Who Killed Sally Parker?
Performance Task: Students will work with a partner to perform a lab simulation to identify the
murderer in the murder of Sally Parker. Students will model the processes of restriction enzymes, gel
electrophoresis and DNA fingerprinting.
Background: Gel electrophoresis is an easy way to separate DNA fragments by their respective sizes and
visualize them. It is a common diagnostic procedure used in molecular biological labs.
Every organism's DNA is composed of strings of four different nucleotides: G (Guanine), C (Cytosine), A
(Adenine), and T (Thymine). These strings of nucleotides are connected to one another by nucleotide pairing
(G-C and A-T) to form the two-stranded DNA molecule that makes up the chromosome. For the most part, the
order - or sequence - of these base pairs is very similar from one individual to another. However, there are
regions of DNA that are highly variable in length and/or sequence and therefore are different from individual to
individual (except in identical twins whose DNA is identical). These variable regions of DNA are typically used
in DNA fingerprinting.
A DNA fingerprint is made by taking a sample of DNA - which can be taken from nuclear or mitochondrial
DNA found in almost every living cell - making copies of the extracted DNA, and isolating certain known base
pair sequences. Since the fragment lengths starting with these known sequences differ in every person, they can
be used to help determine identity. A DNA fingerprint looks at only a small number of base pair sequences
contained in a person's total DNA. Nevertheless, the differences between the DNA in different people are such
that even this small number of sequences can eliminate a large majority of other people in determining an
individual’s identity. In DNA fingerprinting, the DNA is isolated, cut using restriction enzymes and sorted by
size using gel electrophoresis. DNA is placed in a gel and an electrical charge is applied to the gel. The negative
charge is at the top and the positive charge is at the bottom. Because DNA has a slightly negative charge, the
pieces of DNA will be attracted to the bottom. The smaller pieces move more quickly towards the bottom than
the larger pieces. The DNA can then be analyzed.
The rate at which the DNA will move toward the positive pole is slowed by making the DNA move through an
agarose gel. The gel is a buffer solution (which maintains the proper pH and salt concentration) with 0.75% to
2.0% agarose added. The agarose forms a porous lattice in the buffer solution and the DNA must slip through
the holes in the lattice in order to move toward the positive pole. This slows the molecule down. Larger
molecules will be slowed down more than smaller molecules, since the smaller molecules can fit through the
holes easier. As a result, a mixture of large and small fragments of DNA that has been run through an agarose
gel will be separated by size.
Materials Needed: Direction packet, pencils, chart paper, scissors, markers, tape
Technology applied: Gel Electrophoresis
Scenario:
Sally Parker was a nurse who worked at Cedars-Sinai Medical Center in Los Angeles, CA. On June 5th 2014, at
4:15 a.m. her body was found in a closet in the ward she worked in on the 15th floor of the hospital. She had
been beaten to death by a blunt object. Her autopsy report stated that the cause of death was blunt force trauma
to the head. Forensic investigation found skin cells beneath her nails that were not her own. This led
investigators to assume that she had scratched her assailant during the attack. It is unknown if an injury was left
behind.
The last time she was seen alive was at 11:55 p.m. on the night of June 4th right before she was due to clock out
at the end of her shift. She had worked with only two patients that night, and was working on the floor with two
other nurses and one doctor. A custodian was also on the floor at the approximate time of the murder. Key
codes are needed to enter and exit the ward that Ms. Parker was working on. She typed in her key code at
11:59, but camera evidence shows that the door was never opened, and that she never left the ward. No other
key codes were entered between the times of 9:45 p.m. and 4:15 am when her body was discovered. All
windows were locked, and there is only one entrance and one exit to the ward.
Suspects:
Suspect #1: Mrs. Helen Carter- Patient in the ward- Claims to have last seen Ms. Parker at around 6:45 p.m. on
June 4th when she gave her medicine through her I.V. This is confirmed by Mrs. Carter’s patient care sheet. It
is possible that Mrs. Carter may have seen her after her medications were administered, but her medications
make her very groggy and unaware of her surroundings at times.
Suspect #2: Mr. James Love- Patient in the ward- Claims to have seen Ms. Parker at about 11:55 p.m. as she
checked his heart rate and said goodnight to him. His patient care sheet does not confirm this visit, although it
has been noted that nurses do not always notate each time heart rate is checked in patient forms. He is the last
confirmed suspect to have contact with the victim. It is noted that he had a large scratch on his face. He said he
scratched it while changing clothing the previous day.
Suspect #3: Ms. Jasmine Renaldo- Nurse – Known to not get along with Ms. Parker. It was confirmed by
witnesses and camera evidence that Ms. Renaldo and Ms. Parker were seen arguing in the cafeteria at about
7:00 p.m. on the evening of June 4th.
Suspect #4: Ms. Hannah Joy Matter- Head Nurse- Claims to have been working on the computer in a back
room of the ward from 5:45 p.m. until 2:30 a.m. She is the one who discovered Ms. Parker’s body in the closet
at about 4:15 a.m. She claims to have had no contact with Ms. Parker at any point that evening. The only
witness to her presence in the back of the ward was by Mr. Robert McRoy, the custodian, who validated her
story.
Suspect #5: Dr. Perry Fargo- Doctor – Confirmed to have been dating Ms. Parker in the weeks prior to her
murder. This relationship was against hospital policy, and could have led to the termination of both individuals.
Dr. Fargo is married, and his wife was unaware of the relationship between her husband and Ms. Parker prior to
Ms. Parker’s murder.
Suspect # 6: Mr. Robert McRoy- Custodian- Suspect claims to have been cleaning the opposite end of the ward
at the time of Ms. Parker’s death. He said he talked to Ms. Matter while she worked, and continued his work in
the other parts of the ward. He says that Ms. Renaldo was also having an affair with Dr. Fargo, and that Ms.
Parker had become aware of the relationship earlier that evening. He claims to have overheard them arguing
when they both returned from the cafeteria around 7:10 p.m. Investigation reveals a scratch on his left arm. He
claims to have received it while fixing one of the patient beds earlier in the evening.
Procedures:
1. Cut out one of the seven DNA fragment sample strips from the DNA Results sheets, making sure to leave the
source of the DNA (Crime Scene DNA, Suspect #1, Suspect #2, etc) attached.
2. Following the base pairing rules, please fill in the complementary base pairs for each of the 7 DNA strands (write
small!)
3. Examine each DNA fragment strip closely, looking for the sequence AATT. This is a restriction site, where
enzymes will cut the DNA into even smaller fragments. Use a pencil to mark these sites, with a line between the
inner A and the T (AA│TT). Make sure to draw the line through both base pairs.
4. Use the scissors to cut across the fragments at those sites. Count and label the number of base pairs contained in
each of the DNA fragments.
5. Use the chart paper provided by your teacher to make a large restriction map (like the chart shown above). The
enlarged chart will simulate a gel electrophoresis chamber. Use a ruler or meter stick to make sure all of the
lengths are the same. Draw bands of different colors (one color/per suspect) where they belong on the restriction
map.
6. Once you have created the restriction map, you should be able to clearly state who murdered Ms. Sally Parker.
Circle the murderer on your restriction map. Be sure to include murderer name.
7. On THE BACK of your restriction map, please write the names of all of the suspects and organize the pieces of
DNA that go with each suspect from largest to smallest. Make sure to include the crime DNA. Tape the pieces on.
Crime Scene DNA Crime Scene DNA Crime Scene DNA Crime Scene DNA Crime Scene DNA Crime Scene DNA
AAATTCGGTACGTAATTGCATTTGACAATTCGACGTACGTTCCAATTGTACTGACGTAAATTCGTGCCAATTGACTCACGGTACGATCA
Suspect #1 DNA Suspect #1 DNA Suspect #1 DNA Suspect #1 DNA Suspect #1 DNA Suspect #1 DNA Suspect #1 DNA
AATCTTAATTCTATCATCTGATAATTACTGATAATTCCCTTCTACTCAATTCATAATTCGTACCTACTTTCCATCCTAATTCTTATAATTCG
Suspect #2 DNA Suspect #2 DNA Suspect #2 DNA Suspect #2 DNA Suspect #2 DNA Suspect #2 DNA Suspect #2 DNA
AAAAATCGGGTGAATTCGCGTGGCAGAACGTTAATTCGCCGGAAATGGCGTGGCCAATTCGGTCGTGCTACGTACGTACGTAAACGT
Suspect #3 DNA Suspect #3 DNA Suspect #3 DNA Suspect #3 DNA Suspect #3 DNA Suspect #3 DNA Suspect #3 DNA
AAATTCGGTACGTAATTGCATTTGACAATTCGACGTACGTTCCAATTGTACTGACGTAAATTCGTGCCAATTGACTCACGGTACGATCA
Suspect #4 DNA Suspect #4 DNA Suspect #4 DNA Suspect #4 DNA Suspect #4 DNA Suspect #4 DNA Suspect #4 DNA
TACGGAATTGTGACGTAATTCGTTGCCAAATTGCAGGATGCAATTGACGGGGGGTAATTCCATCATCATACTAATTTGGGAATTGACC
Suspect #5 DNA Suspect #5 DNA Suspect #5 DNA Suspect #5 DNA Suspect #5 DNA Suspect #5 DNA Suspect #5 DNA
AATTCGTTGCATCCCGAATTGACGTACGTACGTAATTCGTGGGATCAATTAGCTCAAGTCAAGGTCAACCGTAATTCGCGCGCTGTCT
Suspect #6 DNA Suspect #6 DNA Suspect #6 DNA Suspect #6 DNA Suspect #6 DNA Suspect #6 DNA Suspect #6 DNA
CCAATTGTGGATAACGTGGAATTGCGGATCAAAAATTCGTACGTTTAGCGATGCAGTGAAATTCGGGTCAGTACGTCGGGAATTCTT