Sangkhathat4
1
Department of Biomedical Sciences, Faculty of Medicine, Prince of Songkla University, Hat
Yai, Songkhla, Thailand 90110
Department of Biotechnology, Faculty of Applied Science, King Mongkut’s University of
Technology, North Bangkok, Bangkok, Thailand 10800
2
3
Central Research Laboratory, Faculty of Medicine, Prince of Songkla University, Hat Yai,
Songkla, Thailand 90110
4
Department of Surgery, Faculty of Medicine, Prince of Songkla University, Hat Yai,
Songkhla, Thailand 90110
*e-mail: karuneadyowbms54@gmail.com, e-mail: surasak.sa@psu.ac.th
Abstract
Hirschsprung disease (HSCR) is complex genetic disorder of the enteric nervous system
(ENS) characterized by an absence of ganglion cells in the varying parts of the intestine. The
disease has a strong genetic association with RET-protooncogene (RET) and various genes
involving in the neural crest development. SOX10 is a transcriptional regulator whose
expression is essential in development of the ENS, SOX10 protein physically interacts with
another transcriptional regulator, PAX3, to activate transcription of RET. Association
between single-nucleotide polymorphisms ( SNPs) in SOX10, rs139883 and rs139884, and
sporadic HSCR has not been reported. In this report, we evaluated genetic association
between 2 SNPs in SOX10 and Thai sporadic HSCR, using case-control design. The study
included 101 HSCR and 144 sex-matched controls, whose DNA were genotyped by RFLP
(rs139883) and Taqman SNP genotyping (rs139884) method. The study found minor allele
frequency (MAF) at 0.27 and 0.23 for the rs139883 (allele C) and rs139884 (allele A),
respectively. Only rs139883 complied the Hardy-Weinberg Equilibrium and was regarded in
the disease association analysis. The association analysis found that the risk-genotypes were
not significantly associated with the disease (p-value 0.59). However, when subgroup
analysis was performed, genotypes containing C allele in the rs139883 were significantly
associated with HSCR (p-value 0.01) at the odds ratio of 5.6 (95% confidence interval 1.119.5). Moreover, the long segment disease group significantly harbored risk-genotypes (70%
compared to 36.8%) (P-value < 0.01). In conclusion, the study suggested genetic association
between rs139883 in SOX10 and Thai-female HSCR.
Keywords: Hirschsprung disease (HSCR), ganglion cells, single nucleotide polymorphisms
(SNPs)
Introduction
Hirschsprung disease (HSCR) or congenital megacolon is characterized by functional
colonic obstruction caused by an absence of ganglion cells in the varying parts of the
intestine [9]. It is a congenital disorder that has an incidence of approximately 1: 5,000 live
births. The male: female ratio is proximately 4:1 among patients with short segment
aganglionosis (S-HSCR) and approximately 1:1 among those with long segment aganglionosis
(L-HSCR). Although the disease usually presents as an isolated case in about 70%, familial
cases are found in approximately 20% [7]. In Thailand, the incidence of HSCR has not been
reported, but it is believed to be more prevalent in the southern part of the country [9]. The
etiology of HSCR is multifactorial, involving multiple genetic and environmental factors.
HSCR has a complex pattern of inheritance and also ethnic and sex-dependent penetrance. To
date, at least 11 genes have been identified as susceptibility loci in HSCR, including RETprotooncogene ( RET ) , GDNF, NTN, EDNRB, EDN3, SOX10, ECE-1, ZFHX1B, PHOX2B,
KIAA1279 and the most recently found, NRG1, identified by a genome-wide association
study [7].
SOX10 encodes a transcriptional regulator whose expression is essential for the
development of neural crest cells such as melanocytes and enteric neurons. During
development of the enteric nervous system ( ENS), the SOX10 protein physically interacts
and cooperates with another transcriptional regulator, PAX3, to activate transcription of RET.
SOX10 has recently been found to functionally interact with EDNRB in mice. The
significance of SOX10 in HSCR is revealed in familial type of HSCR. Mutations of SOX10
were found in Yemenite deaf-blind hypopigmentation syndrome and other myelin
deficiencies [7], however the alterations have not been reported in sporadic cases. Therefore,
SOX10 is unlikely to be a major disease-causing gene in isolated HSCR. Interestingly, despite
an absence of genetic mutations, abnormal SOX10 expression can be observed in aganglionic
intestine of isolate HSCR patients [7], suggesting its role in the disease. Association between
single-nucleotide polymorphisms (SNPs) in SOX10 and sporadic HSCR has not been reported
before.
In addition, SNPs of the RET-protooncogene (RET) have been demonstrated to have a
strong association with HSCR in various studies, especially in Asians [3]. The majority of
these studies are conducted in East Asian populations [8]. RET encodes a single-pass receptor
whose function is essential for the development of enteric nervous system. Risk alleles in
RET SNP, in particular rs2435357 T allele, are more frequent in HSCR [2] and, alone or in
combination with other SNP alleles in the RET promoter, are associated with reduced RET
expression in vitro and in vivo. Indeed, the T variant of rs2435357 disrupts a SOX10 binding
site affecting RET transactivation, and therefore, expression [1, 2, 3, 4, 5, 6]. Our previous
works have screened for SNPs within SOX10 in Thai and found 2 interesting variants,
rs139883 and rs139884 [8]. In this study, we aimed to evaluate association between the two
SNPs in SOX10 and sporadic HSCR in Thai subjects.
Methodology
Subjects and Samples collection
Patients with sporadic HSCR, age 0-15 years, operated on in Songklanagarind
Hospital, were included in this study. Diagnosis is based on histological examination that
showed absence of ganglion cells. On sample size calculation, the number of HSCR cases is
estimated at 101 samples. Control group consists of 144 sex-matched individuals, age >15
years, with no history of chronic constipation. A control group that was not age matched was
use on purpose because we needed to be certain that the controls did not have the disease.
A written informed consent was obtained from all contributors for use of clinical data
and molecular genetic studies. The study has been approved by the Ethics Committee for
Clinical Research, Faculty of Medicine, Prince of Songkla University.
DNA isolation and genotyping
DNA is extracted using DNeasy Tissue (Qiagen kit, Germany) according to enclosed
protocol. DNA concentration of PCR products is measured and adjusted to 50 ng/ul. To
validate crude allele frequency in each SNP, coding sequence of SOX10 was determined in
50 samples by polymerase chain reaction (PCR) and direct sequencing methods. SOX10 SNP
genotyping were performed by TaqMan SNP genotyping method for the SNP rs139884 and
polymerase chain reaction restriction fragment length polymorphism ( PCR-RFLP) for the
SNP rs139883. On TaqMan SNP genotyping, the study used the assay mixes (including
unlabeled PCR primers, FAMTM and VIC® dye-labeled TaqMan MGB probes) of Assays byDesign designed and supported by ABI (Applied Biosystems Foster City, CA). The reaction
system contained 50 ng of genomic DNA, 2 µL of 2x TaqMan Genotyping Master Mix, 0.5
µL of 40x Assay Mix, and adjusted Milli-Q H2O in a total volume of 20 µL. The PCR
conditions consisted of an initial step at 95 ºc for 10 min, followed by 40 cycles at 95 ºc for
15 s and 60 ºc for 60 s in a 96-well plate, using ABI Prism®7500 Fast Real-time PCR. Each
experiment included negative (no template) and positive controls (samples with known
genotype) to ensure genotyping accuracy. On PCR-RFLP for rs139883, a typical reaction
contained HpaII ( restriction enzyme) (Thermo Scientific) 0.5 µL, 10x NE buffer 2.5 µL,
DNA from PCR product 2 µL and adjusted Milli-Q H2O in a total volume of 25 µL. The
digested product was analyzed on 2% agarose gel and visualized by ethidium bromide
staining under UV transillumination. Primers and a probe used in this study were shown in
Table1.
Table1. Oligonucleotide sequences and method for genotyping of the 2 SNPs in SOX10
SNP_ID
Name
Sequence (5’ to 3’)
Alleles
Method
rs139883
rs139883_F
rs139883_R
rs139884_F
rs139884_R
rs139884_VIC
rs139884_FAM
ACTGGGGGCTGTTTCTCAG
AATGACCCTCTATCCCAGGAC
CATAGCCGGCTGCTGAGTAG
ACCTGCCGCCCAATGG
VIC-CTGCTCACATGGCCTG-TAMRA
FAM-TGCTCACGTGGCCTG-TAMRA
C/T
PCRRFLP
TaqMan
SNP
genotyping
rs139884
A/G
Statistical Analysis:
Testing for the Hardy–Weinberg equilibrium (HWE) of allele distribution in each
SNPs was performed by chi-square based methods. Univariate analysis used chi-square test
or Fisher’s exact test, as appropriate, to determine the significance of difference between
allele frequencies and risk genotype frequencies between the disease and the control groups.
Statistical analysis was performed using statistics software Intercool Stata V 6.0 (Stata, TX,
USA). Values are reported as raw numbers and percentages, where applicable. The crude
odds ratio with a 95% confidence interval (CI) was derived from univariate logistic
regression analysis. Statistical significance was assumed for a p-value of < 0.05, for all
comparisons.
Figure 1. An example of genotype discrimination plot of the SNP rs139884. Blue dots
represent homozygous for GG, orange dots represent homozygous for AA, green dots for
heterozygous, AG and black dot represents negative (no template) control.
Figure 2.
Restriction fragment length polymorphism patterns on an agarose gel
electrophoresis using HpaII restriction enzyme. C1 - C8 were unknown when C9 - C11 were
controls with known genotypes. Lane M represents 100 bp ladder.
Results
Ninety-six patients, 77 males and 19 females, with sporadic HSCR were included in
this study. Cases were categorized into S-HSCR in 76 cases (79.2%) and L-HSCR in 20
(20.8%) cases. Seven patients (7.29%) had associated Down syndrome. Controls included
122 subjects (98 males and 24 females). Male to female ratio was at 4.08:1 in the control
group, which had no significant difference from 4.05:1 in the HSCR group (p-value 0.982).
Male to female ratio in S-HSCR (62:14 or 4.43:1) were slightly higher than that of L-HSCR
(15:5 or 3:1), however, the difference did not reach a statistically significant level (p-value
0.51).
Distribution of allelotypes and genotypes
Allelic distribution in the SNP rs139883 was not statistically deviated from the HWE
(p-value 0.15) when the rs139884 was significantly deviated from the HWE (p-value 0.03).
The linkage disequilibrium was not calculated due to the significant deviation of the second
SNP from the HWE. Minor allele frequencies (MAF) of the rs139883 (allele C) in HSCR
cases and controls were 0.27 and 0.23, respectively (p-value 0.27) when those of the
rs139884 (allele A) were 0.26 and 0.20 (p-value 0.17). Genotype distribution of both SNPs
was displayed in the Table 2. When genotypes were analyzed with the disease in case-control
fashion, there were no significant association between each risk-genotype and HSCR.
When subgroup analyses were performed based on sex, it was found that the MAFs of
rs139883 and rs139884 in female-HSCR/female controls were 0.36/0.14 (p-value 0.01) and
0.29/0.14, respectively (p-value 0.09). Association analysis revealed significant association
between risk-genotypes of both SNPs and HSCR in female subgroup (Table 3). When only
HSCR was taken into account, risk genotypes of the 2 SNPs were significantly associated
with L-HSCR (Table 4). On univariate logistic regression analysis, odds ratio of the risk
genotypes of rs139883 for HSCR was 5.6 (95% confidence interval 1.1-19.5).
Table 2 Allelic distribution and minor allele frequencies of rs139883 and rs139884
SNPs/Group
HSCR
rs139883
TT
CT
CC
N=96
54 (56.25%)
32 (33.33%)
10 (10.42%)
rs139884
GG
AG
AA
N=96
56 (58.33%)
30 (31.25%)
10 (10.42)
MAF; minor allele frequency
MAF
(%)
10.42
10.42
Control
N=122
76 (62.30%)
37 (30.33%)
9 (7.38%)
N=122
81 (66.39%)
32 (26.23%)
9 (7.38%)
MAF
(%)
7.38
P-value
7.38
0.45
0.59
Table 3 Distribution of genotype groups in male and female subgroups and their disease
association
Sex group
HSCR
Control
p-value
Male
0.77
rs139883
TT
CT/CC
48(62.34%)
29(37.66%)
59(60.20%)
39(39.80%)
rs139884
GG
AG/AA
47 (61.04%)
30 (38.96%)
62 (63.27%)
36 (36.73%)
rs139883
TT
CT/CC
6 (31.58%)
13 (68.42%)
17 (70.83%)
7 (29.17%)
rs139884
GG
AG/AA
9 (47.37%)
10 (52.63%)
19 (79.17%)
5 (20.83%)
0.76
Female
*0.01
*0.03
*p<0.05
Table 4 Distribution of genotypes in short segment (S-HSCR) and long segment (LHSCR) subgroups of Hirschsprung disease
SNPs
rs139883
TT
CT/CC
rs139884
GG
AG/AA
S-HSCR
L-HSCR
48 (63.16%)
28 (36.84%)
6 (30.00%)
14 (70.00%)
49 (64.47%)
27 (35.53%)
7 (35.00%)
13 (65.00%)
P-value
*0.008
*0.017
*p<0.05
Discussion and Conclusion
Our study aimed to evaluate an association between genetic polymorphisms of SOX10
in HSCR, a prototype of polygenic disease with low penetrance. In this study we attempted to
use sex-match controls in order to clear bias caused by unequal distribution of the genotypes
between sexes. All cases were histologically proven and clinically consistent with the disease
when controls were volunteers residing in the same geography who were clear of disease by
careful medical history. As the study has not been completed, the number of controls has not
reached that of expectation. However, on analysis, we keep equal sex-ratio between case and
control groups. Characteristics of our HSCR in terms of sex distribution and length of
aganglionosis group were compatible with those reported by other studies.
MAF of both SNPs in our study were comparable with those reported in the
HAPMAP site. On HWE check, the second SNP, rs139884 did not distribute according to the
Hardy-Weinberg theory. This bias may be a result of a limited number of controls. This
suggests us to exclude the rs138994 from the result interpretation. The study did not find
significant disease association when a case-control analysis was done in all cases. However,
we did find association between the risk-genotypes of rs139883 and HSCR when subgroup
analysis was performed exclusively on females. Moreover, the analysis demonstrated that the
risk genotype was significantly found in higher percentage in L-SHCR subgroup. These
suggested that SOX10 is associated with L-HSCR in females. This result is compatible with
the finding of Gui H, et al. which reported stronger genetic association of rs2435354 in RETprotooncogene in female or L-HSCR.
In conclusion, our study preliminary reported genetic association between the SOX10
SNP, rs139883, and HSCR. Further study of this marker in terms of more subjects and
functional study is recommended.
Acknowledgements:
The study was supported by a grant from the Faculty of Medicine, Prince of Songkla
University. The author thanks all personnel in the pediatric surgery unit, Songklanagarind
Hospital for their participation in surgical specimen collection.
References
[1]Emison ES, McCallion AS, Kashuk CS, Bush RT, Grice E, Lin S, Portnoy ME, Cutler DJ,
Green ED, Chakravarti A .A common sex-dependent mutation in a RET enhancer
underlies Hirschsprung disease risk. Nature (2005) 434:857–863
[2]Emison ES, Garcia-Barcelo M, Grice EA, Lantieri F, Amiel J, Burzynski G, Fernandez
RM, Hao L, Kashuk C, West K, Miao X, Tam PK, Griseri P, Ceccherini I, Pelet A,
Jannot AS, dePontual L, Henrion-Caude A, Lyonnet S, Verheij JB, Hofstra RM,
Antinolo G, Borrego S, McCallion AS, Chakravarti A. Differential contributions of
rare and common, coding and noncoding RET mutations to multifactorial
Hirschsprung disease liability. Am J Hum Genet (2010) 87:60–74
[3]Garcia-Barcelo M, Ganster RW, Lui VC, Leon TY, So MT, Lau AM, Fu M, Sham MH,
Knight J, Zannini MS, Sham PC, Tam PK. TTF-1 and RET promoter SNPs:
regulation of RET transcription in Hirschsprung’s disease. Hum Mol Genet (2005)
14:191–204
[4]Grice EA, Rochelle ES, Green ED, Chakravarti A, McCallion AS .Evaluation of the
RET regulatory landscape reveals the biological relevance of a HSCR-implicated
enhancer. Hum Mol Genet (2005) 14:3837–3845
[5]Griseri P, Bachetti T, Puppo F, Lantieri F, Ravazzolo R, Devoto M, Ceccherini I .A
common haplotype at the 50 end of the RET proto-oncogene, overrepresented in
Hirschsprung patients, is associated with reduced gene expression. Hum Mutat (2005)
25:189–195
[6]Miao X, Leon TY, Ngan ES, So MT, Yuan ZW, Lui VC, Chen Y, Wong KK, Tam PK,
Garcia-Barcelo M. Reduced RET expression in gut tissue of individuals carrying risk
alleles of Hirschsprung’s disease. Hum Mol Genet (2010) 19:1461–1467
[7]Tam PKH, Garcia-Barcelo M. Molecular genetics of Hirschsprung’s disease.
Seminars in Pediatric Surgery (2004) 13, 236-248.
[8]Sangkhathat S, Kusafuka T, Chengkriwate P, Patrapinyokul S, Sangthong B,
Fukuzawa M. (2006) Mutations and polymorphisms of Hirschsprung disease
candidate genes in Thai patients. J Hum Genet (2006) 51:1126–1132.
[9]Phusantisampan T, Sangkhathat S, Phongdara A , Chiengkriwate P, Patrapinyokul S,
Mahasirimongkol S. Association of genetic polymorphisms in the RETprotooncogene and NRG1 with Hirschsprung disease in Thai patients. Journal of
Human Genetics (2012) 57: 286–293.