Supplemental Experimental Procedures
Flow cytometry analysis of ICAM-1 expression on Treg and Tconv cells, CD11b and IL-10 receptors on
neutrophils. ICAM-1 expression was analyzed on unstimulated, LPS- or CD3/CD28-stimulated Treg or Tconv cells
using flow cytometry. T cells were incubated for 0-48 h and then stained with mAbs. CD11b expression was
analyzed on unstimulated neutrophils or neutrophils incubated with LPS- or CD3/CD28-stimulated Treg cell. For
immunostaining, ICAM1-PE (LB-2, BD Pharmingen, San Jose, CA, US), CD11b-PE (D12, BD Pharmingen) and
respective mouse isotype control was employed (IgG2a-PE, DAK-G05, Daco A/S, Glostrup, Denmark). IL-10
receptors expression was analyzed on unstimulated, LPS (100 ng/mL) or hIL-10 (5 ng/mL) stimulated neutrophils (5
h). For immunostaining, mouse anti-IL10RA mAb (2 g/mL, 37607.11, Abcam, Cambridge, UK) and secondary
antibody conjugated with PE (1:10, goat anti-mouse, Daco A/S) were used. As a negative secondary antibody
control, PE-conjugated mouse IgG2a was used (DAK-G05, Daco A/S). After 30 minutes of incubation, samples were
washed, fixed with 1% PFA and analyzed (LSRII, BD, San Jose, CA, US).
Microscopy. For quantitative immunofluorescence analysis, cells cultured on Biocoat 96-well black/clear plate
coated by poly-D-Lysine cellware (Becton Dickinson Labware, San Jose, CA, US ) or cells transferred from Ubottom plates to gelatin-coated microscope slides by cytospine were perfused with PBS containing 4% (w/v)
paraformaldehyde for 20 min at 21C. Fixed cells were extensively washed with PBS and blocked with 10% rabbit
normal blocking serum (Santa Cruz Biotechnology, Santa Cruz, CA, US) supplemented with 3% TritonTM X-100
(Sigma-Aldrich, St. Louis, MO, US) for 45 minutes at 21C. Next, cells were washed and incubated with unlabeled 5
g/mL anti-human IL-10 mAbs (rat, clone JES3-9D7, Invitrogen, Waltham, MA, US) or rat IgG2b-negative isotype
control (Invitrogen) in PBS supplemented with 1.5% normal blocking rabbit serum and 0.3% Triton X-100 and
0.01% sodium azide, overnight at 4C in a wet chamber. Subsequently, cells were washed in PBS three times and
secondary fluorescent antibody (rabbit pre-adsorbed polyclonal TRITC, Abcam, 1:100) supplemented with 1.5%
normal blocking rabbit serum and 0.3% Triton X-100 and 0.01% sodium azide were added for 1 h at 21C. For
double staining, cells were in parallel incubated with primary direct antibody CD15-FITC (MMA, 0.00625mg/mL,
BD Pharmingen) or CD18-FITC (L130, 0.00625 mg/mL, BD Pharmingen) and washed three times in PBS.
Alternatively, neutrophils were incubated in parallel with unlabeled 5 g/mL anti-human IL-10 mAbs (rat, JES39D7, Invitrogen) and 1 g/mL Annexin V (H3, Santa Cruz Biotechnology) or rat IgG2b negative isotype control for
IL-10 (Invitrogen). Rabbit pre-adsorbed polyclonal TRIC (1:100; Abcam) and goat pre-adsorbed polyclonal FITC
(1:100; Abcam) secondary fluorescent antibodies were used. For fluorescent DNA nuclei staining, Hoechst 33342
(fixed cells on the 96-well plate; 1 g/mL in PBS, Sigma Aldrich) or DAPI (fixed cells on the micro slides; 1.5
g/mL UltraCruz Mounteining Medium, Santa Cruz Biotechnology) were used. Images were acquired using
confocal microscope BD PathwayTM Bioimager 850 with AttoVision 1.5.3 software (BD Bioscience, San Jose, CA,
US). For quantitative analysis of IL-10-positive neutrophils, sixteen sites per well (Biocoat 96-well black/clear plate)
were analyzed using Olympus 20×0.75 NA objective. To measure fluorescence intensity, cells were cytospined
(300xg, 10min) on gelatin-coated microscope slides, and sixteen sites per microscope slide were analyzed using
Olympus PlanApo N 60x1.42 oil objective and IPLab Pathway 4.0 software (BD Bioscience, San Jose, CA, US).
Fluorescence intensity was determined as the Average fluorescence (avg. area), the sum of the fluorescence from all
segments divided by the number of segments.1 The average fluorescence was calculated using at least one hundred
single cells taken from four independent experiments. The level of baseline fluorescence was established individually
for each experiment. Nonspecific fluorescence (signal noise) was electronically diminished to the level when
nonspecific signal was undetectable.
The intracellular localization of IL-10 was analyzed by confocal microscopy (Nikon D-Eclipse C1) using
EZ-C1 v. 3.6 software. Image analysis and volume rendering was performed using NIS-elements Ar software
(Nikon, Tokyo, Japan).
The visualization of live cell interactions between neutrophils and LPS-activated Treg cells was performed
on 8-well glass chamber slides (Nalge Nunc International, Waltham, MA, US). During the course of 21 hours,
neutrophil-Treg cell interactions were imaged at five time points (1, 3, 5 and 7 hour intervals) with a Zeiss Axiovert
200 inverse microscope with a Zeiss Plan-apochromat 63x/1.43 oil differential interference contrast objective
(Göttingen. Germany). Additionally, after 21-h incubation cells were fixed and labeled with CD18-FITC, DNADAPI, IL-10-TRITC antibodies as described above, and images were acquired using Zeiss Axiovert 200 inverse
microscope with different settings of filters.
Western blot analysis. After incubation of neutrophils with unstimulated or stimulated Treg cells at a ratio of 50:1
for 21 h, the cells were centrifuged (1min, 12000xg) and lysed in the ice-cold RIPA lysis buffer (1%Triton X-100,
20mM Tris, 150mM NaCL, pH 7.4) containing a 1mM PMSF, 5 mM NaF, 2 mM activated sodium ortovanadate,
1mM EGTA, 1mM EDTA, 1% protease inhibitor cocktail for 30 min on ice (all reagents were purchased from
Sigma-Aldrich). The protein concentration in the lysates was determined using an RC DC Protein Assay Kit
(BioRad, Hercules, CA, US). Cell lysates containing the same amount of proteins were run on a 10% SDS-PAGE
minigel and the proteins were transferred to PVDF membranes (BioRad) at 35 mA, 4C for 18 hours.
The
membranes were blocked with 1% BSA and 1% PEG 3500 with 10 mM NaF in 2 x TBS-Tween 20 for 2 hours (all
reagents from Sigma-Aldrich) and then incubated at room temperature for 2 hours with primary mouse anticytochrome c (7H8.2C12, BD Pharmingen) (1:500) and mouse IgG anti-β actin (Sigma-Aldrich) (1:4000) antibodies.
The membranes were then washed 5 times in TBS-Tween 20, incubated with HRP-conjugated goat anti-mouse IgG
(1:1000, Sigma-Aldrich) at room temperature for 1 hour and washed. The proteins were visualized using an
immunoblotting-enhanced chemiluminescence system (ECL, Santa Cruz Biotechnology). The densitometric
scanning of the blots and the analysis of the visualized bands were performed using a Fluoro-Chem Multi Image FC
Cabinet (Alpha Innotech Corporation, San Leandro, CA, US) and analyzed with AlphaEaseFC software, version
3.1.2.
ELISA. IL-10, was measured in supernatants of 5-h incubations of neutrophils with unstimulated or stimulated Treg
cells using ELISA Kits (Bender MedSystems, Vienna, Austria). The detection limit was 0.39 pg/mL.
RNA isolation and real-time quantitative PCR. Unstimulated or stimulated Treg cells were cocultured with
neutrophils at a ratio of 1:50 for 5 h. T cells were then removed with CD2 microbeads (Miltenyi Biotec, Bergisch
Gladbach, Germany). Total RNA was isolated with an RNeasy Mini Kit (Qiagen, Limburg, Netherlands) according
to the manufacturer’s instructions, and treated with RNase-free DNase I (Qiagen) to remove contaminating genomic
DNA. Following this, 1 µg of total RNA was reverse transcribed to cDNA with random hexamers and M-MMLV
reverse transcriptase using a RT2 First Strand Kit (Qiagen). Real time RT-PCR was performed to assess the
expression levels of mRNA for IL-10, HCAR3 (Puma), NCF-2 (NOXA), GAPDH and -actin using gene specific
primer sets (IL-10; Refseq Accession number NM_000572, HCAR3; NM_006018, NCF-2; NM_000433, GAPDH;
NM_002046, and -actin; ACTB, NM_001101). Reaction was performed using RT 2 SYBR Green ROX qPCR
Mastermix to which set of gene specific primers was added. cDNA synthesized from Human XpressRefTM
Universal Reference Total RNA (SA Bioscience, Limburg, Netherlands) was used as a positive control. Real time
RT-PCR was performed using 7500 Real Time PCR Applied Biosystem (Waltham, MA, US), and the cycling
conditions were as follows: 95C, 15 min; 40 cycles of three stages: 95C for 30 sec, 55C for 30 sec and 72C for
30 sec. The quality of the reaction was verified by melting curve analysis, and the relative expression of the genes
was determined with software supplied by Applied Biosystem. The average expression levels of housekeeping genes,
the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and -actin (ACTB), were used for the normalization of
the cDNA samples.
Multiple Gene Profiling Microarray. Gene expression was analyzed using Human apoptotic RT2 Profiler PCR
Array (SuperArray, USA). RT-PCR was performed according to the manufacturers recommendations and tested
cDNA was amplified in the presence of 84 specific primers (RefSeq accession numbers presented in the
supplementary Table 1), coated in 96-well microtiter plates. Reaction was performed on an Applied Biosystem 7500
Real Time PCR. Data from real-time PCR were calculated using the Ct method and the PCR Array Data Analysis
Template v3.0 (SuperArray, Limburg, Netherlands) as previously described.2
Chromatin immunoprecipitation (ChIP) assays. Chromatin immunoprecipitation was performed using EZ-Magna
ChIP™ A/G Kit (Millipore, Darmstadt, Germany) according to the manufacturer’s protocol. To better visualize
changes in chromatin reorganization, neutrophils were incubated with Treg cells for 21 h, and then negatively
separated by magnetic beads. Briefly, neutrophils were fixed with formaldehyde (1% PBS, 10 min., room temp.) to
generate protein-DNA crosslinks. Neutrophils (4x106 cells) were then lysed and chromatin was released from the
nuclei and sheared by sonication at 85% amplitude by 0.5 sec. on - 1 sec. off pulses (Ultrasonic Homogenizer
Sonoplus mini 20, Banderin, German) to obtain DNA fragments of 200-1000 bp. The efficiency of sonication and
the DNA analysis was performed using commercially available Agilent High Sensitivity DNA kit (2100 Bioanalyzer,
Agilent 2100 expert software, Santa Clara, CA, US). 3 L of anti-trimethyl-Histone H3 antibodies (H3K4me3, clone
MC315, ChIP qualified antibody, Millipore), 2 L of anti-acetyl-Histone H3 antibodies (Lys4) (H3Ac Lys4, ChIP
qualified antibody, Millipore), 1 g of mouse anti-CTD region of RNA Polymerase II antibodies (positive control,
Millipore) and 1 g of normal mouse IgG antibodies (negative control for non-specific immunoselection of
chromatin by immunoglobulins, Millipore) were conjugated to Protein A/G magnetic beads and used to
immunoprecipitate and isolate the crosslinked proteins with the magnetic separators (Magna GrIP Rack, Millipore).
The formaldehyde crosslinking was reversed by heat treatment, and the DNA associated with each protein was
purified and used to perform RT-PCR (SybrGreen, Applied Biosystems) for the human IL-10 promotor genomic
locus
specific
primer
forward
5’GAGTGTCCCTGCTGGTCTGTAG3’,
reverse
5’CAAGCCTTGTCTGAGATGATCC3’ (Invitrogen). To establish the background levels of ChIP experiments, the
histone modifications were quantified also at the promoter of prolactin (silent in myeloid cells) using specific
primers forward 5’AGGGAAACGAATGCCTGATT3’, reverse 5’GCAGGAAACACACTTCACCA3’).3
REFERENCES
1.
2.
3.
Dima, A.A. et al. Comparison of segmentation algorithms for fluorescence microscopy images of cells.
Cytometry A. 79, 545-559 (2011).
Hansel, N.N. et al. Analysis of CD4 T-cell gene expression in allergic subjects using two different
microarray platforms. Allergy 63, 366–369 (2008).
Tamassia, N. et al. Cutting edge: An inactive chromatin configuration at the IL-10 locus in human
neutrophils. J. Immunol. 190, 1921-1925 (2013).