nT-nG paper, 2013, supplement
Supplemental Fig. S1 ROSAnT-nG targeting vector. The targeting vector used to make the ROSAmT-mG
mice (Muzumdar et al. 2007) was kindly made available to us by Dr. Liqun Luo from Stanford University
(Addgene plasmid #17787). Conversion of this into the ROSAnT-nG vector and subsequent verification was
performed as a part of the laboratory section of the 2010 senior-level Gene Expression course
(VTMB422) at Montana State University. The region from Sna BI to Asc I was inserted into Eco RV/Asc
I-digested pBluescript KS+ (Stratagene) containing a modified multiple cloning site (Kpn I-Eco RV-Eco
RI-Asc I-Sac I). The resulting plasmid was entitled “KS+ mT-mG” (panel A). Fragments of KS+ mT-mG
that contained either mT (Kpn I to Hind III) or mG (Hind III to Eco RI) were inserted into PBS+
(Stratatgene; panels B & C, respectively) to use in the following steps. PCR amplification of tdT was
performed with the following primers: tdT forward, 5’-tataccggtccaccatggtgagcaagggagaggaggtc-3’ and
tdT reverse, 5’-tatctcgagcttgtacagctcgtccatgccgta-3’. This primer pair adds a 5’ Age I (A) restriction site,
followed by a strong translation initiation sequence and a 3’ Xho I (X) site, which allowed ligation into
Bsp EI/Xho I (B/X) of the mT subclone. This eliminated the MARCKS domain and the stop codon (panel
D).
mG
was
modified
by
PCR
amplification
tataccggttcatcaccgaccatgggatctgtgagcaagggcgaggag-3’
and
EGFP
using
EGFP
forward,
reverse,
5’5’-
tatgcggccgctcttgtacagctcgtccatgccgag-3’. This primer pair adds a 5’ Age I (Ag) restriction site, followed
by a strong translation initiation sequence, kills a Bam HI site in EGFP, and adds a 3’ Not I (N) site.
Ligation of this PCR product into Bsp EI/Not I (B/N) of mG removed the 5’ MARCKS domain and the
stop codon from EGFP. Addition of amino acids 300-350 of human SRm160 (SRm160) (Wagner et al.
2003) to the C-termini of tdT and EGFP was as follows. Separate primer pairs were designed to amplify
SRm160 for insertion into tdT or EGFP. Each primer pair modified SRm160 by insertion of different
synonymous mutations and a single non-synonymous mutation (in primer SRm160-TdT-reverse) into the
SRm160 coding sequences designated for insertion into TdT or EGFP. The mutations were added to avoid
potential homologous recombination in bacteria between SRm160 sequences in TdT and EGFP. PCR
amplification of SRm160 from a human leukocyte cDNA library (a gift from M. Quinn, Montana State
University)
was
performed
with
the
following
1
primer
pairs:
SRm160-tdT-forward,
5’-
tatgtcgaccggcggcatagatcagataaaatgtattcaccaagaaggcgaccaagtccaagaagacggccatct-3’
and
SRm160-tdT-
reverse, 5’-tatgtcgacttatgaacgtcttcgtcgcctatctggcgatctgctccttctgtgccttgggggaggaggcatccttct-3’.
SRm160-
EGFP-forward, 5’-tatcggccgacgccataggtccgacaagatgtactcacctcgaaggcggcctagcccacgaaggcggccatct-3’ and
5’-
SRm160-EGFP-reverse,
tatgtcgacttaggaacgtctccttcgtctaactggagacctactccttcgatgcctcggtggcggaggcattcttct-3’.
The
SRm160-tdT
primer pair adds a 5’ and 3’ Sal I (S) site to SRm160, allowing in-frame insertion into Xho I at the Cterminus of tdT (panel D). The SRm160-EGFP primer pair adds a 5’ Eag I (E) and 3’ Sal I site to SRm160.
Eag I/Sal I-digested SRm160 was ligated into Not I/Xho I-digested EGFP (panel E). These plasmids
contain the nT and nG portions of the new targeting vector (panels D&E). Hind III/Eco RI (H/RI) nG
was inserted between Hind III and Eco RI sites in KS+ mT-mG, which produced KS+ mT-nG (panel F).
Kpn I/Hind III (K/H) nT was inserted between Kpn I and Hind III in KS+ mT-nG, which produced KS+
nT-nG (panel G). Finally, a fragment of KS+ nT-nG from Sgr AI (Sg) to Asc I (As), which encompassed
all modifications of the original mT-mG to nT-nG sequence (panel G) was inserted into the ROSAmT-mG
targeting vector between Sgr AI and Asc I, replacing mT-mG with nT-nG to generate the ROSAnT-nG
targeting vector. To biologically verify the expression and subcellular localization of fluorescent markers
encoded on these plasmids, the clones depicted in panels A, D, F, and G were transiently transfected into
COS7 cells, the cells were then transduced with a replication-defective adenoviral vector encoding Cre
(AdCre) to express Cre in a subset of the transiently transfected cells. Cells were photographed by
fluorescence microscopy 2 days later (panels H – J and data not shown). In all panels, the blue
fluorescence is Hoechst’s stained nuclei; red fluorescence is expression of the un-recombined (Cre-naïve)
allele; and green fluorescence is expression of the Cre-recombined allele. All of the plasmids depicted or
described here are available on request unless specifically restricted by another party. The final targeting
vector was linearized with Kpn I for electroporation into ES cells. One-hundred-fifty-two (152) G418resistant colonies were selected and analyzed, of which eight contained a correctly targeted version of the
entire cassette. One clone was selected for mouse production. Male chimeras were bred to wild-type
C57Bl/6 dams and pups bearing the ROSAnT-nG allele were selected as founders. Founders (ROSAnT-nG/+)
2
nT-nG paper, 2013, supplement
were bred to C57Bl/6 mice to establish the line. (K) Genotyping of a litter of a founder x C57Bl/6 mouse
is shown for a reaction that verifies targeted insertion (upper panel; primers “Rosa3” and “Rosa4” as
described previously: (Zong et al. 2005)) and a reaction that detects EGFP (lower panel; EGFP-forward,
5’-tagaattcatctgcaccaccggcaagctgc-3’ and EGFP-reverse, 5’-agaaagcttgtgccccaggatgttgccg-3’). Pups 1, 3,
4, and 5 were ROSAnT-nG/+; pups 2, 6, and 7 were ROSA+/+.
Muzumdar MD, Tasic B, Miyamichi K, Li L, Luo L. 2007. A global double-fluorescent Cre reporter
mouse. Genesis 45: 593-605.
Wagner S, Chiosea S, Nickerson JA. 2003. The spatial targeting and nuclear matrix binding domains of
SRm160. Proc Natl Acad Sci U S A 100: 3269-3274.
Zong H, Espinosa JS, Su HH, Muzumdar MD, Luo L. 2005. Mosaic analysis with double markers in
mice. Cell 121: 479-492.
3