Reaction and catalyst engineering to exploit kinetically controlled whole-cell multistep
biocatalysis for terminal FAME oxyfunctionalization
Manfred Schrewe, Mattijs K. Julsing, Kerstin Lange, Eik Czarnotta, Andreas Schmid, and
Bruno Bühler*
Laboratory of Chemical Biotechnology, Department of Biochemical and Chemical
Engineering, TU Dortmund University, Dortmund, Germany
*Corresponding author. Mailing address: Laboratory of Chemical Biotechnology,
Department of Biochemical and Chemical Engineering, TU Dortmund University, EmilFigge-Strasse 66, 44227 Dortmund, Germany. Phone: +49 231 755 7384. Fax: +49 231 755
7382.
E-mail: bruno.buehler@bci.tu-dortmund.de
Supporting Information
Material and methods
Strains and plasmids
Strains and plasmids used in this study are listed in Table S1. E. coli DH5α was used for
cloning purposes. For expression and biotransformation experiments, E. coli W3110 was
transformed with different plasmids following standard procedures (Sambrook and Russell
2001).
Table S1: Bacterial strains and plasmids used in this study
Strain or Plasmid
Characteristics
Reference
Strain
fhuA2 (argF-lacZ)U169 phoA glnV44 80 (lacZ)M15
gyrA96 recA1 relA1 endA1 thi-1 hsdR17
F- -1 rph-1 IN(rrnD-rrnE)1
(Hanahan 1983)
pCOM10
alkane responsive broad-host-range vector; PalkB ; alkS
(Smits et al. 2001)
pGEc47
contains genes necessary for growth on alkanes
(alkBFGHJKL and alkST) in the broad-host-range vector
pLAFR1, Tcr
blunt-end subcloning vector, Kmr
(Eggink et al. 1987)
E. coli DH5
E. coli W3110
(Bachmann 1987)
Plasmid
pSMART-HCKan
pBT10
pBTL10
pBT10M
contains the alkBGT genes inserted into the broad-host
range vector pCOM10
contains alkL inserted into pBT10
Lucigen Corporation
(Middleton, WI, USA)
(Schrewe et al. 2011)
(Julsing et al. 2012)
this study
pSMART-JKL
MCS from pUC18 introduced into pBT10 downstream of
alkG
contains alkJKL in pSMART-HCKan
pSMART-JL
deletion of alkK in pSMART-JKL
this study
pBTJL10
contains alkJL in pBT10
this study
pJ10
contains alkJ in broad-host range vector pCOM10
this study
this study
Construction of alkBGTJL- and alkJ- expression vectors
Standard techniques were used for restriction analysis, cloning, and agarose gel
electrophoresis (Sambrook and Russell 2001). Phusion High-Fidelity DNA Polymerase
obtained from Finnzymes Oy (Espoo, Finland) was used for all PCR reactions. Restriction
endonucleases were purchased from Fermentas GmbH (St. Leon-Rot, Germany) or New
1
England BioLabs GmbH (Frankfurt, Germany). All primers were purchased from Eurofins
MWG (Ebersberg, Germany). Successful cloning was confirmed by sequencing by Eurofins
MWG.
Plasmid pBTJL10 was constructed based on the alkane responsive alkBGT-expression vector
pBT10 (Table S1) (Schrewe et al. 2011). A multiple cloning site (MCS) from pUC18
(Yanisch-Perron et al. 1985) was introduced in the SalI restriction site of pBT10 downstream
of alkG. For this purpose, the MCS from pUC18 was amplified via PCR using primers 1 and
2 (Table S2). The resulting PCR product was digested with XhoI and ligated into pBT10 cut
with SalI (digestion with XhoI and SalI yields compatible ends). The orientation of the MCS
was identified via sequencing and the resulting vector was designated pBT10M.
The DNA fragment containing alkJKL (encoding the alcohol dehydrogenase, the acyl-CoA
synthetase, and an outer membrane protein from P. putida GPo1) was amplified from
pGEc47 (Eggink et al. 1987) via PCR using primers 3 and 4 (Table S2). Primer 3 contained a
stop-codon in frame of the residual rest of alkH in pBT10 in order to prevent the formation of
long non-sense gene-products. The PCR product was cloned into the blunt-end cloning vector
pSMART-HCKan (Lucigen Corporation, Middleton, WI, USA) giving pSMART-JKL. Large
parts of the alkK gene including the start-codon were deleted by digestion with BmgBI.
BmgBI cuts three base pairs upstream of alkK and inside of alkK, resulting in the deletion of
1251 of 1644 base pairs of the gene. Subsequently, the vector was re-ligated and designated
pSMART–JL.
In order to obtain the final alkBGTJL-expression vector, the alkJL fragment was excised from
pSMART-JL by digestion with XmaI and PspXI and ligated into pBT10M cut with XmaI and
SalI (digestion with PspXI and SalI yields compatible ends), resulting in pBTJL10.
The plasmid pJ10 was constructed based on the alkane responsive broad-host-range vector
pCOM10 (Smits et al. 2001). The DNA fragment containing alkJ was amplified from
2
pBTJL10 via PCR using primers 5 and 6 (Table S2). The resulting PCR product was digested
with EcoRI and SalI and ligated into pCOM10 cut with the same enzymes, resulting in pJ10
Table S2: PCR Primers used
Entry
Primer
Sequence (5’ to 3’)
Remark
1
MCS-f
GCTACTCGAGATTACGAATTCGAGCTCGGTAC
XhoI site underlined
2
MCS-r
CAGTCTCGAGCCATATGCGGTGTGAAATAC
XhoI site underlined
3
JKL-f
CCCGGGTGAAAGGTGAAGCAGTTGATTGG
4
JKL-r
GCTCGAGGGGGATGAGGAGCATTATTTG
XmaI site underlined;
stop-codon in bold
PspXI site underlined
5
J-f
CGCCGGAATTCATGTACGACTATATAATCGTTGGTGC
EcoRI site underlined
6
J-r
ACGCGTCGACTGAAACCGTCCGAA TCTATG
SalI site underlined
Determination of Partition Coefficients (KP)
Partition coefficients were determined for aqueous-organic 2-LP-systems using the solvents
BEHP, ethyl oleate, and dibutyl phthalate. Different concentrations of DAME (100–
1000 mM), HDAME (50–200 mM), and ODAME (25–100 mM) were added to the solvents,
of which 1 mL was added to 1 mL KPi buffer in a pyrex tube. All samples were prepared in
triplicates. The pyrex tubes were closed and incubated over night at 30°C and 400 rpm in an
orbital shaker. Then, emulsions were transferred into 2 mL Eppendorf tubes and centrifuged
at 17,000 x g for 5 min. The organic phase was diluted (1:100) with diethyl ether containing
n-dodecane (0.2 mM) as internal standard and analyzed via GC. The aqueous phase was
removed using a syringe, transferred to a new tube, and organic compounds were extracted
with diethyl ether (1:1 ratio). After vortexing for 1 min, the Eppendorf tube was centrifuged
at 17,000 x g and 4°C for 5 min and the organic phase was dried with anhydrous sodium
sulphate, centrifuged, and transferred into GC-vials for analysis.
3
Results
Apparent kinetics
Figure S1 shows Michalis-Menten plots to investigate kinetics and determine the apparent
kinetic parameters for the individual reaction steps catalysed by AlkBGT-containing cells.
The experimental data was fitted using the program GraphPad Prism, Version 5.02
(GraphPad Software, Inc., La Jolla, USA).
Figure S1: Apparent Michaelis-Menten-like kinetics for whole-cell conversions of DAME (A), HDAME (B),
and ODAME (C) catalyzed by resting E. coli W3110 (pBTL10). Biomass concentrations in KPi buffer (50 mM,
pH 7.4) containing 1% (w/v) glucose were 0.25, 0.18, and 0.28 g CDW L-1 for DAME, HDAME, and ODAME
conversions, respectively. DAME, dodecanoic acid methyl ester; HDAME, 12-hydroxydodecanoic acid methyl
ester, ODAME, 12-oxododecanoic acid methyl ester.
Partition coefficients (KP) of DAME, HDAME, ODAME, and DDAME in 2LP systems
with different carrier solvents
Table S3 shows KP`s for DAME and its oxidation products with BEHP, ethyl oleate, dibutyl
phthalate, and octanol (logKP,oct) as organic phases. As aqueous DAME concentrations were
below the detection limit (~5 µM), 106 is given as a lower boundary for respective KP values.
4
Table S3: Partition coefficients of DAME and its oxygenation products in different organic/aqueous 2-LP
systems without cells.
BEHP
Ethyl oleate
Dibutyl phthalate
DAME
logPocta)
7.60
8.51
4.50
5.41
DAME
> 106
> 106
> 106
-
HDAME
2045
1987
2087
2314
ODAME
6035
5209
7419
5841
DDAME
18b)
n.d.
n.d.
15c)
Performed in KPi buffer (50 mM, pH 7.4) containing 1% (w/v) glucose; n.d.: not determined; DAME,
dodecanoic acid methyl ester; HDAME, 12-hydroxydodecanoic acid methyl ester, ODAME, 12-oxododecanoic
acid methyl ester; DDAME, dodecanedioic acid monomethyl ester.
a)
values from www.chemspider.com
b)
obtained from a biotransformation using 25% (v/v) DAME in BEHP
c)
obtained from a biotransformation using DAME as organic phase
(Co)-expression of alkJ
Expression of AlkJ with different constructs was verified by SDS-PAGE analysis of crude
cell extracts (Figure S2). Whereas prominent bands were found fof AlkB and AlkJ, AlkG and
AlkT could not be visualized as described before (Schrewe et al. 2011). Similar AlkB levels
were obtained with pBT10 and pBTJL10, whereas the latter construct gave an approximately
4-fold lower AlkJ level as compared to pJ10
Figure S2: SDS-PAGE (12%) of crude cell extracts from E. coli W3110 carrying pJ10 (containing alkJ),
pBTJL10 (containing alkBGT and alkJ), or pCOM10 (control) harvested before (-) and 4 h after induction (+).
PageRuler #26614 (Fermentas GmbH, St. Leon-Rot, Germany) was used as molecular weight marker.
5
Conversion of DAME, HDAME, and ODAME in resting-cell assays
Figure S3: Oxygenation of DAME (A), HDAME (B), and ODAME (C) with resting E. coli W3110 (pBTL10)
and oxidation of DAME (D), HDAME (E), and ODAME (F) with resting E. coli W3110 (pBTJL10). Biomass
concentration: 0.95-1.0 gCDW L-1 in KPi buffer (50 mM, pH 7.4) containing 1% (w/v) glucose. 12Hydroxydodecanoic acid (HDA) hardly accumulated to concentrations above 0.01 mM and is added up with the
HDAME concentration.
DAME, dodecanoic acid methyl ester; HDAME, 12-hydroxydodecanoic acid methyl ester, ODAME, 12oxododecanoic acid methyl ester; DDAME, dodecanedioic acid monomethyl ester; DDA, dodecanedioic acid.
6
Pairwise addition of DAME, HDAME, ODAME, and DDAME in resting-cell assays
Figure S4: Pairwise addition of DAME and HDAME (A), DAME and ODAME (B), HDAME and ODAME
(C), DAME and DDAME (D), HDAME and DDAME (E), and ODAME and DDAME (F) to resting E. coli
W3110 (pBTL10). Biomass concentration: 0.35 – 0.85 gCDW L-1 in KPi buffer (pH 7.4) containing 1% (w/v)
glucose. 12-Hydroxydodecanoic acid (HAD) hardly accumulated to concentrations below 0.01 mM and is added
up with the HDAME concentration.
DAME, dodecanoic acid methyl ester; HDAME, 12-hydroxydodecanoic acid methyl ester, ODAME, 12oxododecanoic acid methyl ester; DDAME, dodecanedioic acid monomethyl ester; DDA, dodecanedioic acid.
7
Irreversible HDAME oxidation catalyzed by AlkJ
Fig. S5: Influence of AlkJ on HDAME (A and C) and ODAME (B and D) conversion by resting cells. The
compounds were added to E. coli W3110 (pCOM10) lacking AlkJ (A and B) and E. coli W3110 (pJ10)
containing AlkJ (C and D). Biomass concentration: 1.0 gCDW L-1 in KPi buffer (pH 7.4) containing 1% (w/v)
glucose. 12-Hydroxydodecanoic acid (HAD) and dodecanedioic acid (DDA) hardly accumulated to
concentrations below 0.01 mM.
HDAME, 12-hydroxydodecanoic acid methyl ester, ODAME, 12-oxododecanoic acid methyl ester; DDAME,
dodecanedioic acid monomethyl ester.
8
References:
Bachmann BJ. 1987. Derivatisations and genotypes of some mutant derivatives of
Escherichia coli K-12. In: Neidhardt CF, editor. Escherichia coli and Salmonella
typhimurium - Cellular and molecualar biology p1190-1219.
Eggink G, Lageveen RG, Altenburg B, Witholt B. 1987. Controlled and functional
expression of the Pseudomonas oleovorans alkane utilizing system in Pseudomonas
putida and Escherichia coli. J. Biol. Chem. 262(36):17712-17718.
Hanahan D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol.
166(4):557-580.
Julsing MK, Schrewe M, Cornelissen S, Hermann I, Schmid A, Bühler B. 2012. Outer
membrane protein AlkL boosts biocatalytic oxyfunctionalization of hydrophobic
substrates in Escherichia coli. Appl. Environ. Microbiol. 78(16):5724-5733.
Sambrook J, Russell DW. 2001. Molecular cloning - A laboratory manual. Cold Spring
Harbor (NY): Cold Spring harbor Laboratory Press.
Schrewe M, Magnusson AO, Willrodt C, Bühler B, Schmid A. 2011. Kinetic analysis of
terminal and unactivated C-H bond oxyfunctionalization in fatty acid methyl esters by
monooxygenase-based whole-cell biocatalysis. Adv. Synth. Catal. 353(18):3485-3495.
Smits THM, Seeger MA, Witholt B, van Beilen JB. 2001. New alkane-responsive expression
vectors for Escherichia coli and Pseudomonas. Plasmid 46(1):16-24.
Yanisch-Perron C, Vieira J, Messing J. 1985. Improved M13 phage cloning vectors and host
strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33(1):103119.
9