MECHANISM OF CATHETER THROMBOSIS
AND APPROACHES FOR ITS PREVENTION
i
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
MECHANISM OF CATHETER THROMBOSIS
AND APPROACHES FOR ITS PREVENTION
By
JONATHAN WAI-HON YAU, B.Sc. (Hons.), M.A.Sc.
A Thesis
Submitted to the School of Graduate Studies
in Partial Fulfillment of the Requirements
for the Degree
Doctor of Philosophy
McMaster University
© Copyright by Jonathan Wai-hon Yau, July 2014
ii
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
DOCTOR OF PHILOSOPHY (2014)
McMaster University
(School of Biomedical Engineering)
Hamilton, Ontario
TITLE:
Mechanism of Catheter Thrombosis and Approaches for its
Prevention
AUTHOR:
Jonathan Wai-hon Yau
B.Sc.
(Honours)
Biochemistry
and
Biomedical
(McMaster University)
M.A.Sc. Biomedical Engineering (McMaster University)
SUPERVISOR:
Dr. Jeffrey I. Weitz, M.D.
NUMBER OF PAGES: xxv, 231
iii
Sciences
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
ABSTRACT
Medical devices, such as catheters and heart valves, are an important part of
patient care.
However, blood-contacting devices can activate the blood coagulation
cascade to produce factor (f) Xa, the clotting enzyme that induces thrombin generation.
By activating platelets and converting soluble fibrinogen to fibrin, thrombin leads to
blood clot formation. Blood clots that form on medical devices create problems because
they may foul the device and/or serve as a nidus for infection. In addition, clots can break
off from the device, travel through the circulation and lodge in distant organs; a process
known as embolization. This is particularly problematic with central venous catheters
because clots that form on them can break off and lodge in pulmonary arteries, thereby
producing a pulmonary embolism. Similarly, clots that form on heart valves can break
off and lodge in cerebral arteries, thereby producing a stroke. Therefore, anticoagulants,
blood thinning drugs, are frequently used to prevent clotting on medical devices.
Conventional anticoagulants, such as heparin and warfarin, target multiple clotting
factors. Heparin binds to antithrombin in plasma and accelerates the rate at which it
inhibits fXa, thrombin and many other clotting enzymes. Warfarin, which is a vitamin K
antagonist, attenuates thrombin generation by interfering with the synthesis of the vitamin
K-dependent clotting factors, which include fX and prothrombin, the precursor of
thrombin. In contrast to heparin and warfarin, more recent anticoagulants inhibit only a
single clotting enzyme. For example, fondaparinux, a synthetic heparin fragment, only
inhibits fXa and dabigatran, an oral thrombin inhibitor, only targets thrombin. Although
iv
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
effective for many indications, fondaparinux was less effective than heparin for
preventing clotting on catheters in patients undergoing heart interventions and dabigatran
was less effective than warfarin for preventing strokes in patients with mechanical heart
valves.
The failure of these new anticoagulants highlights the need for a better
understanding into the drivers of clotting on medical devices. Therefore, the overall
purpose of this thesis is to gain this understanding so that more rational approaches to its
prevention can be identified.
In the classical model of blood coagulation, clotting is triggered via two distinct
pathways; the tissue factor (TF) pathway or extrinsic pathway and the contact pathway or
intrinsic pathway; pathways which are initiated by fVIIa and fXIIa, respectively. The
mechanism by which medical devices initiate clotting is uncertain.
Platelet and
complement activation and microparticle formation have been implicated, which would
drive clotting via the TF pathway. Alternatively, medical devices can bind and activate
fXII, thereby initiating the contact pathway. We hypothesized that medical devices
trigger clotting via the contact pathway and induce the local generation of fXa and
thrombin in concentrations that exceed the capacity of fondaparinux and dabigatran to
inhibit them. To test this hypothesis, we used catheters as a prototypical medical device
and we used a combination of in vitro and rabbit models.
Several lines of evidence indicate that catheters initiate clotting via the contact
pathway. First, catheter segments shortened the clotting time of human plasma, and this
activity was attenuated in fXII- or fXI-deficient plasma, which are key components of the
v
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
contact pathway, but not in fVII-deficient plasma, which is the critical component of the
extrinsic pathway. Second, corn trypsin inhibitor (CTI), a potent and specific inhibitor of
fXIIa, attenuates catheter thrombosis. Third, selective knockdown of fXII or fXI with
antisense oligonucleotides attenuated catheter-induced thrombosis in rabbits, whereas
knockdown of fVII had no effect. Therefore, these results revealed the importance of the
contact pathway in device-associated thrombosis, and identified CTI or fXII or fXI
knockdown as novel strategies for preventing this problem.
Focusing on fXIIa as the root cause of medical device associated clotting, we
coated catheters with CTI using a polyethylene glycol (PEG) spacer. In addition to
unmodified catheters, other controls included catheters coated with albumin via a PEG
spacer or catheters coated with PEG alone. Compared with unmodified catheters or with
the other controls, CTI-coated catheters attenuated clotting in buffer or plasma systems
and were resistant to occlusion in rabbits.
These findings support the concept that
catheter-induced clotting is driven via the contact pathway and identify CTI coating as a
viable strategy for its prevention.
We next set out to test the hypothesis that fondaparinux and dabigatran, which
inhibit fXa and thrombin, respectively, are less effective than heparin, which inhibits
multiple clotting enzymes. Fondaparinux and dabigatran were less effective than heparin
at preventing catheter induced clotting and thrombin generation, respectively. Likewise,
in a rabbit model of catheter thrombosis, fondaparinux was less effective than heparin and
dabigatran was only effective when administered at doses that yielded plasma dabigatran
vi
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
levels similar to those found at peak in human given the drug; at trough levels, dabigatran
was no better than placebo. Finally, we also showed synergy between heparin and either
fondaparinux or dabigatran. Thus, when co-administered to rabbits in doses that on their
own had no effect, the combination of fondaparinux or dabigatran plus heparin extended
the time to catheter thrombosis.
These findings support the hypothesis that when
catheters trigger clotting via the contact pathway, fXa and thrombin are generated in
concentrations that overwhelm the capacity of fondaparinux or dabigatran to inhibit them.
Furthermore, the synergy between heparin and fondaparinux or dabigatran has clinical
implications because it explains why supplemental heparin attenuated the risk of catheter
thrombosis in patients treated with fondaparinux who underwent cardiac procedures and
it identifies the potential role of supplemental heparin in dabigatran-treated patients who
require such interventions.
In summary, we have shown that catheters trigger clotting via the contact pathway
and have identified CTI coating or fXII or fXI knockdown as viable strategies for
prevention of this problem. In addition, for prevention of catheter thrombosis, we also
have shown that heparin, which inhibits multiple coagulation enzymes, is more effective
than fondaparinux or dabigatran, which only inhibit fXa or thrombin, respectively;
findings consistent with the clinical observations.
Moreover, the synergy that we
observed between fondaparinux or dabigatran and heparin identifies supplemental heparin
as strategy for preventing catheter thrombosis in patients receiving these drugs. Taken
vii
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
together, these studies provide insight into the mechanisms of catheter thrombosis and
potential strategies for its prevention.
viii
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
ACKNOWLEDGEMENTS
I have many people to acknowledge with the completion of this thesis and my
graduate studies at McMaster University, and I would like to take this opportunity to
express my sincere gratitude to all who have helped me with my accomplishments.
First to my supervisor, Dr. Jeffrey Weitz, I would like to thank you for
establishing this project and taking me on as a student. I am very fortunate for the
opportunity to have worked with and learned from such an accomplished clinician and
researcher.
Thank you to Dr. John Brash my supervisory committee member. Your advice,
suggestions, and technical support regarding surface modifications and characterization
have been much appreciated. Also thanks to Drs. Anthony Chan and Peter Gross for
serving on my supervisory committee and for providing insightful questions and
suggestions.
During my graduate career, I have had the chance to work with many great people
from my lab and value all of their help.
First, I am grateful to Peng Liao. It has been a
pleasure to work with you during my studies. You have never hesitated to provide
helpful advice and support. Also to Jim Fredenburgh, Alan Stafford, and Beverly Leslie,
I would like to thank you for all of the guidance and advice that you gave me. Jim, you
have been an invaluable source of advice and the most patient person I have known. By
the time of this submission, you have revised 171 drafts for manuscripts, abstracts,
posters, and of course this thesis, since I began my graduate career in the lab. Alan, your
ix
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
dedication to research, coupled with your boundless enthusiasm, has been an invaluable
source of information and advice. Bev, your caring and dedication to the lab has always
been a source of comfort and relief. Thanks to the other members of the Weitz group, it
has been great to work with you. I wish you all the best of luck in your future careers.
Thank you for all the help and advice.
Thanks to my fellow BME colleagues, it was a truly memorable graduate
experience. I consider some of you, some of my closest friends.
Thank you to all of my family. Especially thanks to my parents, Eddie and Vera
for raising me to be who I am today and for instilling the values that led me to accomplish
this. Thank you for being the wonderful parents that have always supported me. To my
sister, Courtney, you have always been there for me and I am lucky to have you as a
sister.
Last, but certainly not least, to Soula Kritikos, my wife, my best friend, and my
everlasting support. Thank you for your continuous encouragement, love and support, it
means so much to me. You have been there through my accomplishments, my struggles,
and my triumphs during my PhD career. I am thankful and gracious that you are there at
the end of my PhD studies, and happy to start the next phase of our lives together.
Thank you again to all of you for being a part of this journey for me.
x
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
TABLE OF CONTENTS
ABSTRACT ............................................................................................................................................... IV
ACKNOWLEDGEMENTS ........................................................................................................................... IX
TABLE OF CONTENTS ............................................................................................................................... XI
LIST OF FIGURES AND TABLES.............................................................................................................. XVIII
LIST OF ABBREVIATIONS ....................................................................................................................... XXII
DECLARATION OF ACADEMIC ACHIEVEMENT ....................................................................................... XXV
CHAPTER 1: GENERAL INTRODUCTION ..................................................................................................... 1
1.1 OVERVIEW................................................................................................................................................ 1
1.2 BIOCOMPATIBILITY OF MEDICAL DEVICES........................................................................................................ 3
1.3 BIOMATERIAL-ASSOCIATED THROMBOSIS ........................................................................................................ 6
1.3.1 Catheter Thrombosis ..................................................................................................................... 9
1.4 INTRODUCTION TO HEMOSTASIS AND THROMBOSIS ........................................................................................ 10
1.4.1 TF pathway ................................................................................................................................. 13
1.4.2 Contact pathway ......................................................................................................................... 14
1.4.3 Intrinsic and Common pathway .................................................................................................. 15
1.4.4 Regulation of Coagulation .......................................................................................................... 16
1.5 ANTICOAGULANT DRUGS USED FOR PREVENTION AND TREATMENT OF THROMBOSIS ............................................ 18
1.5.1 Heparin ....................................................................................................................................... 18
1.5.2 Low-molecular-weight-heparin (LMWH) .................................................................................... 20
1.5.3 Fondaparinux .............................................................................................................................. 21
1.5.4 Vitamin K-antagonists ................................................................................................................. 21
1.5.5 Dabigatran etexilate ................................................................................................................... 23
xi
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
1.5.6 Rivaroxaban and apixaban ......................................................................................................... 24
1.6 BIOMATERIALS AND THE COAGULATION PATHWAY .......................................................................................... 26
1.7 ANTITHROMBOTIC SURFACE MODIFICATIONS ................................................................................................. 28
1.7.1 Poly(ethylene glycol) Surfaces ..................................................................................................... 28
1.7.2 Albumin Coated Surfaces ............................................................................................................ 29
1.7.3 Heparin modified surfaces .......................................................................................................... 30
1.7.4 ATH modified surfaces ................................................................................................................ 31
1.7.5 Thrombomodulin modified surfaces ........................................................................................... 32
1.7.6 Hirudin and bivalirudin modified surfaces .................................................................................. 33
1.7.7 PPACK and fPRPG modified surfaces ........................................................................................... 35
1.7.8 TFPI modified surfaces ................................................................................................................ 35
1.8 NEED FOR NEW APPROACHES .................................................................................................................... 36
1.8.1 The Contact Factor Pathway as a Target for Anticoagulation .................................................... 36
1.8.2 Corn trypsin inhibitor .................................................................................................................. 38
1.8.3 Antisense-mediated gene knockdown of coagulation factors .................................................... 41
CHAPTER 2: AIMS AND HYPOTHESES AND OBJECTIVES .......................................................................... 44
2.1 AIMS AND HYPOTHESES ............................................................................................................................ 44
2.2 OBJECTIVES............................................................................................................................................. 46
CHAPTER 3: MECHANISM OF CATHETER THROMBOSIS: COMPARISON OF THE ANTITHROMBOTIC
PROPERTIES OF FONDAPARINUX, ENOXAPARIN, AND HEPARIN IN VITRO AND IN VIVO ........................ 47
3.1 ABSTRACT .............................................................................................................................................. 48
3.2 INTRODUCTION ........................................................................................................................................ 49
3.3 MATERIALS AND METHODS........................................................................................................................ 50
xii
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
3.3.1 Materials ..................................................................................................................................... 50
3.3.2 Preparation of human platelet-poor plasma .............................................................................. 51
3.3.3 In vitro PCI catheter-induced clotting assay................................................................................ 51
3.3.4 Comparison of the effect of heparin or fondaparinux on clotting induced by clotting enzymes in
the extrinsic, contact or common pathways of coagulation ................................................................ 52
3.3.5 Comparison of the effects of heparin, enoxaparin or fondaparinux on the time to PU catheter
occlusion in rabbits .............................................................................................................................. 53
3.3.6 Blood sample analysis ................................................................................................................. 55
3.3.7 Statistical analyses ...................................................................................................................... 56
3.4 RESULTS ................................................................................................................................................. 56
3.4.1 Effect of PCI catheter segments on plasma clotting times .......................................................... 56
3.4.2 Determination of the coagulation pathway responsible for the prothrombotic activity of PCI
catheter segments ............................................................................................................................... 61
3.4.3 Effect of heparin, enoxaparin or fondaparinux on PCI catheter segment-induced clotting in
plasma ................................................................................................................................................. 64
3.4.4 Comparison of the effect of fondaparinux and heparin on clotting induced by Recombiplastin,
thrombin or factors Xa, IXa, XIa or XIIa ................................................................................................ 68
3.4.5 Effect of supplemental CTI, heparin or bivalirudin on the ability of fondaparinux to attenuate
PCI catheter-induced clotting ............................................................................................................... 71
3.4.6 Effect of heparin, enoxaparin or fondaparinux on time to PU catheter occlusion in rabbits ...... 74
3.5 DISCUSSION ............................................................................................................................................ 78
CHAPTER 4: SELECTIVE DEPLETION OF FACTOR XI OR XII WITH ANTISENSE OLIGONUCLEOTIDES
ATTENUATES CATHETER THROMBOSIS IN RABBITS ................................................................................ 83
xiii
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
4.1 ABSTRACT .............................................................................................................................................. 84
4.2 INTRODUCTION ........................................................................................................................................ 85
4.3 METHODS .............................................................................................................................................. 86
4.3.1 Materials ..................................................................................................................................... 86
4.3.2 Preparation and synthesis of ASOs ............................................................................................. 87
4.3.3 Tolerability/efficacy screening of ASOs in rabbits ....................................................................... 90
4.3.4 Dosing of ASOs in rabbits ............................................................................................................ 93
Table 4.3: Antisense oligonucleotides directed against rabbit coagulation factors.4.3.5 Preparation
of platelet-poor rabbit plasma ............................................................................................................. 94
4.3.5 Preparation of platelet-poor rabbit plasma ................................................................................ 95
4.3.6 Hepatic fVII, fXI, fXII, and HK mRNA expression .......................................................................... 95
4.3.7 Immunoblot analysis ................................................................................................................... 95
4.3.8 Global tests of coagulation ......................................................................................................... 96
4.3.9 Clotting factor protein activity .................................................................................................... 97
4.3.10 Rabbit model of catheter thrombosis ....................................................................................... 97
4.3.11 Statistical analyses .................................................................................................................... 99
4.4 RESULTS ................................................................................................................................................. 99
4.4.1 Effect of ASO-mediated knockdown on mRNA expression and clotting factor levels ................. 99
4.4.2 Effect of ASOs on global tests of coagulation ........................................................................... 103
4.4.3 Effects of fXI, fXII, and HK ASO treatment on catheter patency in rabbits ................................ 105
4.5 DISCUSSION .......................................................................................................................................... 110
CHAPTER 5: ONLY HIGH LEVELS OF DABIGATRAN ATTENUATE CATHETER THROMBOSIS IN VITRO AND IN
RABBITS ................................................................................................................................................114
xiv
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
5.1 ABSTRACT ............................................................................................................................................ 115
5.2 INTRODUCTION ...................................................................................................................................... 116
5.3 MATERIALS AND METHODS...................................................................................................................... 118
5.3.1 Materials ................................................................................................................................... 118
5.3.2 Catheter-induced thrombin generation assay .......................................................................... 118
5.3.3 Rabbit model of catheter thrombosis ....................................................................................... 119
5.3.4 Treatment groups ..................................................................................................................... 120
5.3.5 Blood sample collection and analysis ........................................................................................ 121
5.3.6 Statistical Analyses.................................................................................................................... 123
5.4 RESULTS ............................................................................................................................................... 123
5.4.1 Effect of dabigatran or heparin on catheter-induced thrombin generation in plasma............. 123
5.4.2 Effect of supplemental heparin on the capacity of dabigatran to attenuate catheter-induced
thrombin generation .......................................................................................................................... 129
5.4.3 Plasma dabigatran concentrations in rabbits ........................................................................... 131
5.4.4 Effect of dabigatran and heparin on time to catheter occlusion in rabbits .............................. 134
5.5 DISCUSSION .......................................................................................................................................... 138
CHAPTER 6: CORN TRYPSIN INHIBITOR COATING ATTENUATES THE PROTHROMBOTIC PROPERTIES OF
CATHETER IN VITRO AND IN VIVO .........................................................................................................143
6.1 ABSTRACT ............................................................................................................................................ 144
6.2 INTRODUCTION ...................................................................................................................................... 145
6.3 MATERIALS AND METHODS...................................................................................................................... 148
6.3.1 Materials ................................................................................................................................... 148
6.3.2 Preparation of 125I-labeled proteins .......................................................................................... 149
xv
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
6.3.3 Preparation of PEG conjugated CTI ........................................................................................... 149
6.3.4 Catheter modification ............................................................................................................... 150
6.3.5 Surface density of immobilized CTI ........................................................................................... 151
6.3.6 X-ray photoelectron spectroscopy (XPS) ................................................................................... 151
6.3.7 Water contact angle ................................................................................................................. 152
6.3.8 fXII or fibrinogen adsorption ..................................................................................................... 152
6.3.9 fXIIa binding .............................................................................................................................. 153
6.3.10 Activity of fXIIa generated in situ ............................................................................................ 153
6.3.11 fXI activation ........................................................................................................................... 154
6.3.12 Prothrombotic activity of catheters in plasma ........................................................................ 154
6.3.13 In vivo characterization of coated PU catheters ..................................................................... 155
6.3.14 Statistical Analyses.................................................................................................................. 156
6.4 RESULTS ............................................................................................................................................... 156
6.4.1 Surface density of CTI and ovalbumin ....................................................................................... 156
6.4.2 XPS analysis ............................................................................................................................... 157
6.4.3 Water contact angle ................................................................................................................. 160
6.4.4 Adsorption of 125I-fXII or 125I-fibrinogen to catheters in plasma ................................................ 162
6.4.5 Effect of surface modification on fXIIa binding ......................................................................... 165
6.4.6 Effect of surface modification on the activity of fXIIa generated in situ ................................... 165
6.4.7 Effect of surface modification on fXI activation ........................................................................ 168
6.4.8 Effect of surface modification on the in vitro prothrombotic activity of catheters ................... 170
6.4.9 Effect of fondaparinux on the prothrombotic activity of catheters in vitro .............................. 172
6.4.10 Effect of surface modifications on the prothrombotic activity of PU catheters in rabbits ...... 174
xvi
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
6.5 DISCUSSION .......................................................................................................................................... 178
CHAPTER 7: GENERAL DISCUSSION ........................................................................................................183
7.1 CONTRIBUTION OF THE CONTACT AND TF PATHWAY ON CATHETER-INDUCED CLOTTING ....................................... 185
7.2 COMPARISON OF THE EFFECT OF SINGLE-TARGET AND MULTI-TARGET ANTICOAGULANTS ON CATHETER-INDUCED
CLOTTING ................................................................................................................................................... 187
7.2.1 Effect of thrombin inhibition on catheter-induced clotting ....................................................... 187
7.2.2 Effect of factor Xa inhibition on catheter-induced clotting ....................................................... 189
7.2.3 Effect of supplemental upstream inhibition on catheter-induced clotting ............................... 192
7.3 TARGETING THE CONTACT PATHWAY OF COAGULATION.................................................................................. 194
7.3.1 Effect of selective depletion of fXI and fXII using antisense oligonucleotides on catheter-induced
clotting ............................................................................................................................................... 195
7.3.2 Effect of surface modification on catheter-induced clotting ..................................................... 196
7.4 FUTURE DIRECTIONS ............................................................................................................................... 197
7.5 CONCLUSION......................................................................................................................................... 204
CHAPTER 8 REFERENCES ........................................................................................................................206
APPENDIX: PUBLICATIONS AND ABSTRACTS .........................................................................................230
xvii
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
LIST OF FIGURES AND TABLES
List of Figures
Figure 1.1: Virchow’s Triad in the Pathogenesis of Thrombosis. ....................................... 8
Figure 1.2: Formation of a clot at the site of blood vessel injury. ..................................... 12
Figure 1.3: Overview of the blood coagulation cascade. ................................................... 17
Figure 1.4: Diagram of protein and cell adsorption onto a biomaterial surface relative to
time. ................................................................................................................................... 25
Figure 1.5: Crystal structure of Corn Trypsin Inhibitor (CTI). .......................................... 40
Figure 1.6: Mode of action of antisense oligonucleotide (ASO). ...................................... 43
Figure 3.1: Catheter-induced clotting in platelet-poor plasma .......................................... 58
Figure 3.2: Effect of CTI on the prothrombotic activity of PCI catheter segments ........... 63
Figure 3.3: Effect of fondaparinux, enoxaparin, or heparin on the prothrombotic activity
of PCI catheter segments ................................................................................................... 67
Figure 3.4: Effect of fondaparinux or heparin on clotting induced by Recombiplastin, or
coagulation enzymes .......................................................................................................... 70
Figure 3.5: Effect of supplemental CTI, heparin, or bivalirudin on the capacity of
fondaparinux to attenuate catheter-induced clotting .......................................................... 73
Figure 3.6: Effect of fondaparinux, enoxaparin, or heparin on the time to PU catheter
occlusion in rabbits ............................................................................................................ 76
Figure 3.7: Effect of low-dose heparin alone or in conjunction with fondaparinux on the
time to PU catheter occlusion in rabbits ............................................................................ 77
xviii
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 4.1: Effect of fVII, fXI, fXII, and HK ASOs on hepatic mRNA expression, protein
levels, and activity ........................................................................................................... 102
Figure 4.2: Effect of treatment with control, fVII, fXI, fXII, or HK ASOs on the dilute
aPTT and PT .................................................................................................................... 104
Figure 4.3: Effect of fVII, HK, fXII, and fXI ASO treatment on the time to catheter
occlusion .......................................................................................................................... 107
Figure 4.4: Effect of fVII and/or fXI ASO treatment on the time to catheter occlusion . 109
Figure 5.1: Representative thrombin generation profile .................................................. 128
Figure 5.2: Plasma dabigatran and heparin concentrations in rabbits.............................. 132
Figure 5.3: Effect of dabigatran or heparin on the time to catheter occlusion in rabbits . 136
Figure 5.4: Effect of low-dose dabigatran and/or heparin on the time to catheter occlusion
in rabbits........................................................................................................................... 137
Figure 6.1: Advancing and receding water contact angles with unmodified or modified
PCI catheters .................................................................................................................... 161
Figure 6.2: Adsorption of
125
I-fXII or
125
I-fibrinogen onto unmodified or modified PCI
catheters in plasma ........................................................................................................... 164
Figure 6.3: Activity of fXIIa generated in situ in the presence of unmodified or modified
PCI catheters .................................................................................................................... 167
Figure 6.4: Effect of surface modification on fXIIa-mediated activation of fXI ............. 169
Figure 6.5: Plasma clotting times in the absence or presence of unmodified or modified
PCI catheters .................................................................................................................... 171
xix
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 6.6: Effect of fondaparinux on the procoagulant activity of unmodified or modified
PCI catheters .................................................................................................................... 173
Figure 6.7: Time to occlusion of unmodified or modified PU catheters in rabbits ......... 176
Figure 6.8: Effect of systemic fondaparinux on the time to occlusion of unmodified or
CTI-coated PU catheters in rabbits .................................................................................. 177
Figure 7.1: Effect of fondaparinux, enoxaparin, and heparin on the anti-Xa levels of
rabbits ............................................................................................................................... 191
Figure 7.2: Effect of systemic heparin on the time to occlusion of unmodified or CTIcoated PU catheters in rabbits .......................................................................................... 203
List of Tables
Table 1.1: Common blood contacting medical devices ....................................................... 5
Table 3.1: The effect of catheter segments or tissue factor (Recombiplastin) on clotting
times in normal, or fVII-, fXI-, or fXII-deficient platelet-poor plasma ............................. 60
Table 4.3: Antisense oligonucleotides directed against rabbit coagulation factors. .......... 94
Table 5.1: Effect of dabigatran on catheter-induced thrombin generation ...................... 125
Table 5.2: Effect of heparin on catheter-induced thrombin generation ........................... 126
Table 5.3: Effect of dabigatran and/or heparin on catheter-induced thrombin generation
.......................................................................................................................................... 130
Table 6.1. X-ray photoelectron spectroscopy (XPS) analysis of unmodified or modified
PCI catheter surfaces ........................................................................................................ 159
xx
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Table 7.1: aPTT and PT for rabbits treated with unmodified and modified catheters ..... 201
xxi
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
LIST OF ABBREVIATIONS
II
Prothrombin
IIa
Thrombin
ACS
Acute coronary syndrome(s)
AIBN
2,2’-azobisisobutyronitrile
aPTT
Activated partial thromboplastin time
ANOVA
Analysis of variance
ASO
Antisense oligonucleotide
BSA
Bovine serum albumin
CaCl2
Calcium chloride
CPM
Counts per minute
CTI
Corn trypsin inhibitor
CVC
Central venous catheter
Da
Dalton(s)
DMSO
Dimethyl sulfoxide
f
Factor
GAG
Glycosaminoglycan
HBS
HEPES-buffered saline
HEPES
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid
HK
High-molecular-weight-kininogen
HRP
Horseradish peroxidase
xxii
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
LMWH
Low-molecular-weight-heparin
M
Molar
MALDI
Matrix-assisted laser desorption/ionization
MI
Myocardial infarction(s)
mRNA
Messenger ribonucleic acid
OD
Optical density
PBS
Phosphate buffered saline
PCI
Percutaneous coronary intervention
PEG
Polyethylene glycol
PEO
Polyethylene oxide
PK
Prekallikrein
PKa
Kallikrein
PPP
Platelet-poor-plasma
PRP
Platelet-rich-plasma
RNase
Ribonuclease
SEM
Standard error of the mean
SD
Standard deviation
SDS
Sodium dodecyl sulfate
SEM
Standard error of the mean
SPR
Surface plasmon resonance
TBS
Tris-buffered saline
xxiii
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
TF
Tissue factor
TM
Thrombomodulin
TFPI
Tissue factor pathway inhibitor
TOF
Time-of-flight
Tris
Tris-(hydroxymethyl)-aminomethane
UFH
Unfractionated heparin
XPS
X-ray photospectroscopy
xxiv
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
DECLARATION OF ACADEMIC ACHIEVEMENT
The research performed for this thesis was conceived, conducted, analyzed,
written, and submitted for publication primarily by the author of this thesis. All research
work reported in this thesis is presented as four manuscripts in Chapters 3 to 6. The
following also contributed to this research:
Dr. Jeffrey I. Weitz provided the research focus and ideas for the direction of the
work, obtained funding to support the studies, and critically reviewed the manuscripts
presented in Chapters 3 to 6.
Dr. James C. Fredenburgh provided research focus and ideas for the direction of
the work, and critically reviewed the manuscripts presented in Chapters 3 to 6.
Peng Liao provided technical assistance for Chapters 3 to 6.
Alan R. Stafford provided technical assistance and research ideas for Chapters 3,
4, and 6.
Robin Roberts provided statistical assistance for Chapters 3 and 5.
Alexey S. Revenko and Brett P. Monia provided technical assistance for Chapter
4.
Dr. John L. Brash provided assistance with research ideas and paper revisions,
particularly in regard to surface characterization techniques for Chapter 6.
xxv
Chapter 1: General Introduction
1.1 Overview
Heparin and warfarin are the mainstay anticoagulants for prevention and treatment
of thromboembolism.
Both drugs target multiple clotting factors.
Heparin binds
antithrombin and catalyzes the rate at which antithrombin inhibits thrombin and fXa.
Warfarin, a vitamin K-antagonist, interferes with the post-translational modification of
vitamin K-dependent proteins (prothrombin, fX, fIX, fVII, protein C, S, and Z).
In contrast to heparin and warfarin, newer anticoagulant drugs target only a single
clotting enzyme. For example, fondaparinux, a synthetic pentasaccharide that interacts
with antithrombin, only targets fXa. Likewise, the new oral anticoagulants (NOACs),
which are licensed alternatives to warfarin for certain indications, also target a single
clotting enzyme. The first NOAC to be licensed was dabigatran, a thrombin inhibitor.
Other NOACs include rivaroxaban and apixaban, which inhibit fXa.
Although
fondaparinux and the NOACs have advantages over heparin and warfarin, respectively,
they are less effective for prevention of clotting on blood-contacting medical devices,
such as coronary catheters, CVCs, and mechanical heart valves.
For example,
fondaparinux-treated patients who require urgent percutaneous coronary intervention
(PCI) develop catheter thrombosis in the OASIS-5 and -6 studies. Likewise, in patients
with mechanical heart valves, there was a trend for more strokes and more bleeding with
dabigatran than with warfarin in the Randomized, Phase II Study to Evaluate the Safety
and Pharmacokinetics of Oral Dabigatran Etexilate in Patients after Heart Valve
1
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Replacement (RE-ALIGN) study; findings that prompted an early termination of the trial.
Taken together, these results suggest that anticoagulants that target either fXa or thrombin
are less effective at preventing medical device-induced clotting than heparin or warfarin.
Why does medical device-induced clotting occur? We address this question by
briefly reviewing the blood coagulation cascade. In the classic waterfall model of blood
coagulation, thrombin generation is triggered by fVII or fXII activation via the tissue
factor (TF) or contact pathways, respectively. Studies with fVII and TF-deficient mice
highlight the essential role of the TF pathway, prompting greater emphasis on the TF
pathway while downplaying the role of the fXII. Patients with fXII deficiency are not
predisposed to bleeding, further downplaying the importance of fXII. Within the last 10
years, studies with fXII deficient mice have challenged this notion and highlight the
importance of fXII in thrombosis. Furthermore, polyurethane, polytetrafluoroethylene,
and Dacron, which are components of catheters and mechanical heart valves, trigger fXII
activation.
Taken together, these observations support the idea that fXII is a key
component in device-associated thrombosis.
The following thesis examines the mechanisms of blood/material interactions, and
identifies novel strategies for the prevention of medical device-induced clotting. We
show that catheters induce clotting via the fXII activation, consistent with the observation
that blood-contacting devices adsorb and activate fXII, thereby initiating the contact
pathway of coagulation.
Also, with the growing use of cardiovascular intervention
procedures, the search for blood compatible materials is essential for reducing thrombotic
2
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
complications. This research hopes to determine why newer single-target anticoagulant
drugs, which include fondaparinux and dabigatran, are less effective than multi-target
anticoagulant drugs, such as heparin and warfarin, for prevention of thrombosis on bloodcontacting medical devices, and to use this information to develop novel approaches to
overcome clotting on such devices.
1.2 Biocompatibility of Medical Devices
Medical devices are ubiquitous for the diagnosis and treatment of numerous
diseases (Table 1.1). These devices are constructed with artificial or biological materials
that confer durability and mechanical strength.
However, these devices induce
physiological responses that result in secondary complications such as thrombosis. The
first evidence of biomaterial use in medicine was the application of gold in dentistry over
2000 years ago (Ratner et al., 2004). Since then other materials have emerged, especially
in the 20th century. Initially, materials developed for industrial applications were adapted
for medical use because of their mechanical properties, including stability, permeability,
processing, cost, and ease of sterilization. The first materials used were plain carbon and
vanadium steels (Williams, 2008).
Subsequently, stainless steels, cobalt-chromium
alloys, titanium alloys, and platinum group metals were impregnated into medical
devices.
More recently, synthetic polymers such as nylon and polyester have been
utilized for medical applications because of their diverse chemical and physical properties
(Williams, 2008). Despite the stability and durability of these materials, undesirable
3
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
biological and physiological responses still occur and are manifested as potentially
serious complication, such as thrombosis (Williams, 2008).
Because of this, the
development of a non-reactive or “biocompatible” surface has been at the forefront of
biomaterials research.
Biocompatibility refers to the “ability of a biomaterial to perform its desired
function with respect to a medical therapy, without eliciting any undesirable local or
systemic effects in the recipient or beneficiary of that therapy…” (Gorbet and Sefton,
2004). Although stainless steel and titanium alloys provide mechanical strength and
stability, these materials are still associated with numerous complications. In light of this,
biocompatibility remains an elusive goal in the development of novel surface materials.
4
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Blood contacting Blood contacting material
Number used
device
per year
Catheters
Silicone, polyurethane, PVC, Teflon
200,000,000
Guidewires
Stainless steel, nitinol
> 1,000,000
Vascular graft
Dacron, Teflon
200,000
Stents
Stainless steel, styrene-isobutylene polymer
4,000,000
Artificial kidney
Polyacrylonitrile, polysulfone, cellulose
1,200,000
Table 1.1: Common blood contacting medical devices.
Millions of procedures are performed every year in the US, and catheters are the most
commonly used devices. Adapted from (Ratner, 2007).
5
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
1.3 Biomaterial-associated Thrombosis
Thrombosis, resulting from excessive clotting, remains a major complication
associated with blood-contacting medical devices.
Thrombus formation may occur
through numerous mechanisms. In general, thrombosis develops as a result of interplay
among reduced blood flow, hypercoagulability, and vessel wall injury, the so-called
Virchow’s Triad (Figure 1.1).
Biomaterial-associated thrombosis is a complication that occurs in patients with a
blood-contacting device. It can manifest as thrombotic occlusion of stents (Bittl, 1996),
central venous catheters (CVCs) (Lee and Kamphuisen, 2012), and vascular grafts (Veith
et al., 1986), or thromboembolic events associated with artificial hearts (Cannegieter et
al., 1994), guide catheters and wires (Yusuf et al., 2006b; Yusuf et al., 2006a), left
ventricular assist devices (Bartoli et al., 2014), extracorporeal membrane oxygenation
devices (Oliver, 2009), and mechanical heart valves (Eikelboom et al., 2013). Because
foreign surfaces are thrombogenic, anticoagulant therapies with heparin, low-molecularweight-heparin, and vitamin K antagonists, such as warfarin, have shown some efficacy
for treatment against biomaterial-associated thrombosis (Monreal et al., 1996; Mismetti et
al., 2003; Abdelkefi et al., 2004; Verso et al., 2005; Karthaus et al., 2006; Yusuf et al.,
2006b; Yusuf et al., 2006a; Niers et al., 2007; De Cicco et al., 2009).
Likewise,
antiplatelet therapy is the mainstay therapy for prevention of stent thrombosis and
thrombosis on bio-prosthetic heart valves.
However their shortcomings, including
increased bleeding risk, highlight the need for alternative strategies.
6
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Blood-contacting devices trigger thrombosis by inducing the activation of the
coagulation system, which may result in thrombus formation.
embolize to other organs.
The thrombus may
In a pooled analysis of six major clinical trials, stent
thrombosis occurred in 0.9% of patients with coronary stents and receiving antiplatelet
therapy with aspirin plus ticlopidine (Cutlip et al., 2001). Other thrombotic events have
been reported in conjunction with devices.
Examples include acute and sub-acute
thrombotic occlusions of medium sized grafts (4-6 mm) (Clagett and Eberhart, 1994),
complete obstruction of stents (Bittl, 1996), as well as thromboembolic complications
associated with artificial hearts (Clagett and Eberhart, 1994), catheters (Eberhart and
Clagett, 1991), and prosthetic valves (Edmunds, Jr., 1996). These observations highlight
the prevalence of biomaterial-associated thrombosis in the clinical setting.
7
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 1.1: Virchow’s Triad in the Pathogenesis of Thrombosis.
Thrombosis reflects interplay among impaired blood flow, hypercoagulability of the
blood and injury to the vessel wall. ACS involves all three factors; clotting is triggered
by the vessel injury that occurs upon atherosclerotic plaque disruption, tissue factor (TF)
exposed at the site of plaque rupture causes hypercoagulability and the occlusive
thrombus leads to impaired blood flow. Device-associated thrombosis also involves all
three factors. However, blood flow and hypercoagulability play a prominent role in
device-associated thrombosis.
8
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
1.3.1 Catheter Thrombosis
Catheter thrombosis occurs due to a variety of conditions, including duration of
blood contact, type of catheter material used, and anticoagulation involved. For example,
guide catheters used in interventional procedures such as PCI, are susceptible to catheter
thrombosis due to the intense blood flow.
In patients undergoing PCI, catheter
thrombosis occurred in 0.4% of patients receiving enoxaparin, a low-molecular-weightheparin (LMWH), and 0.9% of patients receiving fondaparinux (Yusuf et al., 2006b).
Similar observations were noted in other clinical trials (Mehta et al., 2005; Yusuf et al.,
2006a). Likewise, patients with a central venous catheter (CVC), including peripherally
inserted central catheters (PICCs) and port-a-caths, are susceptible to catheter thrombosis.
These catheters are a risk factor for venous thromboembolism, which can further increase
the thrombotic potential in patients that possess other independent risk factors such as
cancer, acute coronary syndrome, immobility, need for surgery or chemotherapy, and
presence of a hypercoagulable state. In recent years, symptomatic catheter thrombosis in
patients with cancer ranged from 4% to 8% in several large prospective trials (Verso et
al., 2005).
Similarly, in a prospective observational cohort study that included 444
consecutive patients with cancer undergoing CVC insertion the incidence of symptomatic
catheter thrombosis was 4.3%. Patients with CVC-associated thrombosis can further
develop upper extremity DVT and subsequent PE. CVC-associated thrombosis can lead
to subsequent catheter infection, pulmonary embolism, and post-thrombotic syndrome
(Baskin et al., 2009).
9
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Consequently, ongoing biomaterials research has focused on development of nonthrombogenic surfaces that decrease the procoagulant capacity of blood-contacting
devices. Due to the complexity of the blood coagulation system, a detailed understanding
of the mechanisms and interactions behind device-induced clotting is required in order to
identify strategies to prevent this complication.
1.4 Introduction to Hemostasis and Thrombosis
Upon vascular damage, pro-inflammatory and wound-healing responses are
initiated (Mackman et al., 2007). As part of the wound-healing response, the blood
coagulation system is activated. Excessive blood loss is prevented by the formation of a
stable clot at the site of injury. Clots or thrombi are composed of protein and cellular
components that are inert prior to injury. As a result of injury, a highly regulated series of
steps occur, which results in the formation of a stable clot (Mackman et al., 2007).
Subendothelial cells constitutively express procoagulant molecules such as TF, which
then bind circulating platelets and fVIIa, respectively. These initial events catalyze the
activation of platelets and the coagulation cascade. Finally, the clot is stabilized through
the polymerization of fibrin.
An overall view of the blood coagulation process is
summarized in Figure 1.2. Since the bulk of the thrombus is composed of fibrin (Wufsus
et al., 2013), the coagulation cascade plays a major role in clot formation.
The blood coagulation cascade is a series of proteolytic reactions that convert
inactive proteins, or zymogens, into active, enzymatic forms. The cascade is composed
10
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
of three pathways that contribute to thrombin generation. The contact pathway and the
TF pathway initiate coagulation and converge at the common pathway, which generates
the essential enzyme, thrombin. Functions of thrombin include conversion of fibrinogen
to fibrin, activation of platelets and other coagulation factors, such as fV, fVIII, fXIII, and
fXI as well as regulation of its own production by binding to thrombomodulin. Excessive
thrombin generation may lead to thromboembolic disorders.
Therefore, regulating
coagulation is essential for normal hemostasis. The following sections describe the
coagulation pathways and their regulation in detail.
11
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 1.2: Formation of a clot at the site of blood vessel injury.
Under normal conditions, the subendothelium is separated from the blood by the
nonthrombogenic vessel wall (endothelium).
The subendothelium expresses TF on
vascular smooth muscle cells, pericytes, and adventitial fibroblasts.
Upon vascular
injury, the subendothelium is exposed to the blood, which leads to the rapid binding of
platelets and initiation of the coagulation cascade by TF. Propagation of the growing clot
involves the recruitment of additional platelets and amplification of the cascade through
the intrinsic pathway. Finally, the clot is stabilized through platelet-platelet interactions
and fibrin deposition. Adapted from (Mackman et al., 2007).
12
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
1.4.1 TF pathway
The (TF) pathway is believed to be the principal initiator of the coagulation
cascade in vivo (reviewed in (Mackman et al., 2007)) (Figure 3). This pathway involves
components within the blood and in the extravascular space. The principal initiating
component in the extrinsic pathway is TF. TF is endogenously expressed as an integral
glycoprotein on subendothelial cells (Morrissey et al., 1987; Weiss et al., 1989). It
functions as a coagulation cofactor by forming a stoichiometric complex with fVIIa in the
blood. This process requires a small amount of pre-existing fVIIa (Fair and MacDonald,
1987; Davie et al., 1991), which comprises less than 1% of the total fVII in plasma
(Karalapillai and Popham, 2007). TF can also bind with fVII, which then converts fVII to
fVIIa by auto-activation. The combination of TF and fVIIa subsequently forms the TFfVIIa complex, also known as the “extrinsic tenase” complex. This complex facilitates
further conversion of fVII to fVIIa, and initiates the common coagulation pathway
through activation of fX (Komiyama et al., 1990; Silverberg et al., 1977). Activated fX
(fXa) then converts prothrombin into thrombin at catalytic quantities. Subsequently,
thrombin activates fVIII and fV, essential cofactors of the intrinsic tenase and
prothrombinase complexes, which amplify thrombin generation.
Inhibition of the
extrinsic pathway by TF pathway inhibitor (TFPI), which inhibits TF-bound fVIIa in a
fXa dependent fashion, regulates fXa generation during the initiation phase of coagulation
(Baugh et al., 1998). Severe fVII deficiency in humans occurs at a very low frequency in
the population (1 in 500 000) (Tuddenham et al., 1995). These individuals experience
13
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
abnormal soft tissue, intra-articular, and mucocutaneous bleeding analogous to patients
with hemophilia A or B, who are deficient in fVIII or fIX, respectively. In contrast,
humans with TF deficiency have not been reported, suggesting that TF is essential for
normal development. These observations are supported by studies of genetically altered
mice lacking TF or fVII, which die during embryonic development or during the perinatal
period because of severe vascular and hemostatic defects (Bugge et al., 1996; Carmeliet
et al., 1996; Rosen et al., 1997; Toomey et al., 1996).
1.4.2 Contact pathway
In the traditional model of blood coagulation, the contact pathway is an alternate
mechanism by which coagulation is initiated (Figure 3). It has been established that the
activation of the contact factor pathway occurs when fXII adsorbs onto a negatively
charged surface and converts to active fXII (fXIIa). Through a series of proteolytic
events, fXIIa activates other contact proteins, such as prekallikrein (PK) and fXI.
Activated prekallikrein (kallikrein, PKa) subsequently activates additional fXII, whereas
fXIa activates fIX into fIXa, which then activates fX and thrombin (de la Cadena et al.,
1994; Colman and Schmaier, 1997; Kaplan and Silverberg, 1987). These processes are
enhanced in the presence of high-molecular-weight-kininogen (HK), a contact system
cofactor. Altogether, fXII activation triggers the coagulation cascade, as well as several
other host defense systems including fibrinolysis, inflammation, complement, and
angiogenesis (Colman and Schmaier, 1997).
14
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
FXII, PK, and HK are required for normal activation of fXI during contactinitiated coagulation. Severe fXII, PK, and HK deficiency in humans is rare within the
normal population.
Patients with a deficiency in any one of these proteins have a
prolonged partial thromboplastin time (PTT) but maintain normal hemostasis.
In
contrast, patients with severe fXI deficiency (also known as Hemophilia C) have
abnormal hemostasis, which is also associated with a prolonged PTT.
1.4.3 Intrinsic and Common pathway
The common pathway, consisting of fX and prothrombin, is initiated upon
activation of fX to fXa by the TF or contact pathways (Figure 3). FXa then converts
circulating prothrombin to thrombin, which activates numerous processes including
amplification and propagation of the coagulation cascade (Furie and Furie, 1988). During
coagulation, thrombin cleaves circulating fV and fVIII, both essential cofactors, into fVa
and fVIIIa, respectively. FVa and fVIIIa bind with fXa and fIXa, respectively, and form
two distinct complexes.
The intrinsic tenase complex consists of fIXa, fVIIIa,
phospholipids, and calcium and further propagates fXa generation (Hockin et al., 2002).
Likewise, the prothrombinase complex consists of prothrombin, fVa, fXa, phospholipids,
and calcium. The diverse interplay between coagulation factors is summarized in Figure
1.3.
15
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
1.4.4 Regulation of Coagulation
Regulation of the coagulation cascade is important to maintain normal hemostasis.
Anticoagulant mechanisms such as antithrombin, the protein C pathway, TF pathway
inhibitor (TFPI), and C1 esterase inhibitor, regulate the blood coagulation cascade
through inhibition or degradation of selected procoagulant factors. Antithrombin inhibits
thrombin, fVIIa, fXa, and fIXa through formation of covalent complexes. Although this
reaction is slow, inhibition is enhanced over 1000-fold in the presence of heparin, which
induces a conformational change in antithrombin.
In humans, heparan sulfate, a
glycosaminoglycan similar to heparin, also catalyzes the inhibition of thrombin and fXa
by antithrombin.
The second major anticoagulant process involves the protein C
pathway. Activated protein C serves numerous functions, but primarily it inactivates fVa
and fVIIIa. Protein C activation is catalyzed by thrombin bound to thrombomodulin, an
endothelial cell surface receptor. Another regulator of coagulation is TFPI. TFPI inhibits
the activity of TF-fVIIa complex, thus blocking the initiation of coagulation by TF. In
addition, TFPI inhibits the activity of fXa, further suppressing thrombin generation.
Another regulator is C1 esterase inhibitor, which inhibits fXIIa, PKa, and fXIa. While C1
esterase inhibitor is only a minor regulator of coagulation, it is the principal regulator of
the contact pathway.
Altogether, these physiological mechanisms regulate the
coagulation cascade and thereby maintain normal blood flow. However, when these
regulatory processes are overwhelmed by excessive procoagulant stimuli, thrombosis can
occur.
16
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 1.3: Overview of the blood coagulation cascade.
The presence of TF or an external factor initiates the blood coagulation cascade via the
extrinsic or contact pathways, respectively. These pathways activate fX, which mediates
the propagation of the common pathway. The result is the conversion of prothrombin to
thrombin. Numerous reactions require a phospholipid (PL) surface for efficient catalysis.
Thrombosis occurs when there is excessive thrombin generation, which results in greater
fibrin formation and platelet activation.
17
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
1.5 Anticoagulant Drugs Used for Prevention and Treatment of Thrombosis
Parenteral and oral anticoagulants are used for the prevention and treatment of
thromboembolism.
While
these
anticoagulants
have
been
effective
against
thromboembolism, they are associated with an increased risk of bleeding when given at
high doses. Currently available parenteral anticoagulants include heparin, LMWH, and
fondaparinux, a synthetic pentasaccharide. The oral anticoagulants include vitamin K
antagonists, such as warfarin, and the new oral anticoagulants that target thrombin
(dabigatran etexilate) or fXa (rivaroxaban and apixaban).
1.5.1 Heparin
Heparin is a sulfated polysaccharide isolated from mammalian tissues rich in mast
cells. Most commercial heparin is derived from porcine intestinal mucosa and consists of
a polymer containing alternating D-glucuronic acid and N-acetyl-D-glucosamine
residues.
Heparin serves as an anticoagulant through activation of antithrombin, and
accelerates the rate at which antithrombin inhibits fXa and thrombin.
The average
molecular weight of heparin is 15,000, but the molecular weight of heparin ranges from
5000 to 30,000. Heparin performs its actions through direct binding with antithrombin,
which enables antithrombin to inhibit proteases. To activate antithrombin, heparin binds
to antithrombin via a unique pentasaccharide sequence that is found on one-third of all
heparin chains. The remaining chains catalyze the inhibition of thrombin by heparin
18
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
cofactor II. Upon binding to antithrombin, heparin induces a conformational change that
renders antithrombin more accessible to its target proteases. This conformational change
increases the rate of antithrombin-dependent inhibition of fXa by two orders of
magnitude. To catalyze the inhibition of thrombin, heparin serves as a bridge between
antithrombin and thrombin, and simultaneously binds them together to form a ternary
complex.
This complex brings thrombin in close proximity to antithrombin, thus
promoting the formation of a stable covalent thrombin-antithrombin complex. Heparin
also catalyzes the inhibition of fIXa, fXIa, and fXIIa by bridging antithrombin with its
target protease.
Heparin possesses numerous limitations, including poor bioavailability at low
doses, dose-dependent clearance, and variable anticoagulant response. It is also unable to
inhibit clot-bound thrombin and fXa bound to phospholipid surfaces within the
prothrombinase system (Weitz et al., 1990).
This inability to inactivate clot-bound
thrombin and fXa incorporated into prothrombinase allows for further thrombin
generation and thus further thrombus formation. Furthermore, heparin binds with various
molecules that affect its activity. For example, heparin binds with platelets, causing
activation and release of platelet factor 4 (PF4). This reaction stimulates the formation of
antibodies that cause heparin-induced thrombocytopenia, a rare but lethal condition. In
addition, heparin interacts with osteoblasts to cause heparin-induced osteoporosis.
19
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
1.5.2 Low-molecular-weight-heparin (LMWH)
Derived from heparin, LMWH is prepared by chemical or enzymatic
depolymerisation to yield fragments that are approximately one third the size of heparin.
The mean molecular weight of LMWH ranges from 4500 to 6000, depending on the type
of LMWH. However, the molecular weight of LMWH can range from 1000 to 10,000.
Like heparin, LMWH is heterogeneous with regard to its molecular size and
anticoagulant activity. However, LMWH possess advantages over heparin, and therefore
has replaced heparin for many indications.
Like heparin, LMWH induces its inhibitory effect via antithrombin. Since the
minimal chain length to form a ternary complex with thrombin is 18 saccharide units,
which corresponds to a mol wt of 5400, only 25 to 50% of LMWH molecules possess this
minimal chain length. Consequently, LMWH catalyzes fXa inhibition by antithrombin
more than thrombin inhibition. Hence, LMWHs have ratios of anti-Xa to anti-IIa activity
that vary between 4:1 and 2:1, depending on molecular size.
Although excessive administration of LMWH is associated with increased risk of
bleeding, LMWH possess numerous advantages over heparin. These advantages include
(1) better bioavailability and longer half-life after subcutaneous injection, (2) reduced
ability to bind nonspecifically to plasma proteins other than antithrombin, (3) reduced
binding to macrophages and cells, and (4) reduced binding to platelets and PF4 thus
lowering the risk of heparin-induced thrombocytopenia. LMWH has replaced heparin in
many indications. However, LMWH has shown limited efficacy in certain situations.
20
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
For example, while LMWH is used for treatment of catheter thrombosis in patients with a
CVC, LMWH has not been effective for prevention of catheter thrombosis.
1.5.3 Fondaparinux
A synthetic analogue of the antithrombin-binding pentasaccharide sequence of
heparin, fondaparinux has a molecular weight of 1728. Although fondaparinux binds to
antithrombin, it is too short to bridge antithrombin to thrombin.
Consequently,
fondaparinux possesses only anti-Xa activity and does not enhance the anti-IIa activity of
antithrombin. Fondaparinux is licensed for (1) thromboprophylaxis in orthopedic patients
as well as medical and surgical patients, and (2) as an alternative to heparin or LMWH for
initial treatment of patients with established venous thromboembolism. Fondaparinux is
also approved for treatment of patients with acute coronary syndrome.
As with heparin or LMWH, the major side effect of fondaparinux is bleeding.
However, fondaparinux does not cross-react with PF4 and thus, is associated with a low
risk of heparin-induced thrombocytopenia. In addition, patients given fondaparinux do
not require frequent monitoring compared with heparin and LMWH. These advantages
allow fondaparinux to be a viable alternative to heparin and LMWH.
1.5.4 Vitamin K-antagonists
The mainstay oral anticoagulant is warfarin. Warfarin is a water-soluble vitamin
K-antagonist, which was initially developed as rodenticide.
21
Like other vitamin-K
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
antagonists, warfarin disrupts the synthesis of vitamin K-dependent procoagulant and
anticoagulant proteins, including prothrombin, fVII, fIX, fX, and proteins C, S, and Z.
Warfarin is rapidly and completely absorbed from the gastrointestinal tract.
Peak
concentrations of warfarin in the blood are achieved within 90 min after oral
administration. The half-life of warfarin is 36 to 42 h. For most indications, warfarin is
administered in doses that achieve an international normalized ratio (INR) of 2.0 to 3.0.
However, a higher INR (2.5 to 3.5) is recommended for some patients with mechanical
heart valves.
Warfarin is also recommended for long-term treatment of catheter-
associated upper extremity venous thromboembolism.
Warfarin possesses limitations that hinder its use. One of the major side effects of
warfarin, like all anticoagulants, is bleeding. This event occurs when the INR exceeds the
normal range or even within the therapeutic range, in the case of intracranial bleeding.
The anticoagulant effect of warfarin is influenced by diet, drugs, and various disease
states. Also different polymorphisms can affect the activity of warfarin. Fluctuating
intake of dietary vitamin K can affect the absorption, clearance, and metabolism of
warfarin. Because of this variability, regular coagulation monitoring is necessary to
ensure that a therapeutic response is obtained. Finally, warfarin can be associated with
skin necrosis in patients with protein C or S deficiency, and it crosses the placenta and
can cause fetal abnormalities in pregnant women.
22
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
1.5.5 Dabigatran etexilate
Dabigatran is a small (472 Da) molecule that inhibits thrombin by binding to its
active site via ionic interactions. Dabigatran rapidly and reversibly inhibits both clotbound and free thrombin in a concentration dependent manner with an inhibition constant
(Ki) of 4.5 nM. It also exhibits high specificity for thrombin relative to other serine
proteases. Dabigatran is a highly charged molecule with poor intestinal absorption. This
issue is resolved with the introduction of dabigatran etexilate, the prodrug to dabigatran.
Dabigatran is administered in fixed doses without routine coagulation monitoring, is
excreted by the kidney, and has a half-life of 12 to 17 h (Baetz and Spinler, 2008).
In many countries, dabigatran is licensed for prophylaxis after hip or knee
replacement surgery and stroke prevention in patients with atrial fibrillation. For patients
undergoing hip or knee replacement surgery, dabigatran given at 150 or 220 mg is as
effective as once-daily LMWH for reduction of venous thromboembolism and mortality
(Eriksson et al., 2007b; Eriksson et al., 2007a). For patients with atrial fibrillation,
dabigatran given at 150 mg twice-daily is superior to warfarin for reduction of both
hemorrhagic and ischemic stroke, systemic embolism, and intracranial bleeding
(Connolly et al., 2009).
This dabigatran regimen also is effective as warfarin for
treatment of acute venous thromboembolism (Schulman et al., 2009; Schulman et al.,
2013b; Schulman et al., 2013a). In contrast, even higher doses of dabigatran had a trend
toward more stroke and bleeding than warfarin in patients with mechanical heart valves
(Eikelboom et al., 2013), raising the possibility that dabigatran may also be limited in its
23
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
capacity to inhibit clotting on other blood-contacting medical devices, such as catheters.
1.5.6 Rivaroxaban and apixaban
Rivaroxaban and apixaban are oral fXa inhibitors that inhibit both free and
prothrombinase-bound fXa. Both drugs are predominately metabolized in the liver and
the pharmacokinetic and pharmacodynamics profiles are dose-dependent. Rivaroxaban is
licensed for thromboprophylaxis after hip or knee replacement surgery, situations in
which the drug is usually given for 2 and 4 weeks (Duggan et al., 2009), respectively, and
as an alternative to warfarin for stroke prevention in atrial fibrillation (Patel et al., 2011).
In most countries, rivaroxaban is licensed for treatment of deep venous thrombosis and
pulmonary embolism (Bauersachs et al., 2010; Buller et al., 2012).
In Europe,
rivaroxaban is licensed for secondary prevention in stabilized patients with acute
coronary syndrome (Mega et al., 2012). Similarly, apixaban is licensed in many countries
for thromboprophylaxis after hip or knee replacement surgery (Lassen et al., 2009; Lassen
et al., 2010a; Lassen et al., 2010b). In some countries, apixaban is licensed for the
prevention of stroke and systemic embolism in patients with atrial fibrillation (Connolly
et al., 2011; Granger et al., 2011).
24
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 1.4: Diagram of protein and cell adsorption onto a biomaterial surface
relative to time.
The initial event in blood/biomaterial interaction is the deposition of protein onto the
surfaces of biomaterials. This initial deposition leads to the adhesion of platelets and
leukocytes. These events lead to the production of thrombin, which further activates
procoagulant cells.
As a result, protein adsorption contributes to biomaterial
incompatibility with the blood. Image adapted from Gorbet and Sefton (Gorbet and
Sefton, 2004).
25
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
1.6 Biomaterials and the coagulation pathway
Protein adsorption is the first event in blood-material interactions, and adsorption
of the contact phase proteins may result in activation of the contact factor pathway.
Within seconds upon exposure, blood serum proteins adsorb onto the surface of artificial
devices to form a protein monolayer. The highest mobility proteins, such as fibrinogen
and fXII, arrive first and are later replaced by less motile proteins such as HK, which
have a higher affinity for the surface; a process known as the Vroman effect (Vroman,
1962). In addition, procoagulant cells such as platelets and leukocytes adhere to the
protein monolayer, and contribute to thrombin generation.
The effect of protein
adsorption on artificial surfaces is summarized in Figure 1.4.
Based on these
observations, protein adsorption plays an important role in the procoagulant response
induced by biomaterials.
Under physiological conditions, the role of TF is to maintain hemostasis. The role
of fXII activation in thrombosis, however, remains elusive and under constant debate
(Schmaier, 2008). It has long been held that fXII autoactivation is most efficiently
facilitated by exogenous “anionic” surfaces (Mitropoulos, 1999a; Mitropoulos, 1999b) or
“hydrophilic” (Vogler et al., 1995a; Vogler et al., 1995b; Vogler et al., 1998; Zhuo et al.,
2005), presumably because fXII binds to these negatively charged surfaces. Artificial
materials, such as glass, have been shown to activate fXII. Recently, however, Zhuo et al
demonstrated that hydrophobic polymers may also facilitate fXII autoactivation with
equal efficiency as hydrophilic polymers (Zhuo et al., 2006). Therefore, targeting the
26
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
activity of fXII is cited to potentially attenuate or inhibit surface-induced clotting, thereby
preventing biomaterial-associated thrombosis (Gorbet and Sefton, 2004; Zhuo et al.,
2006; Vogler and Siedlecki, 2009; Sanchez et al., 2002; Chen et al., 2007).
The procoagulant effect of blood-contacting devices depends on the composition
of the surface. Attenuating this prothrombotic response may be achieved either by (a)
reducing blood protein adsorption, or (b) inhibiting thrombin generation. Many protein
repellent surfaces, such as polyethylene glycol (PEG), consist of “passive” coatings that
render the surface less prone to protein adsorption. Although protein resistant coatings
attenuate the adsorption of non-specific proteins, clotting may still occur. Alternatively,
“active” surface coatings use inhibitors to inhibit clotting enzymes.
For example,
heparin-based coatings catalyze the inhibition of fXa and thrombin by antithrombin,
which reduces the level of thrombin. Decreased thrombin generation, in turn, leads to a
lower production of fibrin and cell activation. Current antithrombotic surfaces involve
the use of synthetic and biological ligands that affect protein adsorption and enzyme
activity (Jordan and Chaikof, 2007).
Despite the multiple ligands that have been
investigated, current antithrombotic coatings have had limited success in the clinical
setting. The following sections highlights and describes some of the present materials
used to coat blood-contacting devices.
27
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
1.7 Antithrombotic surface modifications
In the past several decades, surface modifications have been developed to improve
the patency of blood-contacting devices and reduce the risk of biomaterial-associated
thrombosis. Protein resistant coatings and anticoagulant molecules form the largest group
of agents investigated for surface pacification. Polyethylene glycol (PEG), albumin,
heparin, covalent antithrombin-heparin (ATH) complex, thrombomodulin, and TFPI
target multiple proteases, while hirudin, bivalirudin, D-Phe-Pro-Arg chloromethylketone
(PPACK), and D-Phe-Pro-Arg-Pro-Gly (fPRPG) target thrombin.
However, these
inhibitors have little to no activity against upstream targets such as fXII. Therefore, these
surface modifications may not prevent continuous activation of the contact pathway.
Recent publications from our group using CTI show that inhibition of the contact
pathway can attenuate contact-mediated clotting, and present a novel approach to
developing an antithrombotic surface. The following sections provide an overview of the
current research into antithrombotic surface modification.
1.7.1 Poly(ethylene glycol) Surfaces
The most widely used synthetic polymer for blood-contacting surfaces is
poly(ethylene glycol) (PEG) and its higher molecular weight relative, poly(ethylene
oxide) (PEO). These materials provide neutral surfaces to reduce biomaterial-induced
coagulation (Hansson et al., 2005). PEG is a polymer chain consisting of ether (CH2-OCH2)- monomers. The small repeating units create a surface that contains few protein
28
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
and cell binding sites. In addition, these ethylene glycol units allow PEG chains to be
fully solvated in an aqueous environment, creating a hydrophilic surface. These chains
exhibit low protein adsorption and high hemocompatibility (Suggs et al., 1999). PEG and
PEO coated surfaces also resist the adsorption of platelets and fibrinogen (Merrill and
Salzman, 1983).
PEG chains are also used as a “spacer” group for covalent attachment of ligands
onto a solid surface support. Ligands directly attached to a surface may not have full
access to their targets. Attaching ligands to a surface via a spacer can reduce this steric
hindrance by endowing the ligand with greater flexibility, thereby enhancing the potential
for it to interact with its target. Because of the free-rotating capability of its ether
linkages, PEG chains experience a high degree of flexibility (Lee et al., 1995). PEG
spacers have been exploited for the attachment of anticoagulant agents such as heparin
(Chen et al., 2005b).
Therefore, PEG spacers provide several benefits for surface
modification and hemocompatibility.
1.7.2 Albumin Coated Surfaces
Albumin, a serum protein, circulates at a concentration of 30 – 50 g/L in plasma.
Because of its low cost and abundance, albumin has been investigated as a pacifying
modification for artificial surfaces. Guidoin et al created a glutaraldehyde-crosslinked
albumin coating that demonstrated reduced platelet and leukocyte adhesion and
29
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
aggregation, and reduced fibrin formation in vitro (Guidoin et al., 1976; Guidoin et al.,
1983; Kottke-Marchant et al., 1989). Studies in dogs, however, showed little difference
in the amount of platelet deposition between albumin-coated and uncoated vascular grafts
(Marois et al., 1996).
Similar findings were reported with albumin-coated vascular
prostheses (al Khaffaf and Charlesworth, 1996; Kudo et al., 2002). Although albumin
coated surfaces demonstrated reduced platelet adhesion in vitro, such coating does not
appear to attenuate the procoagulant response.
1.7.3 Heparin modified surfaces
Heparin has been extensively used for the prevention of thrombotic disorders
(Hirsh et al., 2001). As an anticoagulant, heparin interacts with antithrombin via its
pentasaccharide sequence, and catalyzes inhibition of clotting proteases including
thrombin, fXa, fIXa, fXIa, fXIIa, and fVIIa (Tollefsen and Blinder, 1995). By catalyzing
the inhibition of thrombin, heparin not only prevents fibrin formation, but also blocks
thrombin-induced activation of platelets and factors V, VIII and XI. Due to its wide
target array, heparin is a highly potent anticoagulant making it an obvious choice for
antithrombotic coating.
The first use of a heparin coated surface was in 1963, when it was reported that
heparin coatings on graphite surfaces prolonged the in vitro and in vivo clotting times
(Gott et al., 1963).
Since then, heparin has been extensively investigated as an
antithrombotic surface modification. Surface modification with heparin has been shown
30
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
to improve the hemocompatibility of cardiopulmonary bypass grafts (Wendel and Ziemer,
1999).
However, heparin-coatings have shown limited effectiveness in reducing
postoperative complications, improving patient outcome, or reducing hospital stay (Levy
and Hartman, 1996; Janvier et al., 1996; Videm et al., 1999). Certain factors may
contribute to the limited effectiveness of heparin-coated surfaces. First, since heparin
action requires antithrombin, the local concentration of antithrombin may become
limiting in areas of occlusion (Andersson et al., 2003). Second, heparin can bind with
various bioactive molecules such as growth factors and matrix proteins that could cause
secondary side effects or neutralize the activity of heparin (Sakiyama-Elbert and Hubbell,
2000). Lastly, heparin is not an effective inhibitor of the contact pathway. Antithrombin
is a slow inhibitor of fXIIa compared with C1-inhibitor, the natural fXIIa inhibitor (1.3 x
103 M-1min-1 vs 2.2 x 105 M-1min-1, respectively) (Pixley et al., 1985b). While heparin
promotes fXIIa inhibition by antithrombin by 14-fold, the rate is still slower than that of
C1-inhibitor (Pixley et al., 1985a).
Residual fXIIa will continue to initiate the
coagulation cascade. In addition, antithrombin does not inhibit PKa, which can generate
additional fXIIa. Therefore, despite its anticoagulant properties, the effectiveness of
heparin as a surface-pacifying agent remains limited.
1.7.4 ATH modified surfaces
To overcome some of the limitations of heparin, a covalently linked ATH
complex was developed (Chan et al., 1997). ATH has several unique antithrombotic
31
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
properties that distinguish it from heparin. First, ATH rapidly reacts with thrombin with a
bimolecular rate constant of 1.3 x 109 M-1s-1, a value that is 10-fold greater than noncovalently bound antithrombin and heparin (Chan et al., 1997). Second, ATH possesses
approximately 3.8-fold greater anti-Xa activity compared with standard heparin. Lastly,
inhibition of thrombin by ATH is unaffected by other heparin-binding proteins because
the covalent linkage avoids displacement of the AT moiety. Early rabbit studies with
ATH on polycarbonate urethane (Corethane) endoluminal grafts showed improved
patency compared with uncoated surfaces (Klement et al., 2002). Furthermore, ATH
coated catheters showed an ability to attenuate protein adsorption compared with control
catheters (Du et al., 2007). ATH coated catheters demonstrated attenuated catheterinduced clotting in both acute and chronic models of occlusion in rabbits (Du et al., 2005;
Klement et al., 2006).
Yet, ATH possesses a potential limitation that hinders its
applicability as a surface modification. Based on the low rates of heparin catalyzed
inhibition by antithrombin, ATH is predicted to be a poor inhibitor of the contact factor
pathway.
Because of this property, ATH coated surfaces are subject to the same
limitations as heparin, and may remain susceptible to contact-mediated clotting.
1.7.5 Thrombomodulin modified surfaces
Thrombomodulin binds with thrombin to form the thrombin-thrombomodulin
complex. This complex regulates thrombin generation through activation of the protein C
anticoagulant pathway, and inhibition of thrombin's procoagulant activity. Kishida et al
32
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
reported the first use of thrombomodulin as a surface modification (Kishida et al., 1994b;
Kishida et al., 1994a; Kishida et al., 1994c). Thrombomodulin modified surfaces showed
a reduction in thrombin activity, procoagulant activity, and platelet adhesion compared
with unmodified surfaces in vitro. Relatively little work has been done to follow up on
the potential effectiveness of immobilized thrombomodulin in vivo.
Several
disadvantages may hinder the application of thrombomodulin as a surface modification.
Because the thrombin-thrombomodulin complex affects only the intrinsic tenase and
prothrombinase complexes, upstream stimulation may continue to propagate thrombin
generation via the contact pathway. In addition, the thrombin-thrombomodulin complex
activates thrombin-activatable fibrinolysis inhibitor (Brummer-Ziedins and Mann, 2013).
This antifibrinolytic effect of thrombomodulin may hinder the degradation of fibrin on
biomaterial surfaces. Based on these observations, thrombomodulin may not be an ideal
surface coating for blood-contacting devices.
1.7.6 Hirudin and bivalirudin modified surfaces
Hirudin, a potent thrombin inhibitor, is a thrombin-specific inhibitor originally
isolated from medicinal leech (Hirudo medicinalis) (Toschi et al., 1996). It blocks both
the active site and fibrinogen-binding exosite of thrombin, inhibiting its activity. Unlike
heparin, hirudin is capable of inhibiting both free and clot-bound thrombin (Weitz et al.,
1990). Therefore, hirudin possesses potent and specific anti-thrombin activity. Because
of these properties, hirudin has been used for antithrombotic surface modification.
33
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Compared with uncoated surfaces, hirudin-coated surfaces display reduced
platelet adhesion, prolonged partial thromboplastin time and thrombin clotting times, and
decreased rates of clot formation in plasma (Seifert et al., 1997; Phaneuf et al., 1997;
Phaneuf et al., 1998). An in vitro flow loop model demonstrated that covalently bound
hirudin reduced local thrombin concentration under physiological flow conditions
(Berceli et al., 1998).
In vivo, knitted Dacron patches coated with hirudin had no
thrombus and a thin layer of platelets and plasma proteins compared with control patches,
which possessed a thick pseudointima composed of a fibrin-rich thrombus (Wyers et al.,
1999).
A derivative of hirudin, bivalirudin also has been used for anticoagulant surface
modification.
Like hirudin, bivalirudin forms a bivalent complex with thrombin.
However, the affinity of bivalirudin for thrombin is 30,000 times weaker than that of
hirudin. Compared with uncoated surfaces, bivalirudin-coated surfaces display reduced
platelet adhesion and activation, decreased fibrinogen adsorption, and a decreased rate of
clot formation in vitro (Lu et al., 2012). Bivalirudin coated surfaces demonstrate reduced
thrombus formation and improved endothelium cell growth in vivo compared with
control surfaces (Yang et al., 2012).
Hirudin and bivalirudin surface coatings, however, may be prone to contact
activation, owing to their lack of anti-fXIIa activity, but studies are needed to validate this
claim.
34
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
1.7.7 PPACK and fPRPG modified surfaces
Peptide based thrombin inhibitors, such as PPACK and fPRPG have been
investigated as a potential anticoagulant surface coating, but have not gained wide
acceptance due to their low specificity and poor inhibition. These peptides occupy the
active site of thrombin, prohibiting substrate binding and catalytic activity. PPACK and
fPRPG have been immobilized onto polymer films and tetra(ethylene glycol) terminated
self-assembled monolayers (Freitas et al., 2010; Maitz et al., 2010). These surfaces
display increased thrombin adsorption, increased thrombin inhibition, and prolonged
clotting times in vitro compared with uncoated surfaces. However, since these peptide
inhibitors form 1:1 stoichiometric complexes, efficacy is dependent on the surface density
and large amounts are required to effectively attenuate clotting. This limitation can
hinder its applicability as an antithrombotic surface modification.
Lastly, the
antithrombotic properties of modified peptide coated surfaces have yet to be explored in
vivo.
1.7.8 TFPI modified surfaces
TFPI is a Kunitz-type inhibitor that regulates the extrinsic and common pathways.
TFPI directly inhibits fXa and the TF-fVIIa complex.
Inhibition occurs through
interaction between TFPI, fXa, and TF-fVIIa to form a quaternary complex. By targeting
both proteases, TFPI effectively suppresses the extrinsic pathway.
35
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Early experiments involved passive adsorption of TFPI onto vascular grafts. Sun
et al noted that TFPI-adsorbed grafts in the aorta of dogs remained patent for up to 3
months, and displayed reduced thickening of the intima and occlusion compared with
control albumin-coated grafts (Sun et al., 2001).
Subsequently, Raybagkar et al
(Raybagkar et al., 2004) demonstrated that recombinant TFPI adsorbed onto collagen
impregnated knitted Dacron surfaces had reduced fibrin deposition and reduced fXa
activity compared with untreated surfaces, under both static and low flow conditions in
whole blood. Interestingly, when blood was supplemented with CTI, a fXIIa-specific
inhibitor, fibrin deposition was reduced by 40% in the presence of an uncoated surface
compared with whole blood without supplemental CTI. The presence of a TFPI coated
surface reduced fibrin deposition by only an additional 18% (Raybagkar et al., 2004).
This suggests that the contact pathway is primarily responsible for surface-mediated
clotting, whereas the extrinsic pathway may play a smaller role. Further validation of
these results is required.
1.8 Need for New Approaches
1.8.1 The Contact Factor Pathway as a Target for Anticoagulation
Despite the use of anticoagulant drugs and innovations in biomaterial research, the
development of a completely non-thrombogenic surface remains elusive.
Current
antithrombotic surfaces target thrombin or fXa, whereas protein resistant surfaces merely
reduce protein adsorption. As an unexploited avenue for anticoagulation, inhibitors of the
36
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
contact pathway may provide advantages over current approaches. Although the contact
factor pathway does not significantly affect hemostasis, it may contribute thrombosis
(Furie and Furie, 1991; Colman, 2006).
FXII-deficient mice do not demonstrate
spontaneous bleeding or excessive bleeding upon injury (Kleinschnitz et al., 2006; Renne
et al., 2005). These mice, however, are resistant to thrombosis (Renne et al., 2005).
During catheter thrombosis, a fibrin sheath develops on the catheter surface. Inactive
fXII may lead to attenuated fibrin sheath development. From a biomaterials perspective,
targeting the contact factor pathway may attenuate contact-mediated coagulation and
therefore reduce the development of thrombosis.
Physiological inhibitors regulate the contact factor pathway. The major one is C1inhibitor, which inhibits PKa, fXIa, and fXIIa (Schapira et al., 1982; Pixley et al., 1985b;
Meijers et al., 1988). Despite its relative abundance in plasma (50 µg/mL) compared with
its targets, C1-inhibitor exhibits a slow rate of fXIIa inhibition (2.2 x 105 M-1 min-1), but
is approximately 200-fold faster than antithrombin alone (1.3 x 103 M-1 min-1) (Pixley et
al., 1985b). Although antithrombin is the predominant regulator of coagulation, it plays
only a minor role during contact factor inhibition because the rate of heparin-catalyzed
inhibition of fXIa and fXIIa is significantly lower than that of fXa or thrombin. Despite
their abundance, other physiological inhibitors have not been reported to inhibit the
contact factor pathway.
Exogenous inhibitors of the contact pathway have also been investigated.
Aprotinin inhibits the activity of PKa and has been examined as an anti-fibrinolytic agent.
37
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Cardiac surgery patients receiving aprotinin to reduce postoperative bleeding were
reported to have higher rates of renal failure, myocardial infarction, stroke, and in rare
cases, anaphylaxis (Cohen et al., 1999). Because there are few natural inhibitors of the
contact pathway, novel ways of targeting the contact pathway are being developed.
These methods include antisense oligonucleotides, nanobodies, and aptamers.
1.8.2 Corn trypsin inhibitor
A more specific inhibitor is corn trypsin inhibitor (CTI), an inhibitor of fXIIa and
trypsin. Because CTI suppresses the contact factor pathway by inhibiting fXIIa, it is
often included in experiments studying the extrinsic pathway in vitro (Okorie et al., 2008;
van Veen et al., 2008). CTI is a 12 kDa protein of 112 amino acids isolated from the
kernels of corn (Figure 1.6). CTI forms a one-to-one complex with either trypsin or
fXIIa. Kinetic studies show that the inhibition constant (Ki) of CTI for fXIIa is 2.4 x 10-8
M, and it reacts with a rate constant of 6.0 x 107 M-1 min-1 (Hojima et al., 1980). Thus,
CTI inhibits fXIIa at a rate approximately 300- and 4600-fold faster than C1-inhibitor and
antithrombin, respectively. Because it reacts specifically with fXIIa, CTI is an attractive
candidate to use as an antithrombotic coating for surfaces. Therefore, we set out to
examine its potential for attenuating the procoagulant activity of catheters. Inhibition of
the contact factor pathway using CTI significantly prolongs plasma clotting times by 4 to
5 fold, which is consistent with observations with the activated partial thromboplastin
time (aPTT), a contact-mediated clotting assay (Hojima et al., 1980; Rand et al., 1996).
38
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
In our studies, CTI attenuated catheter-induced plasma clotting, but did not affect TFinduced clotting (Yau et al., 2011). As of yet, CTI has not been used in a clinical
application.
39
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 1.5: Crystal structure of Corn Trypsin Inhibitor (CTI).
The structure of CTI is shown in ribbon format. The figure highlights specific regions
such as primary amine groups at the residue Lys69 and at the N-terminal region (red), and
the reactive site at Arg62 (magenta). Crystal structure was prepared with the PyMOL
Molecular Graphics System, Version 1.1eval Schrödinger, LLC., using Protein Data Base
file 1BFA.
40
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
1.8.3 Antisense-mediated gene knockdown of coagulation factors
Antisense therapy is used for treatment of genetic disorders and infections. An
antisense oligonucleotide (ASO) is a single-stranded deoxyribonucleotide that is
complementary to a target mRNA. Hybridization of ASO to the target mRNA via
Watson-Crick base pairing can result in specific inhibition of gene expression, resulting
in reduced levels of translation of the target transcript (Crooke, 2004) (Figure 1.5). ASOs
are useful tools to study the effect of a loss-of-function and target validation. However,
ASOs are increasingly being evaluated as novel tools for the treatment of diseases.
Typically, ASO-mediated protein knockdown is caused by the inclusion of RNase H, an
endonuclease (Wu et al., 2004). ASOs hybridize with their target mRNA to form an
mRNA-ASO heteroduplex. The mRNA is then degraded by RNase H, leaving the ASO
intact.
Other mechanisms by which ASOs can induce protein knockdown include
blocking ribosomal translation by steric hindrance, interfering with mRNA maturation,
and destabilization of pre-mRNA in the nucleus (Kurreck, 2003).
ASO technology is particularly effective for quantitative reduction of coagulation
factor expression. Coagulation factors are primarily synthesized in the liver, an organ
that is highly sensitive to ASO therapy (Chan et al., 2006). Recently, coagulation factor
specific ASOs have been used to evaluate the role of fXII, fXI, and prekallikrein in
various thrombosis models (Zhang et al., 2010; Revenko et al., 2011; Younis et al., 2012;
Crosby et al., 2013). Mice given fXI-specific ASO demonstrated a ~80% reduction in
fXI mRNA expression, leading to a corresponding reduction of plasma fXI protein and
41
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
activity. FXI ASO treatment in mice attenuated stenosis- and ferric chloride-induced
arterial and venous thrombosis in a dose-dependent fashion, but had no effect on tail
bleeding (Revenko et al., 2011).
Coagulation factor-specific ASOs have also been
studied in non-human primates. In cynomolgus monkeys, a 25% to 30% reduction in
plasma fXI activity resulted in a 10% to 17% prolongation of the aPTT (Younis et al.,
2012). Baboons given fXI-specific ASOs showed a greater than 50% reduction in fXI
plasma protein levels, resulting in prolongation of the aPTT and reduced clotting in an
arteriovenous shunt model and no increase in bleeding (Crosby et al., 2013).
42
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 1.6: Mode of action of antisense oligonucleotide (ASO). The ASO is taken up
by cellular endocytosis and hybridizes with target mRNA in the cytoplasm. Formation of
the ASO-mRNA heteroduplex induces activation of RNase H, leading to selective
degradation of bound mRNA. Adapted from Chan et al (Chan et al., 2006).
43
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Chapter 2: Aims and Hypotheses and Objectives
2.1 Aims and Hypotheses
Conventional anticoagulants, such as heparin and warfarin, attenuate coagulation
at multiple levels. Heparin binds to antithrombin and accelerates the rate at which it
inhibits thrombin, fXa, and upstream coagulation enzymes in both the extrinsic and
intrinsic pathways.
Likewise, by interfering with the vitamin K cycle in the liver,
warfarin reduces the synthesis of functional clotting factors involved in the extrinsic,
intrinsic, and common pathways of coagulation. In contrast, newer anticoagulants target
only a single clotting enzyme. For example, fondaparinux only inhibits fXa, and the new
oral anticoagulants inhibit thrombin or fXa.
Although fondaparinux and the new oral anticoagulants have advantages over
heparin and warfarin, respectively, they appear to be less effective at preventing clotting
induced by blood-contacting medical devices. Thus, when fondaparinux was compared
with low-molecular-weight heparin or heparin in patients with acute coronary syndrome,
catheter thrombosis was more frequent with fondaparinux in those who underwent
percutaneous coronary intervention (PCI) (Yusuf et al., 2006b; Yusuf et al., 2006a).
Likewise, when dabigatran, an oral thrombin inhibitor, was compared with warfarin in
patients with mechanical heart valves, the study was stopped early because of a trend for
more ischemic strokes and more bleeding in those randomized to dabigatran (Eikelboom
et al., 2013). Dabigatran failed in this study even though dose escalation from 150 mg
twice daily to 300 mg twice-daily was permitted in an attempt to maintain trough drug
44
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
levels above 50 ng/ml. Despite several theories (Hylek, 2013), the explanation for the
higher number of strokes in the dabigatran group remains elusive.
We hypothesized that the inability of fondaparinux to prevent catheter thrombosis
and dabigatran to prevent thrombosis on mechanical heart valves reflects the fact that
blood-contacting medical devices activate factor XII and trigger the local generation of
fXa and thrombin in concentrations that exceed the capacity of fondaparinux or
dabigatran to inhibit them. To test this hypothesis, we examined whether catheters induce
coagulation, and if so, whether catheters trigger coagulation by activating factor XII. In
addition, building on the observation that since fondaparinux is less effective than heparin
at preventing catheter thrombosis in patients undergoing PCI and dabigatran is less
effective than warfarin at preventing thrombotic events in patients with mechanical heart
valves, we hypothesized that downstream targets, such as thrombin and fXa, are
insufficient to inhibit catheter-induced clotting.
Moreover, we hypothesized that
supplemental anticoagulants are needed in conjunction with downstream inhibition; a
phenomenon that is observed in fondaparinux-treated patients undergoing PCI and
receiving adjunctive heparin (Yusuf et al., 2006b; Steg et al., 2010). To test these
hypotheses, we measured the prothrombotic activity of catheters and the effect of
systemic anticoagulation, as well as surface modifications in two in vitro models, plasma
clotting and thrombin generation assays, and a rabbit model of catheter thrombosis.
45
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
2.2 Objectives
Our objectives were as follows:
Objective 1: To investigate the mechanism by which catheters trigger coagulation.
Specific aims:
1. Examine the prothrombotic activity of catheters in vitro using plasma clotting
assays and in vivo using a rabbit model of catheter thrombosis.
2. Compare the role of the TF and contact pathways of coagulation.
Objective 2: To compare the effect of multi-targeted anticoagulants and singletarget anticoagulants on catheter-induced clotting.
Specific aims:
3. Examine the effect of thrombin inhibition on catheter-induced clotting.
4. Examine the effect of fXa inhibition on catheter-induced clotting.
5. Evaluate the effect of upstream inhibition on catheter-induced clotting.
Objective 3: To modify surfaces that target upstream clotting factors and examine
the efficacy of surface modification on catheter-induced clotting.
Specific aims:
1. To immobilize CTI onto catheter surfaces and quantify its anticoagulant activity.
2. To compare CTI-coated catheters with uncoated catheters in rabbits.
46
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Chapter 3: Mechanism of catheter thrombosis: Comparison of the
antithrombotic properties of fondaparinux, enoxaparin, and heparin in
vitro and in vivo
Forward
This study investigates the mechanism by which catheters induce clotting and
demonstrate the efficacy of anticoagulant drugs in vitro and in vivo.
This study
demonstrates that catheters possess prothrombotic activity, which is attenuated in contact
factor deficient plasmas. In addition, this study demonstrates that multi-target inhibitors
such as heparin and LMWH inhibit catheter-induced clotting whereas fondaparinux, a
fXa inhibitor, had no effect.
Copyright Information: This research was originally published in Blood. Jonathan W.
Yau, Alan R. Stafford, Peng Liao, James C. Fredenburgh, Robin Roberts, and Jeffrey I.
Weitz. Mechanism of catheter thrombosis: Comparison of the antithrombotic properties
of fondaparinux, enoxaparin, and heparin in vitro and in vivo. Blood. 2011; 118(25):
6667-6674. © the American Society of Hematology.
47
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
3.1 Abstract
In patients undergoing percutaneous coronary intervention (PCI), catheter thrombosis is
more frequent with fondaparinux than heparin. This study was undertaken to identify the
responsible mechanism and develop strategies for its prevention. PCI catheter segments
shortened plasma clotting times from 971 ± 92 to 352 ± 22 s. This activity is factor XIIdependent because it was attenuated with corn trypsin inhibitor and abolished in factor
XII-deficient plasma. Heparin and enoxaparin blocked catheter-induced clotting at 0.5
and 2 anti-Xa U/ml, respectively, whereas fondaparinux had no effect. Addition of
fondaparinux to bivalirudin or low-dose heparin attenuated catheter-induced clotting
more than either agent alone. In a rabbit model of catheter thrombosis, a 70 anti-Xa U/kg
intravenous bolus of heparin or enoxaparin prolonged the time to catheter occlusion by
4.6- and 2.5-fold, respectively, compared with saline, whereas the same dose of
fondaparinux had no effect. Although 15 anti-Xa U/kg heparin had no effect on its own,
when given in conjunction with 70 anti-Xa U/kg fondaparinux, the time to catheter
occlusion was prolonged 2.9-fold.
These findings indicate that (a) catheters are
prothrombotic because they trigger fXII activation; and (b) fondaparinux does not prevent
catheter-induced clotting unless supplemented with low-dose heparin or bivalirudin.
48
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
3.2 Introduction
In recent years, percutaneous coronary intervention (PCI) has emerged as routine
therapy for acute coronary syndromes (ACS). Traditionally, unfractionated heparin has
been the anticoagulant of choice to prevent thrombotic complications in ACS patients
undergoing PCI. Over the past 10 years, however, there has been a shift to the use of
smaller heparin fragments, starting with low-molecular-weight heparin (LMWH) and,
more recently, with fondaparinux, a synthetic pentasaccharide.(Ferguson et al., 2004;
Montalescot et al., 2006) With better bioavailability, a longer half-life, and a more
predictable anticoagulant response, LMWH and fondaparinux are more convenient than
heparin because they can be given subcutaneously and they do not require anticoagulation
monitoring.(Buller et al., 2003; Buller et al., 2004; Samama and Gerotziafas, 2003) In
addition, the risk of heparin-induced thrombocytopenia is lower with LMWH and
fondaparinux than it is with heparin.(Warkentin, 2010)
Recently, fondaparinux was compared with LMWH for treatment of patients with
non-ST-segment elevation acute coronary syndrome and with heparin or placebo for
management of those with ST-segment elevation myocardial infarction.(Yusuf et al.,
2006a; Yusuf et al., 2006b) Although fondaparinux was found to be safe and effective in
both trials, it was associated with an increased risk of guide catheter thrombosis in
patients who underwent PCI.(Mehta et al., 2007) To explore the mechanism responsible
for this phenomenon and to identify strategies to prevent it, we developed an in vitro
plasma clotting assay to evaluate the extent to which PCI guide catheters activate clotting.
49
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Studies were then performed to (a) determine whether catheter-induced shortening of the
clotting time reflects activation of the contact or extrinsic pathway of coagulation, (b)
compare the capacities of heparin, enoxaparin or fondaparinux to inhibit catheter-induced
clotting, and (c) examine the effect of supplemental heparin or bivalirudin on the capacity
of fondaparinux to inhibit catheter-induced clotting. Finally, we used a model of
accelerated catheter thrombosis in rabbits to determine whether our in vitro findings also
apply in vivo.
3.3 Materials and Methods
3.3.1 Materials
Factor (f) VII-, fXI- and fXII-deficient human plasmas were obtained from Affinity
Biologicals (Ancaster, ON), whereas relipidated recombinant human tissue factor
(RecombiPlastin), was purchased from Hemoliance Instrumentation Laboratory
(Lexington, MA). Based on immunoassay (American Diagnostica, Greenwich, CT), the
tissue factor concentration in Recombiplastin is 0.3 µg/ml. Corn trypsin inhibitor (CTI),
bovine fXa and antithrombin, human thrombin, fXIIa, fXIa, fIXa, and fXa were
purchased from Enzyme Research Laboratories, Inc. (South Bend, IN). Fondaparinux
was from GlaxoSmithKline, enoxaparin was from Sanofi-Aventis Pharma, Inc. (Laval,
PQ), and unfractionated heparin was from Leo Pharma, Inc. (Thornhill, ON). 6 Fr Cyber
guide catheters, composed of polyether block amide and polytetrafluoroethylene(Berg
and Galdonik, 10 A.D.), with an outer diameter of 2 mm were a generous gift from
50
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Boston Scientific, Natick, MA; 7 Fr polyurethane (PU) single lumen catheters (Solo-Cath
PU-C70) were purchased from Solomon Scientific (Plymouth Meeting, PA).
3.3.2 Preparation of human platelet-poor plasma
After obtaining written informed consent, blood was collected from the antecubital veins
of at least 10 healthy volunteers into 3.8% trisodium citrate (9:1 vol/vol) using a butterfly
needle. The blood was maintained on ice until cellular elements were sedimented by
centrifugation at 1500 X g for 20 min at 4°C. After removing the plasma and subjecting
it to a second centrifugation step under the same conditions, the platelet-poor plasma was
harvested, pooled and frozen in aliquots at -70°C.
3.3.3 In vitro PCI catheter-induced clotting assay
PCI catheters were pressed flat with a hand roller and cut into 1.6 cm segments; a length
chosen to fit the circumference of wells of 96-well polystyrene plates (Evergreen
Scientific, Los Angeles, CA). Catheter segments were then shaped into rings and placed
around the perimeter of wells, leaving the center of the well unobstructed. To the wells
were added 75 µl of 20 mM Tris-HCl, 150 mM NaCl, pH 7.4 (TBS) and 100 µl of
plasma. After 10 min incubation at 37°C, clotting was initiated by addition of 25 µl of a
pre-warmed 160 mM CaCl2 solution (to yield a final CaCl2 concentration of 20 mM),
and clot formation was assessed by monitoring absorbance at 340 nm in kinetic mode
using a SPECTRAmax plate reader (Molecular Devices, Sunnyvale, CA). Clotting times
51
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
were defined as the time to half maximal absorbance and were calculated by instrument
software from plots of absorbance versus time. Studies were repeated in plasma lacking
fVII, fXI, or fXII. In some experiments, Recombiplastin was added to normal plasma to
initiate clotting in wells that did or did not contain catheter segments. Where indicated,
varying concentrations of CTI, heparin, enoxaparin or fondaparinux were incubated in
plasma before recalcification. In subsequent experiments, fondaparinux was used in the
absence or presence of heparin (at concentrations of 0.05 or 0.1 anti-Xa U/ml),
bivalirudin (at concentrations of 12.5 or 50 µg/ml), or CTI (at a concentration of 100
µg/ml). The specific anti-Xa activities of heparin, enoxaparin or fondaparinux used in
these experiments were 180, 100 and 700 U/mg, respectively. Values for heparin and
enoxaparin were provided by the suppliers, whereas, as previously reported, the specific
anti-Xa activity of fondaparinux was obtained experimentally.(Visser and Meuleman,
1990) Concentrations of bivalirudin were selected to match the plasma levels achieved
with therapeutic doses of the drug.(Kastrati et al., 2008)
3.3.4 Comparison of the effect of heparin or fondaparinux on clotting induced by clotting
enzymes in the extrinsic, contact or common pathways of coagulation
Preliminary experiments were done to identify the concentrations of Recombiplastin,
thrombin, fXa, fIXa, fXIa or fXIIa that produced clotting times of approximately 300 s; a
value similar to that achieved with PCI catheter segments alone. A 1/1500-fold dilution
of Recombiplastin, or thrombin, fXa, fIXa, fXIa or fXIIa concentrations of 5, 0.13, 2.0,
52
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
0.5 or 20 nM, respectively, yielded the requisite clotting times. For these experiments, 75
µl of TBS and 100 µl of plasma were added to wells of a 96-well plate in the absence or
presence of varying concentrations of heparin or fondaparinux. After incubation for 10
min at 37°C, clotting was initiated by addition of 25 µl of a 160 mM CaCl2 solution
containing the requisite concentration of the various clotting enzymes. For thrombininitiated reactions, CaCl2 was omitted to avoid feedback activation of coagulation and
thrombin was added after the 10-min incubation.
Clot times were determined by
absorbance as described above.
3.3.5 Comparison of the effects of heparin, enoxaparin or fondaparinux on the time to PU
catheter occlusion in rabbits
A rabbit model of accelerated catheter thrombosis was developed by modifying the
procedures of Du et al.(Du et al., 2005) Studies were approved by the Animal Research
Ethics Board at McMaster University and all procedures were in compliance with
Canadian Council on Animal Care guidelines. Briefly, male New Zealand white rabbits
(3 – 3.5 kg), purchased from Charles River Canada, were anaesthetized with a
ketamine/xylazine mixture. PU catheters were cut into 15 cm segments and a 3.8 cm 16
gauge needle (reduced to 1.9 cm and with the end filed obliquely and then beveled) was
inserted into one end. Catheters were flushed inside and outside with 10 ml normal saline
prior to a final flush with 1 ml of saline to remove any bubbles. After exposing the right
jugular vein via a ventral incision, the catheter was inserted, advanced toward the heart
53
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
for 7 cm and secured with a ligature. Using a syringe, 3 ml of blood was slowly
withdrawn from the catheter, maintained within the syringe for 2 minutes, and then
slowly re-injected. The catheter was then flushed with 2 ml of saline. This cycle was
repeated every 5 min. A pressure transducer (Truwave Disposable Pressure Transducer,
Baxter Healthcare Corp., Irvine, CA), placed between the catheter and the syringe, was
used to quantify pressure within the catheter. The time to catheter occlusion was taken as
the time when blood could no longer be withdrawn from the catheter and the pressure
within the catheter was greater than 15 mm Hg. At this point, or at 4 h if catheter
occlusion did not occur, the study was terminated and 1,000 U of heparin was injected via
a central ear artery to prevent post-mortem thrombosis, and the rabbits were euthanized
with 1.5 ml of euthanyl.
Using this accelerated catheter thrombosis model, we first determined the time to
catheter occlusion in rabbits (n=5 per group) randomized to receive saline or a 70 anti-Xa
U/kg intravenous bolus of heparin, a dose within the recommended range for patients
undergoing PCI(Goodman et al., 2008; Harrington et al., 2008), or an equivalent dose of
enoxaparin or fondaparinux immediately prior to catheter insertion.
Next, a dose-
response study was performed with heparin to identify heparin doses that had little or no
effect on the time to catheter occlusion. For this study, the time to catheter occlusion was
compared in rabbits (n=5 per group) randomized to receive an intravenous bolus of either
saline or heparin at doses of 15, 30, 50, or 70 anti-Xa U/kg. Building on the finding that a
15 anti-Xa U/kg dose of heparin had a minimal effect on the time to catheter occlusion,
54
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
we then compared the time to catheter occlusion in rabbits (n=5 per group) randomized to
receive an intravenous bolus of saline, 15 anti-Xa U/kg heparin, 70 anti-Xa U/kg
fondaparinux, or the two agents in combination.
3.3.6 Blood sample analysis
Before catheter insertion and at intervals thereafter, 2 ml aliquots of blood were collected
from a central ear vein into syringes prefilled with 0.2 ml of 3.8% citrate.
After
centrifugation at 1500 X g in a micro-centrifuge, platelet-poor plasma was harvested and
anti-Xa activity was determined by chromogenic assay. Briefly, 2 μl of plasma was
mixed with 88 μl of 50 mM Tris-HCl, 150 mM NaCl, pH 8, and containing 2.5 mM
EDTA. After incubation with 10 µl of a 5 µM bovine antithrombin solution for 4 min at
37°C, a 20-µl aliquot was removed and 10 µl of 10 nM bovine Xa was added and
incubated for 30 s prior to the addition of 20 µl of 500 µM S2765 (DiaPharma Group
Inc., West Chester, OH). The amidolytic activity was then measured at 405 nm for 5 min
using a plate reader. An anti-Xa calibration curve was constructed in rabbit plasma
containing known concentrations of heparin, enoxaparin, and fondaparinux. The specific
anti-Xa activities of heparin, enoxaparin, and fondaparinux in rabbit plasma were 180,
100, and 300 U/mg, respectively. Values for heparin and enoxaparin are in agreement
with those in human plasma provided by the suppliers, whereas, as previously reported,
the specific anti-Xa activity of fondaparinux is 2-fold lower in rabbit plasma than in
human plasma.(Amar et al., 1990)
55
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
3.3.7 Statistical analyses
Results are presented as the mean ± standard deviation (SD). Unless otherwise stated,
experiments were performed at least three times. Comparisons of means of paired data
were performed using paired Student’s t-tests.
To examine the effect of varying
concentrations of CTI on catheter-induced clotting times in human plasma, the clotting
times were fitted to a linear model, and variations in slope were used to estimate the
standard deviation. Mean slopes were then compared using t-tests. To compare the
effects of varying concentrations of heparin, enoxaparin or fondaparinux on clotting times
in human plasma, the clotting times were plotted versus the drug concentrations displayed
on a log scale; a method that yielded a linear dose-response with each agent. The effects
of the various anticoagulants on clotting times were then compared in terms of
differences in slopes as determined by linear regression analysis. For all analyses, a p
value < 0.05 was considered statistically significant.
3.4 Results
3.4.1 Effect of PCI catheter segments on plasma clotting times
To explore the possibility that PCI catheters are prothrombotic, the clotting time of
recalcified plasma was measured in a plate reader in the absence or presence of catheter
segments. Catheter segments were placed around the perimeter of wells and plasma
clotting times were determined by monitoring absorbance. As illustrated in Figure 3.1,
clot formation, evident as an increase in turbidity, started on the outside catheter surface
56
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
and then extended toward the center of the well. The mean clotting time of normal
plasma was 3-fold shorter in the presence of catheter segments than in their absence (352
± 22 and 971 ± 92 s, respectively; p < 0.005; Table 1). Thus, PCI catheter segments
exhibit prothrombotic activity, consistent with the observation that catheter thrombosis
can occur in patients undergoing PCI.
57
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 3.1: Catheter-induced clotting in platelet-poor plasma. Pooled platelet-poor
plasma was incubated in wells of a 96-well plate at 37°C in the absence (open circles) or
presence of PCI catheter segments (closed circles). After addition of CaCl 2 to 20 mM,
absorbance was monitored at 340 nm at 10 s intervals and the values were plotted versus
time. A well from a separate plate at 37°C was photographed at 30 s intervals and
individual images at four time points (labeled a-d) are displayed above the plot. The
58
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
arrow identifies the catheter segment. With increasing incubation times, an opaque clot
forms on the catheter segments positioned at the periphery of the well and then extends to
fill the center of the well.
59
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Type of Plasma
Normal
Condition
Control
Catheter
RecombiPlastin
Catheter + RecombiPlastin
Time to Clot (s)
970 ± 92
351 ± 22*
102 ± 1*
93 ± 3*
fVII-deficient
Control
Catheter
RecombiPlastin
Catheter + RecombiPlastin
782 ± 35
387 ± 27*
514 ± 30*
320 ± 28*
fXI-deficient
Control
Catheter
RecombiPlastin
Catheter + RecombiPlastin
>2500
>2500
136 ± 38*
140 ± 45*
fXII-deficient
Control
Catheter
RecombiPlastin
Catheter + RecombiPlastin
Table 3.1: The effect of catheter segments or tissue
2467 ± 306
1625 ± 532
133 ± 40*
131 ± 38*
factor (Recombiplastin) on
clotting times in normal, or fVII-, fXI-, or fXII-deficient platelet-poor plasma.
Plasma was incubated for 10 min at 37°C in the presence of PCI catheter segments prior
to the addition of CaCl2 to 20 mM with or without a 1/1500-fold dilution of
Recombiplastin. As a control, clotting was monitored in the absence of catheters or
Recombiplastin. Absorbance was monitored up to a maximum of 2500 s in a plate reader
and time to clot was determined as the time to half maximal absorbance. Results reflect
the mean ± SD of at least 3 determinations. Asterisks denote p < 0.05 compared with the
respective controls.
60
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
3.4.2 Determination of the coagulation pathway responsible for the prothrombotic
activity of PCI catheter segments
Additional experiments were performed to determine whether PCI catheters exert their
prothrombotic activity through activation of the extrinsic or contact pathway of
coagulation. To explore involvement of the extrinsic pathway, two sets of experiments
were performed. First, coagulation was initiated with Recombiplastin in the absence or
presence of catheter segments.
Catheter segments had no significant effect on
Recombiplastin-induced clotting (Table 3.1), suggesting that the extrinsic pathway of
coagulation is not affected by catheters. Second, the effect of catheter segments on the
clotting time in normal plasma was compared with that in plasma deficient in fVII. No
significant difference in clotting times was observed between normal plasma and plasma
deficient in fVII in the presence of catheters, suggesting that catheter-induced activation
of coagulation is not dependent on fVII. Taken together, these findings suggest that the
prothrombotic activity of PCI catheters does not reflect activation of the extrinsic
pathway of coagulation.
Next, studies were done to determine whether PCI catheters activate the contact
pathway of coagulation. Compared with the control, CTI, a potent and specific inhibitor
of fXIIa (Hojima et al., 1980), had minimal effect on Recombiplastin-induced clotting
(334 ± 18 and 322 ± 17 s, respectively; p = 0.46). In contrast, as illustrated in Figure 3.2,
in the presence of catheter segments, CTI prolonged the clotting time, producing a
significant (p = 0.005) linear increase in clotting time as a function of CTI concentration.
61
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
These findings suggest that catheters trigger clotting via the contact pathway of
coagulation and induce the generation of fXIIa. To further explore the role of this
pathway, catheter-induced clotting in normal plasma was compared with that in plasma
deficient in either fXII or fXI. The capacity of catheter segments to promote clotting was
attenuated in both deficient plasmas (Table 3.1), suggesting that the prothrombotic effect
of catheters is dependent on these two key components of the contact pathway. Thus,
these studies demonstrate that PCI catheters exert their prothrombotic activity through the
contact pathway of coagulation.
62
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 3.2: Effect of CTI on the prothrombotic activity of PCI catheter segments.
Catheter segments were incubated with plasma for 10 min at 37°C in wells containing
increasing concentrations of CTI. Clotting was initiated by addition of CaCl 2 to 20 mM.
Time to clot was determined as the time to reach half maximal absorbance. The bars
represent the mean of at least 3 separate experiments, while the lines above the bars
reflect the SD.
63
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
3.4.3 Effect of heparin, enoxaparin or fondaparinux on PCI catheter segment-induced
clotting in plasma
We next compared the effects of heparin, enoxaparin or fondaparinux on catheter-induced
clotting. As a control, the effect of these agents on Recombiplastin-induced clotting also
was examined. As shown in Figure 3.3A, all three agents attenuated Recombiplastininduced clotting in a concentration-dependent fashion, and clotting was attenuated to
beyond 14,000 s with 0.5, 2 and 35 anti-Xa U/ml of heparin, enoxaparin, or fondaparinux,
respectively. Comparisons of slopes obtained by linear regression analysis of plots of
clotting time versus log-transformed drug concentrations yielded significant (p < 0.001)
differences among the three agents (not shown). When catheters were used to induce
clotting, heparin and enoxaparin again attenuated clotting in a concentration-dependent
fashion (Figure 3.3B).
In contrast, fondaparinux had minimal activity, prolonging
clotting times only by a maximum of 2.1-fold at a concentration of 35 anti-Xa U/ml.
Once again, comparison of slopes obtained by linear regression analysis of plots of logtransformed data yielded significant (p < 0.001) differences among the three agents.
These data suggest that higher molecular weight heparin molecules attenuate catheterinduced clotting to a greater extent than those of lower molecular weight. The minimal
effect of fondaparinux and the intermediate effect of enoxaparin in this system are
consistent with the observation that catheter thrombosis occurred more frequently in
fondaparinux-treated patients undergoing PCI than in those given enoxaparin.(Yusuf et
64
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
al., 2006b) To explore this phenomenon in more detail, the effects of heparin and
fondaparinux on different steps in the coagulation cascade were examined.
65
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
66
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 3.3: Effect of fondaparinux, enoxaparin, or heparin on the prothrombotic
activity of PCI catheter segments. Plasma was incubated with either (A) 1/1500 diluted
Recombiplastin, or (B) catheter segments, and the indicated concentrations of heparin
(squares), enoxaparin (triangles), or fondaparinux (circles) for 10 min at 37°C. After
initiating clotting by addition of CaCl2, to 20 mM, absorbance was monitored up to a
maximum of 14,000 s and time to clot was determined. The symbols represent the mean
of at least 3 separate experiments, while the lines above the symbols reflect the SD.
67
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
3.4.4 Comparison of the effect of fondaparinux and heparin on clotting induced by
Recombiplastin, thrombin or factors Xa, IXa, XIa or XIIa
In contrast to its limited effect on catheter-induced clotting, fondaparinux prolongs the
clotting time in a concentration-dependent fashion when dilute Recombiplastin is used to
induce clotting. The distinct effects of fondaparinux on catheter- and Recombiplastininduced clotting suggest that fondaparinux is limited in its capacity to inhibit clotting
triggered via the contact pathway. To further explore this possibility, we compared the
capacity of fondaparinux and heparin to inhibit clotting induced by fXIIa, fXIa, or fIXa.
When clotting was triggered with fXIIa or fXIa, heparin prolonged the clotting time in a
concentration-dependent fashion and clotting was abrogated with a concentration of 1
anti-Xa U/ml (Figure 3.4). In contrast, fondaparinux, even at concentrations up to 70
anti-Xa U/ml, had no effect on clotting induced by fXIIa or fXIa. Heparin also inhibited
clotting induced by fIXa in a concentration-dependent fashion and abrogated clotting at a
concentration of 2 anti-Xa U/ml. Fondaparinux also prolonged the fIXa clotting time 5fold at a concentration of 14 anti-Xa U/ml, consistent with the observation that
fondaparinux promotes the inhibition of fIXa by antithrombin.(Wiebe et al., 2003) When
clotting was triggered with fXa, heparin and fondaparinux attenuated clotting in a
concentration-dependent manner and clotting was abrogated with concentrations of 0.5
and 7 anti-Xa U/ml, respectively. Whereas heparin inhibited thrombin-induced clotting
in a concentration-dependent manner, fondaparinux had no effect; consistent with the
concept that fondaparinux is too short to bridge antithrombin to thrombin. Overall, these
68
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
results indicate that heparin is better than fondaparinux at inhibiting clotting induced by
coagulation enzymes of the contact pathway.
Although, fondaparinux attenuates
Recombiplastin and factor Xa-induced clotting, it has no effect on clotting triggered by
thrombin, fXIa, or fXIIa, and only limited effect on fIXa-induced clotting.
69
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 3.4: Effect of fondaparinux or heparin on clotting induced by
Recombiplastin, or coagulation enzymes.
After incubating 1/1500 diluted
Recombiplastin, 0.13 nM fXa, 5 nM fIXa, 0.5 nM fXIa, or 20 nM fXIIa in plasma
containing fondaparinux (closed circles) or heparin (open circles), at the indicated
concentrations, for 10 min at 37°C, clotting was initiated by addition of CaCl 2 to 20 mM.
For thrombin-initiated reactions, CaCl2 was omitted to avoid feedback activation of
coagulation and thrombin (fIIa) was added to 5 nM after the 10-min incubation at 37°C.
Absorbance was monitored up to a maximum of 14,000 s and time to clot was
determined. The symbols represent the mean of at least 3 separate experiments, while the
lines above the symbols reflect the SD. The arrows represent the contact, tissue factor,
and common pathways of coagulation.
70
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
3.4.5 Effect of supplemental CTI, heparin or bivalirudin on the ability of fondaparinux to
attenuate PCI catheter-induced clotting
To further investigate the inability of fondaparinux to inhibit catheter-induced clotting,
we examined the effect of supplemental CTI, heparin, or bivalirudin on the activity of
fondaparinux. As expected, fondaparinux on its own had little or no effect on catheterinduced plasma clotting. In contrast, the addition of 100 µg/ml CTI (Figure 3.5A), 0.05
or 0.1 U/ml heparin (Figure 3.5B), or 12.5 or 50 µg/ml bivalirudin (Figure 3.5C) rendered
fondaparinux more effective at attenuating catheter-induced clotting. Taken together,
these findings suggest that low doses of heparin promote the antithrombotic activity of
fondaparinux as do CTI or bivalirudin, anticoagulants that specifically target fXIIa or
thrombin, respectively.
71
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
72
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 3.5: Effect of supplemental CTI, heparin, or bivalirudin on the capacity of
fondaparinux to attenuate catheter-induced clotting. PCI catheter segments were
incubated for 10 min at 37°C in plasma containing the indicated concentration of
fondaparinux and (A) 0 (closed circles), or 100 (open circles) μg/ml CTI, (B) 0 (closed
circles), 0.05 (open circles), or 0.1 (triangles) anti-Xa U/ml heparin, or (C) 0 (closed
circles), 12.5 (open circles), or 50 (triangles) µg/ml bivalirudin. After initiating clotting
by addition of CaCl2 to 20 mM, absorbance was monitored up to a maximum of 14,000 s
and time to clot was determined. The symbols represent the mean of at least 3 separate
experiments, while the lines above the symbols reflect the SD.
73
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
3.4.6 Effect of heparin, enoxaparin or fondaparinux on time to PU catheter occlusion in
rabbits
To determine whether our in vitro data also apply in vivo, we used a rabbit model of
accelerated catheter thrombosis to compare the antithrombotic activities of heparin,
enoxaparin and fondaparinux.
PU catheters were used in this model because PCI
catheters lack the flexibility to maneuver the anatomy of the rabbit venous system. In the
initial set of studies, rabbits were randomized to receive saline or a 70 anti-Xa U/kg
intravenous bolus of heparin, enoxaparin or fondaparinux immediately prior to insertion
of a PU catheter in the right atrium via the right jugular vein. In the control rabbits given
saline, catheters occluded at 50.8 ± 7.6 min (Figure 3.6). The time to catheter occlusion
was significantly (p < 0.05) prolonged 4.6- or 2.5-fold in rabbits given heparin or
enoxaparin, respectively, but was unchanged in those given fondaparinux. All three
agents produced comparable levels of anticoagulation because mean plasma anti-Xa
levels 5 min after drug administration administered were 1.0 ± 0.1, 1.0 ± 0.1, and 1.1 ±
0.1 U/ml, with fondaparinux, enoxaparin, and heparin, respectively (p = 0.93). Therefore,
the disparate effects of these agents on the time to occlusion cannot be explained by
differing anti-Xa levels. Taken together, the minimal effect of fondaparinux on the time
to catheter occlusion and the intermediate effect of enoxaparin relative to heparin in the
rabbit model are consistent with their activities in vitro.
Next, we examined the effect of supplemental low-dose heparin on fondaparinux
activity in the rabbit model. To identify a dose of supplemental heparin that has little or
74
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
no activity, a pilot study was performed in which rabbits were randomized to receive an
intravenous bolus of either saline or heparin at doses of 15, 30, 50, or 70 anti-Xa U/kg.
As before, a heparin dose of 70 anti-Xa U/kg prolonged the occlusion time to 4 h (not
shown). Whereas the 30 and 50 anti-Xa U/kg heparin doses had intermediate effects
(prolonging the occlusion time from 50.8 ± 7.6 min to 80.4 ± 5.7, and 125.8 ± 17.8 min,
respectively), with a heparin dose of 15 anti-Xa U/kg the mean time to occlusion of 60.4
± 6.7 min was not significantly different from that in the saline-treated controls (p = 0.1).
Building on this information, rabbits were next randomized to receive an intravenous
bolus of 70 anti-Xa U/kg fondaparinux, 15 anti-Xa U/kg heparin, or the two agents in
combination. Control rabbits received an equal volume of saline. Whereas neither
fondaparinux nor low-dose heparin alone had an effect on the time to occlusion, the
combination produced a significant (p < 0.05) 2.9-fold prolongation of the mean time to
occlusion compared with that in the saline control (Figure 3.7). These findings suggest
that, like the results in vitro, supplemental low-dose heparin promotes the antithrombotic
activity of fondaparinux in a more than additive fashion.
75
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 3.6: Effect of fondaparinux, enoxaparin, or heparin on the time to PU
catheter occlusion in rabbits. Rabbits (n = 5 per group) were given saline or 70 anti-Xa
U/kg fondaparinux, enoxaparin, or heparin intravenously prior to insertion of a PU
catheter into their jugular veins.
Thereafter, every 5 minutes, 2 ml of blood was
withdrawn from the catheter, held for 2 minutes in a syringe, and slowly re-injected.
Catheter occlusion occurred when blood could no longer be withdrawn and the pressure
measured with a transducer exceeded 15 mm Hg. The bars represent the mean of at least
3 separate experiments, while the lines above the bars reflect the SD. Asterisks denote p
< 0.05 compared with the saline control.
76
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 3.7: Effect of low-dose heparin alone or in conjunction with fondaparinux on
the time to PU catheter occlusion in rabbits. Rabbits (n = 5 per group) were given an
intravenous bolus of saline, 70 anti-Xa U/kg fondaparinux, 15 anti-Xa U/kg heparin, or
the combination of 70 anti-Xa U/kg fondaparinux plus 15 anti-Xa U/kg heparin prior to
insertion of a PU catheter into their jugular veins. The time to catheter occlusion was then
determined as described in the legend to Figure 3.6. The bars represent the mean of at
least 3 separate experiments, while the lines above the bars reflect the SD. Asterisk
denotes p < 0.05 compared with the saline control.
77
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
3.5 Discussion
Because of a reduced risk of bleeding (Yusuf et al., 2006a), fondaparinux is an
attractive alternative to enoxaparin for treatment of patients with non-ST-segment
elevation acute coronary syndromes. However, the potential for catheter thrombosis in
fondaparinux-treated patients who require PCI has dampened the enthusiasm for the use
of this drug in patients who are managed invasively. To circumvent this problem, we set
out to identify the mechanism responsible for catheter thrombosis with fondaparinux and
to devise approaches for its prevention.
Using in vitro and in vivo models, we
demonstrated that (a) catheters are prothrombotic because of their propensity to activate
fXII, thereby initiating the contact pathway of coagulation, (b) whereas heparin attenuates
this phenomenon, fondaparinux is unable to inhibit catheter-induced clotting, and LMWH
has an intermediate effect, (c) supplemental bivalirudin or low-dose heparin promotes the
capacity of fondaparinux to inhibit catheter-induced clotting, supporting the concept that
adjunctive anticoagulation is useful for prevention of catheter thrombosis in
fondaparinux-treated patients.
Two lines of evidence support the concept that the prothrombotic activity of
catheters reflects the capacity to activate the contact pathway of coagulation. First, this
activity was abolished in plasma deficient in fXII or fXI, key components of the contact
pathway.
Second, the addition of CTI, a specific fXIIa inhibitor, attenuated the
prothrombotic properties of PCI catheter segments, consistent with the observation that
blood-contacting medical devices adsorb and activate fXII (Vogler and Siedlecki, 2009).
78
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
fXII is activated in the presence of dextran sulfate, polyphosphates, sulfatides,
prolylcarboxypeptidase, DNA, and RNA (Tankersley et al., 1983; Smith et al., 2006;
Tans and Griffin, 1982; Schmaier and McCrae, 2007; Kannemeier et al., 2007).
Numerous reports have demonstrated that fXII can also be activated by synthetic
materials such as polyurethanes, polytetrafluoroethylene, various polymers, and silicon
(van der Kamp et al., 1995; Bernacca et al., 1998; van der Kamp and van Oeveren, 1994;
Cenni et al., 1996; Zhuo et al., 2006; Arvidsson et al., 2007).
Catheters are often
composed of such materials, which would explain why we observed similar procoagulant
activity with coronary catheters and PU catheters obtained from different suppliers (not
shown). Taken together, these results suggest that the contact pathway plays an important
role in the initiation of catheter-induced clotting.
The correlation between our in vitro and in vivo findings and their concordance
with the clinical trial results suggest that our in vitro assay provides a useful method to
quantify the prothrombotic activity of catheters and to screen the capacity of various
anticoagulants to abrogate catheter-induced clotting. These data also suggest that the
inside and outside surfaces of catheters are equally prothrombotic and trigger clotting via
similar mechanisms.
Although thrombus on the inner surface of guide catheters is
evident when the catheters are withdrawn, thrombus may also form on the outer surface.
Likewise, the outside and inside surfaces of central venous catheters can trigger
thrombosis. Thrombus on the outside surface of venous devices can lead to upper
extremity deep vein thrombosis that can extend into the jugular vein and/or the superior
79
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
vena cava, whereas thrombus formation on the inside surface of such devices can result in
occlusion of the lumen and subsequent device failure (Beathard, 2001). Therefore, our in
vitro and in vivo models confirm the concept that catheters are prothrombotic and provide
useful tools to investigate this phenomenon.
In contrast to heparin, fondaparinux was unable to inhibit catheter-induced
clotting in vitro and in vivo, even at concentrations that far exceed those used clinically.
Like heparin, enoxaparin inhibited catheter-induced clotting in vitro in a concentrationdependent fashion, but its effect was intermediate between that of heparin and
fondaparinux both in vitro and in vivo. The disparate effects of heparin, enoxaparin, and
fondaparinux in the rabbit model are unlikely to be the result of differences in the anti-Xa
activities or half-lives of these agents because the peak anti-Xa levels with all three agents
were the same and fondaparinux and LMWH have longer half-lives than heparin
(Samama and Gerotziafas, 2003).
The inability of fondaparinux to prevent catheter
thrombosis is in agreement with the results of a previous study, which demonstrated
clotting in catheters perfused with blood from fondaparinux-treated volunteers, but not in
catheters perfused with blood from heparin-treated subjects (Schlitt et al., 2008). The
intermediate effect of enoxaparin in our studies is consistent with the results of the
OASIS 5 trial (Yusuf et al., 2006a), which demonstrated catheter thrombosis in
enoxaparin-treated patients, albeit at a lower rate than that observed in patients given
fondaparinux, suggesting that enoxaparin does not eliminate this complication.
Prevention of catheter thrombosis with enoxaparin requires an adequate dose of the drug.
80
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Because catheter thrombosis has been reported despite subcutaneous enoxaparin doses of
50 anti-Xa U/kg (Buller et al., 2006; Chen et al., 2009), most patients who are undergoing
PCI are given intravenous enoxaparin at doses ranging from 75 to 100 anti-Xa U/kg.
Building on our observation that fondaparinux has limited inhibitory activity
against proteases in the contact pathway, has no activity against thrombin, and is
ineffective at preventing catheter-induced clotting, we examined whether the addition of
agents that target the contact pathway and/or thrombin would render fondaparinux
effective against catheter-induced clotting.
Addition of a low dose of heparin to
fondaparinux inhibited the prothrombotic activity of catheters both in vitro and in vivo.
This reflects, at least in part, the capacity of heparin to inhibit thrombin because addition
of bivalirudin, a specific thrombin inhibitor, with fondaparinux also attenuated the
prothrombotic activity of catheters in plasma. In addition, however, heparin also inhibits
contact pathway coagulation enzymes upstream of fXa, thereby attenuating fXa
generation. Supporting the concept that attenuation of fXa generation through upstream
inhibition contributes to the capacity of low dose heparin to promote the activity of
fondaparinux is the observation that combining CTI with fondaparinux also inhibited
catheter-induced clotting in plasma. These findings raise the possibility that targeted
inhibition of fXIIa or thrombin with CTI or bivalirudin, respectively, or adjunctive
therapy with these agents or low dose heparin may prevent catheter thrombosis in
fondaparinux-treated patients.
81
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
In conclusion, we have shown in vitro and in vivo that catheters are prothrombotic
because they activate the contact pathway of coagulation, and fondaparinux is unable to
inhibit catheter-induced clotting because it does not inhibit upstream coagulation via the
contact pathway nor does it inhibit downstream clotting mediated by thrombin. These
findings suggest that (a) the potential for catheter thrombosis in fondaparinux-treated
patients who require PCI can be largely overcome by administration of supplemental
heparin; an approach that was used successfully in the FUTURA/OASIS 8 trial (Steg et
al., 2010), (b) fondaparinux may not be the best choice of anticoagulant for initial or
extended treatment of patients with catheter-associated deep vein thrombosis because it is
unable to inhibit catheter-induced clotting, and (c) since fXII activation is the root cause
of catheter thrombosis, modifications of the catheter surface that limit this phenomenon
may prevent catheter thrombosis, thereby obviating or attenuating the need for systemic
anticoagulants.
82
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Chapter 4: Selective depletion of factor XI or XII with antisense
oligonucleotides attenuates catheter thrombosis in rabbits
Forward
This study investigates the effect of selective depletion of fXII, fXI, and HK on
catheter-induced occlusion in rabbits. In addition, this study compares the importance of
the contact pathway and extrinsic pathway on catheter-induced occlusion. The study
demonstrates that selective depletion of fXII and fXI attenuates catheter-induced
occlusion whereas selective depletion of HK and fVII has no effect.
Copyright Information: This research was originally published in Blood. Jonathan W.
Yau, Peng Liao, James C. Fredenburgh, Alan R. Stafford, Alexey S. Revenko, Brett P.
Monia, and Jeffrey I. Weitz. Selective depletion of factor XI or XII with antisense
oligonucleotides attenuates catheter thrombosis in rabbits. Blood. 2014; 123(13): 21022107. © the American Society of Hematology.
83
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
4.1 Abstract
Central venous catheter thrombosis can cause venous obstruction and pulmonary
embolism. To determine the extent to which catheter thrombosis is triggered by the
contact or extrinsic pathway of coagulation, we used antisense oligonucleotides (ASOs)
to selectively knockdown factor (f) XII, fXI, or high-molecular-weight kininogen (HK),
key components of the contact pathway, or fVII, which is essential for the extrinsic
pathway. Knockdown of contact pathway components prolonged the activated partial
thromboplastin time and decreased target protein activity levels by over 90%, whereas
fVII knockdown prolonged the prothrombin time and reduced fVII activity to a similar
extent. Using a rabbit model of catheter thrombosis, catheters implanted in the jugular
vein were assessed daily until they occluded, up to a maximum of 35 days. Compared
with control, fXII and fXI ASO treatment prolonged the time to catheter occlusion by 2.2and 2.3-fold, respectively. In contrast, both HK and fVII knockdown did not significantly
prolong the time to occlusion, and dual treatment with fVII- and fXI-directed ASOs
produced a time to occlusion similar to that with the fXI ASO alone. These findings
suggest that catheter thrombosis is triggered via the contact pathway and identify fXII and
fXI as potential targets to attenuate this complication.
84
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
4.2 Introduction
Central venous catheters (CVCs) are frequently used in patients with cancer,
including those with haematological malignancies. Patients with cancer are at risk for
thrombosis, and indwelling CVCs increase this risk (Lee and Peterson, 2013; Falanga et
al., 2013; Tagalakis et al., 2013). Thrombosis associated with CVCs can cause upper
extremity deep-vein thrombosis, which can lead to pulmonary embolism. With more
extensive thrombosis, superior vena cava syndrome can occur (Lee and Kamphuisen,
2012). Symptomatic thrombosis occurs in at least 5% of cancer patients with CVCs, and
is a serious problem because it often delays cancer treatment, prolongs hospital stay, and
increases health care costs by necessitating anticoagulant therapy in patients at risk for
bleeding (Lee and Kamphuisen, 2012).
The pathogenesis of thrombosis in patients with CVCs is unclear. Low doses of
warfarin and prophylactic low-molecular-weight heparin do not reduce the risk of CVCassociated thrombosis (Schiffer et al., 2013). The failure of these agents to prevent this
problem highlights the need for a better understanding of the mechanism of catheter
thrombosis so that more targeted preventive therapy can be developed.
According to the classic waterfall model of blood coagulation, coagulation can be
triggered by the tissue factor-factor (f) VIIa complex, which initiates the extrinsic
pathway, or by fXIIa, which initiates the contact pathway. Although evidence in humans
and studies in mice have confirmed the role of the tissue factor pathway in hemostasis
and thrombosis (Mackman et al., 2007), the contact system plays no part in hemostasis
85
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
and its role in thrombosis is uncertain (Gailani and Renne, 2007). fXII is activated in the
presence of high-molecular-weight-kininogen (HK) and goes on to activate fXI and
prekallikrein.
Historically, artificial surfaces and, more recently, native polyanionic
compounds such as nucleic acids and inorganic polyphosphates have been identified as
potential cofactors in fXII activation (Vogler and Siedlecki, 2009; Kannemeier et al.,
2007; Smith et al., 2006). Recently, we showed that (a) catheters have prothrombotic
activity in plasma and initiate clotting by activating fXII and (b) corn trypsin inhibitor, a
potent inhibitor of fXIIa, attenuates catheter-induced clotting (Yau et al., 2011; Yau et al.,
2012). If the same is true in vivo, we hypothesized that the use of liver-directed antisense
oligonucleotides (ASOs) to selectively knockdown contact pathway factors, fXII, fXI,
and HK, in rabbits would attenuate catheter thrombosis, whereas fVII knockdown would
have little or no effect. To further explore the involvement of the extrinsic pathway in
catheter-induced clotting, we also examined the effect of combined knockdown of fVII
plus fXI.
4.3 Methods
4.3.1 Materials
Solo-Cath polyurethane single-lumen catheters (PU-C70, 7F x 15 cm) with slightly
rounded distal tips, integrated Luer locks, and suture flanges were purchased from
Solomon Scientific (Plymouth Meeting, PA). Goat IgG directed against human fXII and
fXI, peroxidase-conjugated sheep IgG directed against human HK, and fVII-, fXI-, fXII-,
86
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
and HK-deficient human plasma were purchased from Affinity Biologicals, Inc.
(Ancaster, ON).
Goat antibodies directed against fXII and fXI were conjugated to
horseradish peroxidase using Lightning Link (Innova Biosciences Ltd., Cambridge, UK).
To prepare a pool of normal rabbit plasma, blood collected from at least 5 healthy rabbits
into 3.8% sodium citrate was subjected to centrifugation and the resultant platelet poor
plasma was harvested, pooled, and frozen in aliquots at -70°C as described.(Yau et al.,
2011)
4.3.2 Preparation and synthesis of ASOs
All oligonucleotides for fVII, fXI, fXII, and HK mRNA knockdown were 20
nucleotides in length and were chemically modified with phosphorothioate in the
backbone and 2-O-methoxyethyl (MOE) on the wings with a central deoxy gap (socalled 5-10-5 design). Oligonucleotides were synthesized and purified as previously
described.(Baker et al., 1997) ASOs were reconstituted in PBS to 15 mg/ml, based on
spectrophotometric analyses, filtered through a 0.22 µm filter and stored at 4°C until
used.
Their activity was first assessed in cultured rabbit hepatocytes using
electroporation mediated transfection.
Briefly, hepatocytes isolated from male New
Zealand white rabbits were washed and re-suspended at 35,000 cells/ml in DMEM high
glucose medium supplemented with 10% fetal bovine serum. To the wells of a 2 mm
electroporation plate (Harvard Apparatus) containing 11 µl of 10X molar stock of
oligonucleotide in water were added 100 µl of cell suspension. After shaking for 30 s,
87
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
cells were pulsed at 130 V for 6 mS using an ECM 830 Square Wave Electroporation
instrument (Harvard Apparatus). Cells were then transferred to wells of a 96-well culture
plate containing 50 µl of growth medium and incubated with 5% CO2 for 16 h at 37ºC.
After washing once with 20 mM sodium phosphate, pH 7.4, 150 mM NaCl, cells were
subjected to lysis and RNA was isolated using the RNeasy96 kit (Qiagen Inc.). Target
mRNA was quantified by RT-PCR using a StepOnePlus instrument (Life Technologies
Inc.) and normalized using a rabbit 18S ribosomal RNA primer probe set.(Hashimoto et
al., 2004) The primer probe sets used for mRNA determination are listed in Table 4.1. A
dose-response was performed with the ASOs that produced the greatest reduction in
mRNA levels and the most potent agents were selected for tolerability and efficacy
screening in rabbits.
88
Ph.D. Thesis – J. Yau
Molecular target
Factor VII
Factor XI
Factor XII
HK
18S ribosomal RNA
McMaster University – Biomedical Engineering
Oligonucleotide
Forward primer
Sequence
CACGCTGCTGCCCAATG
Reverse primer
CTTTTCCAGAGCAGGTACTTTGC
Probe
TCCTGCACACCCACAGTTGATTACCCA
Forward primer
ATGGATAATGTGTGCACAACCAA
Reverse primer
TGACACAGTGTGCAGGGTTACC
Probe
AGGATCTGCCTCTCTTCCCGGCG
Forward primer
GCCAGAGAGAGAAATGCTTTGAG
Reverse primer
CTGCCCGCTCGAATCG
Probe
CCGCTTCTTCCACGAGAATGACATGTG
Forward primer
TTCTCCGACTTGGAGGACTTTG
Reverse primer
CGCACATCAGGGATCCAATC
Probe
TGCCTAATACAGCACCAGCTCCCACAG
Forward primer
TGCGGCGGCGTTATTC
Reverse primer
TTTAAGTTTCAGCTTTGCAACCAT
Probe
Table 4.1: Primer probe sets
ACCCGCCGGGCAGCTTCC
89
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
4.3.3 Tolerability/efficacy screening of ASOs in rabbits
Tolerability and efficacy screening was performed in 3 – 4 month old male New
Zealand White rabbits. Animals were randomized into 17 groups (Table 4.2) and ASOs
were formulated in 0.9% saline and administered subcutaneously at a dose of 15 mg/kg
twice weekly for 3 weeks; the control group (C) received equivalent volumes of
subcutaneous saline. Rabbits were monitored on a regular basis and their weight and
general health was assessed. Blood was collected from the marginal ear vein on days 15
and 22 and serum was analyzed for alanine aminotransferase, aspartate aminotransferase,
total bilirubin, albumin, and blood urea nitrogen using an A480 Chemistry Analyzer
(Beckman Coulter). Animals were euthanized by sodium pentobarbital injection 48 h
after the last subcutaneous injection and necropsied. A section of liver was collected and
snap-frozen in liquid nitrogen.
After homogenization, mRNA was extracted using
PureLink Pro 96 Total RNA Purification Kit (Life Technologies Inc.). fVII, fXI, fXII,
and HK mRNA levels were quantified using an OneStepPlus Real-Time PCR System
(Applied Biosystems) and normalized using a rabbit 18S ribosomal RNA primer probe
set. ASOs that produced the greatest reductions in fVII, fXI, fXII, and HK mRNA levels
(ISIS 608032, 564673, 564859, and 567518, respectively) were selected for further study.
A scrambled ASO (ISIS 141923) was used as the control.(Tang et al., 2012)
90
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
91
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Molecular target
Number of animals
ISIS #
Sequence
C
3
-
-
fVII
3
607951
CCGCCAGACCCCTCACCCCT
fVII
3
607958
CCCTTCCGAAATCTGTCTCT
fVII
3
608032
CTGCAAGTGTCTCTCCCCTT
fVII
3
608038
TGTCTCAACTTCCTGTCCCC
fXI
3
564560
ACACCTTTGTGCTTATTTGC
fXI
3
564595
GGCACTGGTACACATTTTCT
fXI
3
564673
GTAACATGTGCCCTTTCCTT
fXI
3
564686
AATTCCACCATAGACACGCA
fXII
3
564739
CGGCAATGGCACAGGTGGTG
fXII
3
564785
GCCATTGTCCTCGCCGACCA
fXII
3
564848
AGCGCACAGCATTCCAGGGA
fXII
3
564859
GGAATGGCCATTGTCCTCGC
HK
3
567445
AGCAGACTGCAGTAGGCCAA
HK
3
567446
CGTGTTTGTTATCAGAGAAG
HK
3
567518
GCTATTCTGAGACATCATGG
HK
3
567519
GTCCATGGAGATTGACAGCG
Table
4.2:
Tolerability/efficacy
screening
92
groups
in
rabbits
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
4.3.4 Dosing of ASOs in rabbits
Male New Zealand white rabbits (2.5 – 3.0 kg) purchased from Charles River Canada
(Sherbrooke, QC) were housed in individual cages in rooms maintained on a constant 12
h light-dark cycle with controlled temperature and humidity, and were given free access
to food and water. Studies were approved by the Animal Research Ethics Board at
McMaster University and procedures complied with Canadian Council on Animal Care
guidelines.
After identifying the ASO sequences that produced the greatest reductions in
factor levels in a preliminary study (described in Supplement), five groups of rabbits (n =
7 – 12 per group) were randomized to receive subcutaneous injections of control, fVII-,
fXI-, fXII-, or HK-directed ASOs at a dose of 15 mg/kg twice weekly (Table 4.3). For
combined treatment, rabbits received 15 mg/kg twice weekly subcutaneous injections of
both fVII- and fXI-directed ASO.
oligonucleotide.(Tang et al., 2012)
The control ASO consisted of a scrambled
All treatments were given for 4 weeks prior to
catheter implantation and continued for 5 weeks thereafter. During treatment, rabbits
were monitored daily for signs of toxicity and body weight was recorded weekly. At the
end of the treatment period, we examined the effect of the ASOs on clotting factor hepatic
mRNA expression, protein levels as determined by immunoassay and by clotting activity
using appropriate factor-deficient human plasma, respectively, and global tests of
coagulation.
Investigators performing the rabbit studies and conducting the sample
analyses were blinded as to treatment allocation.
93
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
ISIS #
Target
Sequence
141923
Control
CCTTCCCTGAAGGTTCCTCC
608032
Factor VII
CTGCAAGTGTCTCTCCCCTT
564673
Factor XI
GTAACATGTGCCCTTTCCTT
564859
Factor XII
GGAATGGCCATTGTCCTCGC
567518
HK
GCTATTCTGAGACATCATGG
Table 4.3: Antisense oligonucleotides directed against rabbit coagulation factors.
94
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
4.3.5 Preparation of platelet-poor rabbit plasma
Blood samples were collected under anesthesia every week until study termination.
Blood (4 ml) was withdrawn from a central ear artery catheter using a 5 ml syringe
containing 0.5 ml of 3.8% sodium citrate. Samples were immediately mixed and stored at
4°C prior to centrifugation for 15 min at 2000g at 23°C. Plasma was subjected to a
second centrifugation step under the same conditions, pooled, and frozen in aliquots at 70°C.
4.3.6 Hepatic fVII, fXI, fXII, and HK mRNA expression
To assess mRNA expression, a 0.5 cm3 section of liver collected from each rabbit at postmortem examination was submerged in RNALater solution (Life Technologies Inc.,
Burlington, ON), stored overnight at 4°C, and then frozen at -70°C.
After
homogenization of thawed samples, mRNA was isolated using the PureLink Pro 96 Total
RNA Purification Kit (Life Technologies Inc.) and fVII, fXI, fXII, and HK mRNA levels
were quantified using OneStepPlus Real-Time PCR (Applied Biosystems, Foster City,
CA) and normalized against a rabbit 18S ribosomal RNA primer probe set.(Hashimoto et
al., 2004)
4.3.7 Immunoblot analysis
Plasma was subjected to electrophoresis on SDS 4-15% polyacrylamide gradient gels
(Bio-Rad Laboratories, Hercules, CA) under non-reducing conditions and separated
95
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
proteins were then transferred to Immuno-Blot PVDF membranes (Bio-Rad) as
described.(Wiebe et al., 2003) Clotting factors were detected by immunoblot analysis
using horseradish peroxidase-conjugated IgG directed against human fVII, fXI, fXII, or
HK. Blots were incubated with Immuno-Star Western reagent (Bio-Rad), imaged on a
ChemiDoc XRS+ System using Image Lab v3.0 software (Bio-Rad) and protein levels
were then quantified by densitometry.
4.3.8 Global tests of coagulation
Activated partial thromboplastin time (aPTT) and dilute prothrombin time (PT)
measurements were performed using a SpectroMax 340PC384 plate reader (Molecular
Devices, Sunnyvale, CA). For aPTT determination, 50 µl of platelet-poor rabbit plasma
was incubated with 50 µl of aPTT reagent (APTT-SP HemosIL, Instrumentation
Laboratory Co., Bedford, MA) for 5 min at 37°C, followed by recalcification with 50 µl
of 25 mM CaCl2.
For PT determination, 50 µl of platelet-poor rabbit plasma was
incubated for 2 min at 37°C prior to addition of 100 µl of a 1/100 dilution of
RecombiPlastin, a recombinant tissue factor (Instrumentation Laboratory Co., Bedford,
MA), containing 25 mM CaCl2. Clotting was monitored by measuring absorbance at 405
nm with a SpectroMax 340PC384 plate reader and clotting times were recorded as the time
to half maximum absorbance by instrument software (SoftMax Pro v5.4).
96
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
4.3.9 Clotting factor protein activity
Functional plasma levels of fVII, fXI, fXII, and HK were quantified by clotting assay
using the appropriate factor-deficient human plasma. Briefly, platelet-poor rabbit plasma
was diluted 1:20 in 20 mM HEPES, pH 7.4, 150 mM NaCl buffer containing 0.1% (w/v)
bovine serum albumin. In a 96-well plate, 30 µl of diluted plasma was incubated with 30
µl APTT-SP and 30 µl of citrated human plasma deficient in fXI, fXII or HK for 5 min at
37°C. A similar system was used to quantify levels of fVII except RecombiPlastin was
used in place of aPTT reagent. In all cases, clotting was initiated by addition of 30 µl of a
25 mM CaCl2 solution, and clot formation was assessed by monitoring absorbance at 340
nm in kinetic mode using a SpectroMax 340PC384 plate reader. Clotting times were taken
as the time to achieve half maximal increase in absorbance as determined by the
instrument software. Activity levels of fVII, fXI, fXII, or HK were interpolated from
standard curves prepared using serial dilutions of citrated normal rabbit reference plasma
and expressed as a percentage of normal.
4.3.10 Rabbit model of catheter thrombosis
The rabbit model of catheter thrombosis was a modification of that described by
Klement et al.(Klement et al., 2006) Rabbits that had received control, fVII, fXI, fXII, or
HK ASOs for 4 weeks as described above were sedated using a ketamine/xylazine
mixture. The hair over the right craniolateral neck and right ear was clipped and the skin
was prepared for sterile surgery.
Rabbits were then given inhalational anesthesia
97
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
consisting of oxygen and 3 – 5% isoflurane via a mask. Catheters were flushed inside
and outside with 10 ml of sterile normal saline followed by a final flush with 1 ml of
saline to remove any air bubbles. Under sterile conditions, a 2 cm skin incision was made
to isolate the right external jugular vein. A subcutaneous tunnel was then created from
the incision site to the posterior base of the auricular cartilage.
After incising the
auricular cartilage and overlying skin to facilitate retrograde passage, the proximal
portion of the catheter was secured to the skin of the external auditory meatus using a
single 4-0 prolene cruciate ligature. The jugular vein was ligated proximally and, under
distal occlusion, the catheter was introduced into the vein and advanced into the superior
vena cava. After inserting 7 cm of catheter, the catheter was anchored at the insertion site
with two 4-0 vicryl sutures. Skin incisions were closed with stainless steel wound clips.
Any blood loss was replaced with an equivalent volume of intravenous saline and
buprenorphine and enrofloxacin (0.02 and 10 mg/kg, respectively) were administered
intramuscularly for pain and infection control, respectively.
After recovery, rabbits were returned to their cages and monitored daily. Catheter
patency was examined daily by withdrawing 0.5 ml of blood and then flushing the
catheter with 2 ml of saline. A pressure transducer (Baxter Healthcare Corp.), placed
between the catheter and the syringe, was used to quantify pressure within the catheter.
Catheter occlusion was taken as the time when blood could no longer be withdrawn,
saline could no longer be flushed, and the pressure within the catheter was > 100 mm Hg
98
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
during the saline flush. At this point, or at 35 days if occlusion did not occur, the study
was terminated, as described.(Klement et al., 2006; Yau et al., 2011)
4.3.11 Statistical analyses
Results are presented as means ± standard deviation (SD). Unless otherwise stated,
experiments were performed at least three times. Means of paired data were compared by
analysis of variance followed by post-hoc analysis using Tukey’s test. For all analyses, pvalues less than 0.05 were considered statistically significant.
4.4 Results
4.4.1 Effect of ASO-mediated knockdown on mRNA expression and clotting factor levels
After 4 weeks of treatment, the fVII, fXI, fXII, and HK directed ASOs significantly (p <
0.001) reduced respective mRNA expression by 92%, 84%, 97%, and 57% (Figure 4.1A).
Coincident with reduced mRNA expression, plasma levels of fXI, fXII, and HK as
detected by immunoblot analysis, also were significantly (p < 0.001) reduced by 96%,
97%, and 87%, respectively (Figure 4.1B). The HK-directed ASO not only decreased
plasma HK, but also significantly (p < 0.05) decreased the plasma level of fXI by 76%.
Plasma fVII protein levels could not be determined immunologically because there are no
commercially available antibodies directed against rabbit fVII, and human and mouse
fVII-directed antibodies exhibit poor cross-reactivity (data not shown). In functional
assays, the respective ASOs significantly (p < 0.001) reduced fVII, fXI, fXII, and HK
99
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
activity by 92%, 99%, 99%, and 91%, respectively (Figure 4.1C). In addition to lowering
HK activity, the HK directed ASO also significantly (p < 0.001) decreased fXI activity by
72%. Thus, the ASOs decrease target mRNA and protein levels, as well as plasma
clotting activity.
100
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 1
A
B
101
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
C
Figure 4.1: Effect of fVII, fXI, fXII, and HK ASOs on hepatic mRNA expression,
protein levels, and activity.
Male New Zealand white rabbits were treated
subcutaneously with control, fVII, fXI, fXII, and HK ASO for 4 weeks at 15 mg/kg twice
weekly dose (n = 8 per treatment group). Two days after final dosing, blood was
collected for quantification of (A) hepatic fVII, fXI, fXII, and HK mRNA expression, (B)
fXI, fXII, and HK protein levels by immunoblot analysis, and (C) procoagulant activity in
fVII- (black bars), fXI- (grey bars), fXII- (white bars), and HK- (hatched bars) deficient
human plasma. The bars for mRNA and activity levels represent the mean of 3 separate
experiments for each rabbit, while the lines above the bars reflect the SD. * p < 0.05
compared with control ASO.
102
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
4.4.2 Effect of ASOs on global tests of coagulation
We next examined the effect of factor depletion on the aPTT and dilute PT at 4 weeks.
Compared with a mean aPTT of 258 ± 115 s with control ASO, the mean aPTT values in
rabbits treated with fXI, fXII, and HK-directed ASOs were significantly prolonged by
3.1- (p = 0.009), 4.7- (p < 0.001), and 3.6-fold (p < 0.001), whereas the fVII-directed
ASO had no effect (Figure 4.2). The mean PT in rabbits given control ASO was 130 ± 10
s. As expected, mean PT values in rabbits treated with fXI, fXII, and HK directed ASOs
were similar to that in controls. In contrast, the mean PT in rabbits given fVII-directed
ASO was prolonged 2-fold (p < 0.001). Taken together, these results indicate that contact
factor-directed ASOs prolong the aPTT, whereas the fVII-directed ASO prolongs the PT.
103
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 4.2: Effect of treatment with control, fVII, fXI, fXII, or HK ASOs on the
dilute aPTT and PT. Rabbits were treated subcutaneously with control, fVII, fXI, fXII,
or HK ASOs ASO for 4 weeks at 15 mg/kg twice weekly (n = 8 per treatment group).
Two days after the last ASO dose, blood was collected for determination of the dilute
aPTT (black bars) or PT (white bars). Values were normalized relative to those obtained
in rabbits given the control ASO.
The bars represent the mean of 3 separate
determinations for each rabbit, while the lines above the bars reflect the SD. * p < 0.05
compared with control ASO.
104
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
4.4.3 Effects of fXI, fXII, and HK ASO treatment on catheter patency in rabbits
Having demonstrated that a 4 week period of ASO treatment reduced target factor
activity, we explored the relative importance of fVII, fXI, fXII, and HK on catheter
patency over a subsequent 35-day period. Treatment with twice-weekly injections of
ASOs or control was continued during this period. With control ASO, the time to
catheter occlusion was 9.7 ± 5.6 days (Figure 4.3); a value similar to the median number
of days between catheter insertion and catheter thrombosis in cancer patients.(Saber et al.,
2011) Treatment with fXI or fXII ASO significantly prolonged the mean time to catheter
occlusion by 2.3- and 2.2-fold, respectively (p < 0.001). In contrast, treatment with HK
ASO only prolonged the mean time to catheter occlusion 1.4-fold (p = 0.97), even though
this regimen also decreased fXI activity by 72% (Figure 4.1). Likewise, treatment with
fVII ASO produced a non-significant 1.2-fold prolongation in the mean time to catheter
occlusion. Thus, we demonstrated that treatment with fXI and fXII ASO, but not HK or
fVII ASO, attenuates the prothrombotic activity of catheters in rabbits.
To further investigate the role of fVII in catheter thrombosis, we co-administered
fVII- and fXI-directed ASOs. The combination produced a 2.4-fold prolongation of the
aPTT (p < 0.001) and 1.5-fold prolongation of the PT (p = 0.003) compared with control
ASO (data not shown). The mean time to catheter occlusion was prolonged by 2.8-fold
(p < 0.001); a value significantly longer than that with the fVII ASO alone (p < 0.001),
but not significantly different from that with the fXI ASO alone (p = 0.55) (Figure 4.4).
105
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Thus, even in the absence of a functional contact system, the extrinsic pathway does not
appear to play a part in catheter-induced clotting in this model.
106
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 4.3: Effect of fVII, HK, fXII, and fXI ASO treatment on the time to catheter
occlusion. Rabbits (n = 7 - 12 per group) were given a 4-week course of control ASO or
fVII, HK, fXII, or fXI ASO prior to insertion of a catheter into their jugular veins and
continued during this period. Every day for 35 days, 0.5 ml of blood was withdrawn from
the catheter into a syringe and slowly re-injected. The catheter was then flushed 2 ml of
saline. Catheter occlusion occurred when blood could no longer be withdrawn, saline
could no longer be injected, and the pressure measured with a transducer exceeded 100
107
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
mm Hg. The bars represent the mean of at least 7 separate experiments, while the lines
above the bars reflect the SD. * denote p < 0.001 compared with the control.
108
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 4.4: Effect of fVII and/or fXI ASO treatment on the time to catheter
occlusion. Rabbits (n = 8 - 12 per group) were given a 4-week course of control ASO,
fVII or fXI ASO, or fVII plus fXI ASO combination subcutaneously prior to insertion of
a catheter into their jugular veins and continued during this period. Catheter occlusion
was assessed as described.
The bars represent the mean of at least 8 separate
experiments, while the lines above the bars reflect the SD. * denote p < 0.001 compared
with the control.
109
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
4.5 Discussion
The purpose of this study was to delineate the relative contributions of the contact
and extrinsic pathway to catheter thrombosis by targeted clotting factor knockdown using
ASO technology. After confirming that ASOs directed against fVII, fXI, fXII, and HK
reduced respective rabbit liver mRNA, plasma protein, and coagulant activity levels, we
showed that selective knockdown of fXI, fXII, or HK prolonged the aPTT, whereas
selective knockdown of fVII prolonged the PT. Neither treatment regimen affected the
function of the other pathway. In the rabbit model of catheter thrombosis, the time to
catheter occlusion was prolonged with knockdown of fXI and fXII, but not with
knockdown of fVII or HK. These findings (a) suggest that catheter thrombosis is
triggered via the contact pathway and that the extrinsic pathway plays little or no role in
this process, and (b) identify fXI and fXII as potential targets to attenuate catheter
thrombosis.
Recent studies using ASO technology have identified roles for fXI, fXII, and
prekallikrein in arterial and venous thrombosis in mice and non-human primates.(Zhang
et al., 2010; Revenko et al., 2011; Younis et al., 2012; Crosby et al., 2013) Since ASOs
are species specific, we developed ASOs that target rabbit coagulation factors.
Consistent with previous investigations in other species, fXI- and fXII-directed ASO
treatment reduced mRNA, protein expression and procoagulant activity in a targeted
fashion. Importantly, fXI- and fXII-directed ASO treatment bestowed an antithrombotic
phenotype in rabbits, as shown by the prolongation of the time to occlusion. Therefore,
110
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
fXII, fXI, HK and fVII directed ASOs can be added to the list of effective ASOs for study
in rabbits and these can be used to examine the effect of contact factor and fVII
knockdown in models of thrombosis.
Treatment with HK-directed ASO not only reduced the level of HK, but was
associated with a concomitant reduction in the level of fXI despite normal hepatic fXI
mRNA expression. This finding raises the possibility that HK modulates fXI clearance;
an observation that deserves further exploration. Unlike fXI or fXII knockdown, HK
knockdown did not prolong the time to catheter occlusion. There are several potential
explanations. First, although plasma levels of HK were reduced by 87%, the residual HK
may have been sufficient to amplify contact activation because over 90% HK depletion is
required to prolong clotting times in plasma.(Munakata et al., 1990) Second, although
HK accelerates fXI activation by fXIIa, the reaction can occur in the absence of HK,
albeit at a slower rate.(Griffin and Cochrane, 1976) Third, polyanions, such as inorganic
polyphosphates,(Geng et al., 2013) may substitute for HK. Lastly, the extent of fXI
depletion may have been inadequate. Although HK ASO produced a 72% reduction,
there may have been sufficient fXI to induce clotting. Any or all of these phenomena
may explain why fXI and fXII knockdown attenuated catheter-induced clotting in rabbits
more than HK knockdown.
There is abundant evidence that fXII is activated by negatively-charged surfaces
such as glass, kaolin, dextran sulfate, sulfatides, and polymers.(Tans and Griffin, 1982;
Tankersley et al., 1983; van der Kamp et al., 1995; Zhuo et al., 2006; Zhuo et al., 2007)
111
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
However, the role of the contact pathway in thrombosis induced by catheters or other
blood-contacting devices has been a matter of debate.(Gorbet and Sefton, 2004; Chan et
al., 2009)
Likewise, although the extrinsic pathway is essential for hemostasis, its
contribution to catheter thrombosis also is uncertain.(Gorbet and Sefton, 2004; Chan et
al., 2009) In this study, we show that knockdown of fXI or fXII prolongs the time to
catheter occlusion, whereas fVII knockdown does not, nor does concomitant knockdown
of fVII and fXI extend the time to catheter occlusion beyond that produced by fXI
knockdown alone. These findings suggest that catheter thrombosis is mainly driven by
the contact pathway and that the extrinsic pathway does not play a major role in this
process.
Although the small amount of circulating fVII that remains after fVII
knockdown in rabbits may be sufficient to trigger the extrinsic pathway, this is unlikely to
explain why fVII knockdown had little effect on the time to catheter occlusion for at least
two reasons. First, consistent with the findings in rabbits, we showed that catheterinduced clotting in vitro is attenuated in plasma deficient in fXI or fXII, but not in
plasma deficient in fVII.(Yau et al., 2011) Second, there was more catheter thrombosis
with nematode anticoagulant protein (NAP) c2, a potent inhibitor of fVIIa, than with
heparin when the agents were compared in a phase II study in patients with acute
coronary syndrome (Giugliano et al., 2007); a finding that suggests that extrinsic pathway
inhibition fails to prevent catheter thrombosis. Therefore, catheter thrombosis appears to
be triggered by the contact pathway.
112
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Selective knockdown of fXI and fXII in rabbits conferred protection against
catheter-induced occlusion; findings in keeping with our earlier observation that catheterinduced clotting is attenuated to a similar extent in fXI- and fXII-deficient human
plasma.(Yau et al., 2011)
Ferric chloride-induced thrombosis is attenuated in mice
deficient in fXI or fXII and when fXI or fXII is knocked down with ASOs,(Revenko et
al., 2011; Kleinschnitz et al., 2006; Renne et al., 2005) supporting the role of fXI and fXII
in thrombosis. Together, these results confirm the role of fXI and fXII in thrombosis, and
validate fXI and fXII as novel targets for antithrombotic therapy.
Targeting the contact pathway offers potential benefits over conventional
anticoagulant therapies. Although the delayed knockdown with ASOs limits their utility
in the acute setting, inhibitory antibodies against fXIa(Tucker et al., 2009) and fXII
(Matafonov et al., 2014), small molecule inhibitors of fXIa,(Lin et al., 2006) inhibitory
nanobodies against fXIIa,(de Maat et al., 2013) and RNA aptamers targeting
fXII(Woodruff et al., 2013) offer promise for the future.
Alternatively, surface
modifications using CTI, a fXIIa inhibitor, provides a method for rendering catheters and
other blood-contacting devices less thrombogenic (Alibeik et al., 2011; Alibeik et al.,
2012a; Alibeik et al., 2012b; Yau et al., 2012). The utility of these agents for prevention
and treatment of catheter thrombosis requires further investigation.
In conclusion, using targeted ASO knockdown in rabbits, we provide evidence
that catheter thrombosis is triggered via the contact pathway. Furthermore, our studies
identify fXI and fXII as potential targets to attenuate catheter thrombosis.
113
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Chapter 5: Only High Levels of Dabigatran Attenuate Catheter
Thrombosis in vitro and in Rabbits
Forward
This study demonstrates the efficacy of dabigatran and heparin on catheterinduced clotting.
Dabigatran was shown to attenuate catheter-induced clotting at
concentrations above 100 ng/ml. It demonstrates that low-dose dabigatran supplemented
with low-heparin can effectively inhibit clotting in a more than additive effect.
Copyright Information: This research was originally published in Thrombosis and
Haemostasis. Jonathan W. Yau, Peng Liao, James C. Fredenburgh, Robin S. Roberts, and
Jeffrey I. Weitz. Only high levels of dabigatran attenuate catheter thrombosis in vitro and
in rabbits. Thrombosis and Haemostasis. 2014; 112(1): 79-86. Reprinted with permission
from Schattauer GmbH. © 2014 Schattauer GmbH. Published by Schattauer GmbH.
114
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
5.1 Abstract
In patients with mechanical heart valves, thromboembolic events were more
frequent with dabigatran, an oral thrombin inhibitor, than with warfarin. This observation
raises the possibility that dabigatran may be less effective than conventional
anticoagulants in patients with other blood-contacting devices, such as catheters. To
address this, we compared the capacity of dabigatran and/or heparin to inhibit catheterinduced thrombin generation in vitro and to attenuate catheter occlusion in rabbits. Using
a catheter-induced thrombin generation assay, concentrations of dabigatran over 100
ng/ml prolonged the lag time and time to peak thrombin, and reduced the peak thrombin
concentration and endogenous thrombin potential in a concentration-dependent fashion.
Compared with saline in a rabbit model of catheter thrombosis, dabigatran prolonged the
mean time to catheter occlusion by 2.9- and 1.9-fold when plasma levels were 173 and
140 ng/ml, respectively; values comparable to median peak levels in humans given
dabigatran 150 mg twice-daily. In contrast, low-dose dabigatran, which produced a level
of 60 ng/ml; a value comparable to the trough level of dabigatran in humans, did not
prolong the time to occlusion. Whereas a 70 U/kg bolus of heparin prolonged the mean
time to occlusion by 3.4-fold, a 15 U/kg bolus had no effect. When low-dose dabigatran
was given in combination with 15 U/kg heparin, the mean time to occlusion was
prolonged by 2.7-fold. These findings suggest that only peak levels of dabigatran are
sufficient to prevent catheter-induced clotting unless supplemented heparin is given.
115
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
5.2 Introduction
Conventional anticoagulants, such as heparin and warfarin, attenuate coagulation
at multiple levels. Heparin binds to antithrombin and accelerates the rate at which it
inhibits thrombin, factor Xa, and upstream coagulation enzymes in both the extrinsic and
intrinsic pathways.
Likewise, by interfering with the vitamin K cycle in the liver,
warfarin reduces the synthesis of functional clotting factors involved in the extrinsic,
intrinsic, and common pathways of coagulation. In contrast, newer anticoagulants target
only a single clotting enzyme. For example, fondaparinux only inhibits factor Xa, and the
new oral anticoagulants inhibit thrombin or factor Xa.
Although fondaparinux and the new oral anticoagulants have advantages over
heparin and warfarin, respectively, they appear to be less effective at preventing clotting
induced by blood-contacting medical devices. Thus, when fondaparinux was compared
with low-molecular-weight heparin or heparin in patients with acute coronary syndrome,
catheter thrombosis was more frequent with fondaparinux in those who underwent
percutaneous coronary intervention (PCI) (Yusuf et al., 2006b; Yusuf et al., 2006a).
Likewise, when dabigatran, an oral thrombin inhibitor, was compared with warfarin in
patients with mechanical heart valves, the study was stopped early because of a trend for
more ischemic strokes and more bleeding in those randomized to dabigatran (Eikelboom
et al., 2013). Dabigatran failed in this study even though dose escalation from 150 mg
twice daily to 300 mg twice-daily was permitted in an attempt to maintain trough drug
116
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
levels above 50 ng/ml. Despite several theories (Hylek, 2013), the explanation for the
higher number of strokes in the dabigatran group remains elusive.
We hypothesized that the inability of fondaparinux to prevent catheter thrombosis
and dabigatran to prevent thrombosis on mechanical heart valves reflects the fact that
blood-contacting medical devices activate factor XII and trigger the local generation of
factor Xa and thrombin in concentrations that exceed the capacity of fondaparinux or
dabigatran to inhibit them. In support of these concepts, we showed that (a) catheters
trigger coagulation by activating factor XII, and (b) fondaparinux is less effective than
heparin at preventing catheter-induced clotting in vitro and catheter occlusion in rabbits
(Yau et al., 2011). Moreover, we also showed that when used together, the two agents
have synergistic effects (Yau et al., 2011); a phenomenon that supports the use of
adjunctive heparin in fondaparinux-treated patients requiring PCI (Yusuf et al., 2006b;
Steg et al., 2010). Based on these observations, we hypothesized that, like fondaparinux;
dabigatran would be less effective than heparin for prevention of catheter thrombosis. In
addition, we reasoned that adjunctive heparin would enhance the antithrombotic activity
of dabigatran in this setting. To test these hypotheses, we compared the capacity of
dabigatran and/or heparin to inhibit catheter-induced thrombin generation in vitro and to
prevent catheter occlusion in a rabbit model of catheter thrombosis.
117
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
5.3 Materials and Methods
5.3.1 Materials
Polyurethane single-lumen catheters with slightly rounded distal tips (Solo-Cath
PU-C70, 7 Fr x 15 cm) were purchased from Solomon Scientific (Plymouth Meeting,
PA). Unfractionated heparin was from Pharmaceutical Partners of Canada (Richmond
Hill, ON). Dabigatran was a generous gift from Dr. J. van Ryn (Boehringer Ingelheim,
Biberach, Germany).
Stock dabigatran and subsequent dabigatran dilutions were
prepared in 100% dimethyl sulfoxide (DMSO) and diluted with 20 mM Tris-HCl, 150
mM NaCl, pH 7.4 (TBS) to a final DMSO concentration of 2%; a concentration that had
no effect on thrombin generation in control experiments (data not shown). Human
thrombin was purchased from Enzyme Research Laboratories, Inc. (South Bend, IN). ZGly-Gly-Arg-AMC, a thrombin-directed fluorogenic substrate, was from Bachem
(Bubendorf, Switzerland). Human antithrombin was obtained from Affinity Biologicals,
Inc. (Ancaster, ON). Human platelet-poor-plasma from at least 10 donors was prepared
as previously described (Kretz et al., 2010), and stored in aliquots at -70°C.
5.3.2 Catheter-induced thrombin generation assay
Catheter-induced thrombin generation was quantified using a fluorescence-based
assay with some modifications (Technothrombin TGA; Technoclone, Vienna, Austria).
Catheters were cut into 0.5 cm segments, a length chosen to fit into the wells of black
polystyrene 96-well microtiter plates (Costar, Corning, NY), and opened longitudinally to
118
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
expose the inner surface. To the wells were added 80 µl of human platelet-poor-plasma
and dabigatran and/or heparin in concentrations ranging from 50 to 400 ng/ml and 0.01
and 0.08 units/ml, respectively, in 20 µl of TBS. After 15 min of incubation at 37°C, 30
mM CaCl2 and 1 mM Z-Gly-Gly-Arg-AMC in 100 µl of TBS were added (final
concentrations 15 mM and 0.5 mM, respectively) and substrate hydrolysis was monitored
at 37°C at 1 min intervals for 120 min using a SpectraMax M3 fluorescence plate reader
(Molecular Devices, Sunnyvale, CA) at excitation and emission wavelengths of 360 and
460 nm, respectively, and a cut-off filter at 455 nm.
Data were analyzed using
Technothrombin TGA evaluation software and the assay was calibrated with the
Technothrombin TGA CAL SET according to manufacturer’s instructions (Technoclone).
This assay is unaffected by thrombin in complex with α2-macroglobulin (Lau et al.,
2007).
The time to initial thrombin generation (lag time), the maximum thrombin
concentration (peak thrombin), the time to maximum thrombin concentration (time to
peak thrombin), the area under the curve or endogenous thrombin potential (ETP), and
velocity index were determined using instrument software. All samples and controls
were assayed in duplicate.
5.3.3 Rabbit model of catheter thrombosis
The rabbit model of catheter thrombosis was performed as described in detail
previously (Du et al., 2005; Yau et al., 2011; Yau et al., 2012). Studies were approved by
the Animal Research Ethics Board at McMaster University and all procedures were in
119
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
compliance with the Canadian Council on Animal Care guidelines. Briefly, male New
Zealand white rabbits (3 – 3.5 kg), purchased from Charles River Canada, were
anesthetized with a ketamine/xylazine mixture. Catheters were inserted into the right
jugular vein and advanced toward the heart for 7 cm and then secured in place with a
ligature. Every 5 min, 3 ml of blood was withdrawn from the catheter, maintained within
the syringe for 2 min, and then slowly re-injected. The catheter was then flushed with 2
ml of saline. A pressure transducer (Truwave Disposable Pressure Transducer; Baxter
Healthcare Corp.) placed between the catheter and the syringe was used to quantify the
pressure within the catheter. The time to catheter occlusion was taken as the time when
blood could no longer be withdrawn from the catheter and the pressure within the catheter
exceeded 15 mm Hg. At this point, or at 4 h if catheter occlusion did not occur, the study
was terminated.
5.3.4 Treatment groups
In the first study, the time to catheter occlusion was determined in rabbits (n = 5
per group) randomized to receive dabigatran in one of three different dose regimens, 70
U/kg heparin, or an equivalent volume of dabigatran vehicle (0.9% NaCl containing 0.1%
DMSO and 1% HCl). Because of its short half-life in rabbits (Wienen et al., 2007),
dabigatran was given as an intravenous bolus followed by a continuous infusion delivered
via a Harvard Apparatus Syringe Pump (Instech Laboratories, Inc., Plymouth Meeting,
PA). The high-, medium- and low-dose dabigatran regimens consisted of bolus doses of
120
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
0.15, 0.11 and 0.08 mg/kg, respectively, followed by infusions of 0.05, 0.04 and 0.03
mg/kg/h, respectively. The high-dose regimen was chosen based on the results of a study
in rats that reported that this regimen produces steady state plasma dabigatran
concentrations of about 150 ng/ml (Schiele et al., 2013); a concentration comparable to
the median peak concentration obtained when dabigatran is given orally to humans at a
dose of 150 mg twice-daily (van Ryn et al., 2010).
The medium- and low-dose
dabigatran regimens, which represent 75% and 50% of the high-dose regimen,
respectively, were chosen to achieve plasma dabigatran concentrations comparable to
those obtained in humans at mid-interval and trough, respectively (van Ryn et al., 2010).
In a second study, we compared the time to catheter occlusion in rabbits (n = 5 per
group) randomized to receive low-dose heparin, which was given as a single intravenous
bolus of 15 U/kg; a dose that failed to prolong the time to catheter occlusion when
compared with placebo in our previous study using this model (Yau et al., 2011), the lowdose dabigatran regimen, or the two in combination.
Control rabbits received an
equivalent volume of vehicle.
5.3.5 Blood sample collection and analysis
Before catheter insertion and at 5, 15, 30, 45, and 60 min thereafter, 1.8 ml
aliquots of blood were collected from a central ear vein into 3 ml syringes prefilled with
0.2 ml of 3.8% citrate. Blood samples were immediately mixed by inverting the tube 5
times and then maintained on ice until cellular elements were sedimented by
121
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
centrifugation at 1500 X g for 20 min at 4°C. After removing the plasma and subjecting
it to a second centrifugation step under the same conditions, platelet-poor plasma was
harvested and frozen in aliquots at -70°C.
Plasma dabigatran concentrations were determined using the Hemoclot Thrombin
Inhibitor assay (Hyphen Biomed, Neuville-sur-Oise, France), a dilute thrombin clotting
time assay with internal dabigatran calibrators (Stangier and Feuring, 2012). Briefly,
rabbit plasma was diluted with TBS in a 1:7 ratio (v/v), and 50 µl was then added to 100
µl of human platelet-poor plasma, and incubated at 37°C for 60 sec. After addition of
100 µl of human thrombin and CaCl2 (final concentrations, 10 nM and 20 mM,
respectively) in TBS to initiate clotting, absorbance was monitored at 340 nm for 1 h at
37°C using a SpectraMAX plate reader (Molecular Devices). The clotting time was
determined as the time to achieve half maximum absorbance, as calculated by the
instrument software. The dabigatran concentration was then determined by comparison
with a calibration curve constructed using pooled rabbit platelet-poor plasma diluted with
human plasma as described above and containing known concentrations of dabigatran.
Each dabigatran assay was performed in duplicate.
The lower limit of dabigatran
detection in this assay is 40 ng/ml and the intra- and inter-assay coefficients of variation
are less than 4% and 6%, respectively (Hyphen Biomed).
Heparin concentrations were determined using a chromogenic anti-Xa assay
modified from Teien et al. (Teien and Lie, 1977). Briefly, 2 μl of rabbit plasma was
mixed with 88 μl of 50 mM Tris-HCl, pH 8.4, 150 mM NaCl containing 2.5 mM EDTA.
122
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
After incubation with 10 µl of a 5 µM human antithrombin solution for 3 min at 37°C, a
20 µl-aliquot was removed and 10 µl of a 10 nM human factor Xa solution was added and
incubated for 30 sec prior to the addition of 20 µl of 500 µM S2765 (DiaPharma Group
Inc., West Chester, OH). Substrate hydrolysis was then monitored at 405 nm for 5 min
using a plate reader and anti-Xa levels were determined by comparison with a calibration
curve constructed in rabbit plasma containing known concentrations of heparin.
5.3.6 Statistical Analyses
Results are presented as mean ± standard deviation (SD) or as mean ± standard
error of the mean (SEM). The effect of dabigatran and/or heparin on thrombin generation
parameters was assessed by analysis of variance (ANOVA) with post-hoc analysis using
Tukey's test. To compare the influence of the three dabigatran dosing regimens in rabbits
on plasma concentrations of dabigatran, concentrations were displayed on a log scale and
plotted against time. The differences among the three rabbit treatment groups were then
assessed by ANOVA. For all analyses, a p-value < 0.05 was considered statistically
significant.
5.4 Results
5.4.1 Effect of dabigatran or heparin on catheter-induced thrombin generation in plasma
We first explored the effect of dabigatran on catheter-induced clotting using a
modified thrombin generation assay. Briefly, catheter segments were incubated in plasma
123
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
in the absence or presence of dabigatran at concentrations up to 400 ng/ml; an amount
that exceeds the therapeutic range, and thrombin generation was monitored (Figure 5.1A).
Overall, dabigatran prolonged the lag time and time to peak thrombin, and reduced peak
thrombin, ETP and velocity index in a statistically significant (p < 0.001) and
concentration-dependent fashion (Table 5.1). However, at concentrations of 100 ng/ml or
lower, there were no significant effects on these parameters. In a separate experiment,
catheter segments were incubated in plasma in the absence or presence of heparin at
concentrations up to 0.08 U/ml; values that might be achieved with prophylactic doses of
heparin (Cheng et al., 2012). Like dabigatran, heparin prolonged the lag time and time to
peak thrombin, and reduced peak thrombin, ETP and velocity index in a statistically
significant (p < 0.001) and concentration-dependent manner (Figure 5.1B, Table 5.2).
Therefore, whereas heparin attenuates catheter-induced thrombin generation in a dosedependent fashion, only dabigatran concentrations over 100 ng/ml attenuate catheterinduced thrombin generation.
124
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Table 1
Dabigatran (ng/ml)
Parameter
0
50
100
200
400
Lag (min)
16.3 ± 2.4
26.1 ± 5.1
31.0 ± 6.9
*43.4 ± 18.9
*62.3 ± 16.0
Time to peak thrombin
(min)
23.8 ± 3.6
38.5 ± 10.1
43.0 ± 7.0
*53.9 ± 17.5
*68.5 ± 5.8
155.5 ± 25.8
135.3 ± 24.3
126.0 ± 22.4
80.7 ± 46.3
*12.6 ± 10.6
1708 ± 244
1443 ± 217
1203 ± 248
*747 ± 430
*148 ± 125
Peak thrombin (nM)
ETP (nM)
Table 5.1: Effect of dabigatran on catheter-induced thrombin generation. Catheter
segments (0.5 cm) were incubated in human plasma for 15 min at 37°C in the absence or
presence of dabigatran at the indicated concentrations. After addition of 30 mM CaCl2,
thrombin generation was monitored by measuring the hydrolysis of 1 mM Z-Gly-GlyArg-AMC. Data are shown as mean ± SD. * denotes p < 0.05 compared with no
dabigatran.
125
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Table 2
Heparin (U/ml)
Parameter
0
Lag (min)
Time
to
thrombin (min)
peak
Peak thrombin (nM)
ETP (nM)
0.01
0.02
0.04
0.08
11.5 ± 0.9
13.2 ± 0.6
16.0 ± 1.3
21.0 ± 4.6
*31.2 ± 1.0
17.3 ± 3.7
22.2 ± 0.3
31.2 ± 6.8 *45.8 ± 16.1
*112 ± 14
183.9 ± 38.9
131.7 ± 20.6
*55.1 ± 29.1 *22.1 ± 17.4
*0.7 ± 1.2
1890 ± 307
1668 ± 100
*1153 ± 418
*3.7 ± 6.4
*502 ± 300
Table 5.2: Effect of heparin on catheter-induced thrombin generation. Catheter
segments (0.5 cm) were incubated in human plasma for 15 min at 37°C in the absence or
presence of heparin at the indicated concentrations. After addition of 30 mM CaCl 2,
thrombin generation was monitored by measuring the hydrolysis of 1 mM Z-Gly-GlyArg-AMC. Data are shown as mean ± SD. * denotes p < 0.05 compared with no heparin.
126
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
A
B
127
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 5.1: Representative thrombin generation profile. Catheter segments (0.5 cm)
were incubated in human plasma for 15 min at 37°C in the absence or presence of
dabigatran (Panel A) or heparin (Panel B). After addition of 30 mM CaCl2, thrombin
generation was monitored by measuring the hydrolysis of 1 mM Z-Gly-Gly-Arg-AMC.
In panel A, the concentrations of dabigatran are 0, 50, 100, 200, and 400 ng/ml,
respectively, whereas in panel B, the concentrations of heparin are 0, 0.01, 0.02, 0.04, and
0.08 U/ml, respectively.
128
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
5.4.2 Effect of supplemental heparin on the capacity of dabigatran to attenuate catheterinduced thrombin generation
To determine whether heparin enhances the capacity of low doses of dabigatran to
inhibit catheter-induced thrombin generation, we examined the effect of low doses of
these agents alone or in combination. At 50 ng/ml, dabigatran had no significant effect
on thrombin generation parameters, except ETP, which was significantly (p = 0.02)
reduced by 21.6% compared with no anticoagulant (Table 5.3). When used alone at a
concentration of 0.02 U/ml, heparin had no significant effect on lag time and time to peak
thrombin, but significantly (p < 0.001) reduced peak thrombin, ETP and velocity index by
76.6%, 51.4%, and 88.3%, respectively, compared with no anticoagulant. When 50 ng/ml
of dabigatran and 0.02 U/ml of heparin were administered together, the lag time and time
to peak thrombin were significantly (p < 0.001) prolonged by 2.3- and 2.4-fold,
respectively, and the peak thrombin, ETP, and velocity index were significantly (p <
0.001) reduced by 81.5%, 69.1%, and 95.2%, respectively, compared with no
anticoagulant. Similar results were obtained when higher concentrations of dabigatran
and heparin were used. Therefore, heparin enhances the capacity of low concentrations
of dabigatran to attenuate catheter-induced thrombin generation.
129
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Heparin (U/ml)
Parameter
Dabigatran (ng/ml)
Lag (min)
0
19.5 ± 2.8
25.8 ± 3.4
28.9 ± 4.4
50
29.1 ± 5.3
*43.9 ± 2.6
*67.3 ± 12.4
100
39.0 ± 5.6
*46.0 ± 9.6
*81.3 ± 9.4
0
31 ± 5.2
48.3 ± 12.8
*57.4 ± 11.9
50
47.5 ± 5.2
*74.1 ± 7.6
> 120
100
49.9 ± 4.7
*77.8 ± 28.9
> 120
0
115.4 ± 9.4
*27.0 ± 7.5
*15.4 ± 13.3
50
102.2 ± 5.5
*26.4 ± 10.9
0
100
105 ± 12
*33.4 ± 41.9
0
0
1374 ± 71
*668 ± 144
*353 ± 315
50
*1076 ± 63
*502 ± 152
*12 ± 23
100
*1016 ± 87
*320 ± 395
0
Time
to
thrombin (min)
peak
Peak thrombin (nM)
ETP (nM)
0
0.02
0.04
Table 5.3: Effect of dabigatran and/or heparin on catheter-induced thrombin
generation. Catheter segments (0.5 cm) were incubated in human plasma for 15 min at
37°C in the absence or presence of dabigatran and/or heparin at the indicated
concentrations. After addition of 30 mM CaCl2, thrombin generation was monitored by
measuring the hydrolysis of 1 mM Z-Gly-Gly-Arg-AMC. Data are shown as mean ± SD.
* denotes p < 0.05 compared with no anticoagulant.
130
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
5.4.3 Plasma dabigatran concentrations in rabbits
Dabigatran infusion regimens were selected to produce plasma concentrations
comparable to those reported at peak and trough in patients given dabigatran at a dose of
150 mg twice daily (van Ryn et al., 2010). Mean dabigatran concentrations 5 min after
bolus administration were 336 ± 17, 254 ± 36, and 81 ± 6 ng/ml with the high-, medium-,
and low-dose regimens, respectively, whereas the corresponding levels at 30 min were
173 ± 10, 140 ± 21, and 60 ± 4 ng/ml, respectively (Figure 5.2). Examination of the logtransformed plots of dabigatran concentration versus time revealed a significant (p <
0.001) dose dependence, and the dabigatran levels with the two higher dose regimens
were significantly higher than those with the lower dose regimen, but not significantly
different from each other (not shown). With the high- and medium-dose regimens, mean
dabigatran concentrations after 30 min were comparable to median peak values observed
in humans (184 ng/ml; range 64 – 443 ng/ml), whereas the mean dabigatran concentration
in rabbits given the low-dose regimen was similar to the median trough values (90 ng/ml;
range 31 – 225 ng/ml) (van Ryn et al., 2010). Therefore, the chosen regimens achieve
clinically relevant plasma dabigatran concentrations.
131
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 5.2: Plasma dabigatran and heparin concentrations in rabbits. Rabbits (n = 5
per group) were given high- (■), medium (▼), or low-dose (●) dabigatran regimens
consisting of an intravenous bolus of 0.15, 0.11 or 0.08 mg/kg followed by an infusion of
0.05, 0.04 or 0.03 mg/kg/h, respectively. Blood samples were collected at the times
indicated and plasma dabigatran concentrations were determined using a dilute thrombin
clotting time assay. Symbols represent the mean while the lines reflect the SEM. Inset:
Rabbits (n = 5) were given heparin as an intravenous bolus of 70 U/kg followed by a
vehicle infusion. Blood samples were collected at the times indicated and plasma heparin
132
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
concentrations were determined using an anti-Xa assay. Symbols represent the mean
while the lines reflect the SEM.
133
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
5.4.4 Effect of dabigatran and heparin on time to catheter occlusion in rabbits
To explore the effect of dabigatran and/or heparin on catheter-induced clotting in
vivo, we used a rabbit model of catheter thrombosis. The time to catheter occlusion in
rabbits given vehicle was 53.4 ± 5.8 min (Figure 5.3); a value consistent with our
previous results (Yau et al., 2011). With dabigatran, the mean time to catheter occlusion
was prolonged 2.9-fold (to 153 ± 23 min; p = 0.001) in rabbits given high-dose and 1.9fold (to 102 ± 13 min; p = 0.02) in those given the medium-dose regimen. In contrast, the
mean time to catheter occlusion in rabbits given the low-dose dabigatran regimen (52.2 ±
2.4 min) was similar to that with vehicle. By comparison, the mean time to occlusion was
prolonged 3.4-fold (to 182 ± 7 min; p < 0.001) with 70 U/kg heparin (Figure 5.3), which
produced mean heparin anti-Xa concentrations 5 and 30 min after bolus administration of
1.2 ± 0.3 and 0.7 ± 0.2 U/ml, respectively (Figure 5.2, inset). Taken together, the
minimal effect of low-dose dabigatran and the pronounced effect of high- and mediumdose dabigatran, along with heparin, are consistent with their activities in vitro.
To determine whether dabigatran and heparin have synergistic effects when
administered together, we next examined the effect of combining the agents in doses that,
on their own, had minimal effects on the time to catheter occlusion (Figure 5.4).
Therefore, we used the low-dose dabigatran regimen and a 15 U/kg intravenous bolus
dose of heparin; a regimen that failed to prolong the time to catheter occlusion in a
previous study (Yau et al., 2011). The mean heparin anti-Xa concentrations 5 and 30 min
after administration of this dose of heparin were 0.16 ± 0.01 and < 0.05 U/ml,
134
Ph.D. Thesis – J. Yau
respectively.
McMaster University – Biomedical Engineering
As expected, the mean time to occlusion with low-dose heparin or
dabigatran alone was similar to that with the vehicle control (55.6 ± 6.5, 52.2 ± 2.4 and
53.4 ± 5.8 min, respectively). In contrast, when the two drugs were given in combination,
there was a significant 2.7-fold prolongation in the time to occlusion (to 142 ± 9 min; p <
0.001) compared with the control or with either agent alone; a finding consistent with
synergy between the two anticoagulants. These findings suggest that, like the results in
vitro, supplemental heparin promotes the antithrombotic activity of dabigatran in a more
than additive manner.
135
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 5.3: Effect of dabigatran or heparin on the time to catheter occlusion in
rabbits. Catheters were inserted in the jugular veins of rabbits that were randomized to
receive vehicle, high-, medium-, or low-dose dabigatran, or 70 U/kg of heparin (n = 5 per
group). Every 2 min, 2 ml of blood was withdrawn from the catheter, held for 2 min in a
syringe, and then slowly re-injected. Catheter occlusion occurred when blood could no
longer be withdrawn, and the pressure measured with a transducer exceeded 15 mm Hg.
Bars reflect the mean times to catheter occlusion, while the lines above the bars reflect the
SEM. * denotes p < 0.05 compared with the vehicle control.
136
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 5.4: Effect of low-dose dabigatran and/or heparin on the time to catheter
occlusion in rabbits. Catheters were inserted into the jugular veins of rabbits (n = 5 per
group) that were randomized to receive vehicle, 15 U/kg heparin, low-dose dabigatran, or
the combination and the time to catheter occlusion was determined. The bars reflect the
means, while the lines above the bars represent the SEM. * denotes p < 0.05 compared
with the vehicle control.
137
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
5.5 Discussion
When compared with warfarin in patients with atrial fibrillation, dabigatran given
at a dose of 150 mg twice-daily was associated with a significantly lower rate of stroke
and systemic embolism (Connolly et al., 2009). This dabigatran regimen also was as
effective as warfarin for treatment of acute venous thromboembolism (Schulman et al.,
2009; Schulman et al., 2013a). In contrast, even higher doses of dabigatran were less
effective than warfarin for prevention of stroke in patients with mechanical heart valves
(Eikelboom et al., 2013), raising the possibility that dabigatran may also be limited in its
capacity to inhibit clotting on other blood-contacting medical devices, such as catheters.
Using a catheter-induced thrombin generation assay and a previously validated rabbit
model of catheter thrombosis to examine this possibility, we demonstrate that (a) peak,
but not trough, concentrations of dabigatran attenuate catheter-induced thrombin
generation in vitro and prolong the time to catheter occlusion in rabbits, and (b) low-dose
heparin enhances the capacity of low-dose dabigatran to inhibit catheter-induced
thrombin generation in vitro and to prolong the time to catheter occlusion in rabbits.
Our findings provide further insights into the pathogenesis of catheter thrombosis.
Previously, we showed that catheters activate factor XII, thereby initiating coagulation
via the intrinsic pathway (Yau et al., 2011; Yau et al., 2012). The limited capacity of
dabigatran to attenuate catheter-induced thrombin generation or to prolong the time to
catheter occlusion is consistent with our hypothesis that the concentration of thrombin
generated on the surface of the catheters can readily exceed that of dabigatran, which
138
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
inhibits thrombin in a 1:1 stoichiometric fashion (Hankey and Eikelboom, 2011). There
are two reasons why heparin may be more effective than dabigatran in this setting. First,
because it activates antithrombin in a catalytic fashion, heparin can inhibit high
concentrations of thrombin and factor Xa. Second, in addition to inhibiting thrombin and
factor Xa, heparin also promotes inhibition of factors XIIa, XIa, and IXa. Upstream
inhibition above the level of factor Xa is important because fondaparinux, which only
targets factor Xa in an antithrombin-dependent fashion, also failed to prolong the time to
catheter occlusion in this rabbit model, even when given in supra-therapeutic doses (Yau
et al., 2011).
Whether direct factor Xa inhibitors prevent catheter thrombosis or
thrombosis induced by other blood-contacting medical devices to a greater extent than
fondaparinux is unknown.
However, the observation that compared with placebo,
rivaroxaban reduced the risk of stent thrombosis when added to dual antiplatelet therapy
in patients with stabilized acute coronary syndrome (Mega et al., 2012) certainly raises
this possibility.
Although dabigatran prolonged the time to catheter thrombosis at peak therapeutic
concentrations in the rabbit model, the effect was lost at trough levels.
Likewise,
dabigatran concentrations below 100 ng/ml failed to attenuate catheter-induced thrombin
generation. If the same holds for patients with mechanical heart valves, these findings
would explain why maintaining the trough level of dabigatran above 50 ng/ml was
insufficient to prevent thromboembolic events (Eikelboom et al., 2013).
139
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
The limited capacity of dabigatran to prevent catheter-induced clotting has
potential clinical implications. First, dabigatran is likely to be licensed as an alternative
to warfarin for treatment of acute venous thromboembolism, which includes deep-vein
thrombosis (DVT) and pulmonary embolism (PE). Central venous catheters can trigger
DVT and subsequent PE, particularly in patients with cancer (Lee and Kamphuisen,
2012). Our findings with catheters raise concern about the use of dabigatran in such
patients. Second, our results may also be relevant in atrial fibrillation patients receiving
dabigatran for stroke prevention who develop acute coronary syndrome and require
urgent PCI. If trough doses of dabigatran fail to prevent catheter-induced thrombin
generation or prolong the time to occlusion in rabbits, dabigatran alone may be
insufficient to prevent catheter thrombosis in such patients. This concept is supported by
the results of a small randomized trial that compared pre-procedural oral dabigatran (in
doses of 110 or 150 mg twice-daily) with conventional intra-procedural intravenous
heparin in patients undergoing elective PCI (Vranckx et al., 2013). Plasma levels of
prothrombin fragment 1+2 and thrombin-antithrombin complexes, markers of activation
of coagulation, were higher in patients given dabigatran than in those randomized to
heparin (Vranckx et al., 2013); findings consistent with our in vitro data that dabigatran is
less effective than heparin at inhibiting catheter-induced thrombin generation. Therefore,
dabigatran-treated patients undergoing elective or urgent PCI are likely to require
supplemental heparin at the time of the procedure.
140
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
When low-dose heparin is co-administered with low-dose dabigatran, the time to
catheter occlusion is prolonged, whereas neither agent has an effect on its own; a finding
consistent with synergy between the two agents. In contrast to dabigatran, which only
targets thrombin, heparin not only inhibits factor Xa and thrombin, but also attenuates
thrombin generation, thereby decreasing the concentration of thrombin that requires
inhibition by dabigatran. Therefore, their complementary mechanism of action likely
explains the more than additive effects of dabigatran and heparin when used in
combination. Similar synergy was observed when low-dose heparin or bivalirudin, a
parenteral direct thrombin inhibitor, was given in conjunction with fondaparinux (Yau et
al., 2011). Because of the synergy, it is likely that even low doses of heparin will be
sufficient to prevent catheter thrombosis in dabigatran-treated patients undergoing PCI.
This study has potential limitations. The clinical relevance of catheter-induced
thrombin generation is uncertain. However, the fact that the findings in the rabbit model
are consistent with those in vitro suggests that the thrombin generation assays are
relevant. Nonetheless the extent to which our findings in vitro and in rabbits translate to
those in humans is unclear. Although this question can only be addressed through clinical
trials, the observations that fondaparinux was less effective than heparin or lowmolecular-weight heparin at preventing catheter thrombosis in this model and that
adjunctive heparin circumvented this problem are consistent with the results in humans
(Yau et al., 2011; Steg et al., 2010; Yusuf et al., 2006b; Yusuf et al., 2006a). Likewise,
the failure of dabigatran to prevent thrombosis in patients with mechanical heart valves
141
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
(Eikelboom et al., 2013) highlights its limitations in patients with blood-contacting
medical devices.
In summary, this study suggests that the limited capacity of dabigatran to prevent
thrombosis in patients with mechanical heart valves may extend to catheters and other
blood-contacting devices. Consequently, dabigatran may not be the agent of choice for
treatment of patients with DVT in association with central venous catheters or ports.
Furthermore, our observation that catheters initiate clotting by activating fXII (Yau et al.,
2011) raises the possibility that agents that target clotting factors upstream to thrombin
may provide advantages over thrombin-specific inhibitors.
Although fXII-specific
inhibitors have yet to be investigated in humans, several are under development,
including fXII-directed monoclonal antibodies (Matafonov et al., 2014), nanobodies (de
Maat et al., 2013), RNA aptamers (Woodruff et al., 2013), and antisense oligonucleotides
(Revenko et al., 2011; Yau et al., 2014). It remains to be determined whether these
agents prevent medical device-associated thrombosis to a greater extent than inhibitors of
thrombin or factor Xa. Another strategy is to coat medical devices with corn trypsin
inhibitor (CTI), a fXIIa inhibitor, to block the root cause of device–associated thrombosis;
an approach that prolongs the time to catheter occlusion in vitro and in rabbits (Yau et al.,
2012). Additional studies are required to compare the utility of these strategies.
142
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Chapter 6: Corn trypsin inhibitor coating attenuates the prothrombotic
properties of catheter in vitro and in vivo
Forward
This study demonstrates the antithrombotic properties of CTI-coated catheter
surfaces.
CTI-coated catheter surfaces demonstrate reduced fXII and fibrinogen
adsorption, reduced fXII and fXI activation, and reduced apparent fXIIa activity. These
properties result in prolonged plasma clotting time in vitro and catheter-induced occlusion
time in rabbits.
Copyright Information: This research was originally published in Acta Biomaterialia.
Jonathan W. Yau, Alan R. Stafford, Peng Liao, James C. Fredenburgh, Robin S. Roberts,
John L. Brash, and Jeffrey I. Weitz. Corn trypsin inhibitor coating attenuates the
prothrombotic properties of catheters in vitro and in vivo. Acta Biomaterialia. 2012;
8(11): 4092-4100. Reprinted with permission from Elsevier. © 2012 Acta Materialia
Inc. Published by Elsevier Ltd.
143
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
6.1 Abstract
Catheters initiate coagulation by activating factor (f) XII, which can lead to catheter
thrombosis. Fondaparinux, which only targets activated fX (fXa), is associated with more
catheter thrombosis than heparin, which targets fXa and thrombin. To render catheters
less thrombogenic and fondaparinux more effective, we examined whether coating
catheters with corn trypsin inhibitor (CTI), which blocks fXIIa, attenuates catheterinduced clotting and promotes fondaparinux activity.
Compared with unmodified
catheters, CTI-coated catheters demonstrated (a) decreased adsorption of fibrinogen and
fXII, (b) greater inhibition of fXIIa generated by catheter-induced autoactivation, (c)
attenuated fXIIa-mediated activation of fXI; and (d) longer plasma clotting times in the
absence or presence of fondaparinux. In an accelerated catheter thrombosis model in
rabbits, (a) the time to catheter occlusion was longer with CTI-coated catheters than with
unmodified catheters; and (b) an intravenous dose of fondaparinux that had no effect on
the time to occlusion of unmodified catheters extended the time to occlusion of CTIcoated catheters. These findings support the concept that the prothrombotic activity of
catheters reflects their capacity to activate fXII and identify CTI immobilization as a
novel approach for rendering catheters and other blood-contacting medical devices less
thrombogenic.
144
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
6.2 Introduction
Percutaneous coronary intervention (PCI) is a mainstay of treatment for patients
with acute coronary syndromes (ACS). Guide catheter thrombosis, a peri-procedural
complication of PCI, can lead to myocardial infarction (Chan et al., 2009; Montalescot
and Walenga, 2009).
Although heparin abrogates catheter thrombosis, its use in
conjunction with potent antiplatelet drugs can lead to serious bleeding complications
(White and Chew, 2008). This is problematic because there is mounting evidence that
bleeding in ACS patients is associated with adverse outcomes, including increased
mortality (Amlani et al., 2010; Happe et al., 2009; Lindsey et al., 2009; Manoukian et al.,
2007). To reduce the risk of bleeding, attention has focused on anticoagulants that are
safer than heparin in the ACS setting. One such agent is fondaparinux, a synthetic analog
of the unique pentasaccharide sequence that mediates the interaction of heparin with
antithrombin. Whereas heparin and low-molecular weight heparin (LMWH) promote the
inhibition of activated factor X (fXa) and thrombin by antithrombin, fondaparinux only
enhances fXa inhibition because it is too short to bridge antithrombin to thrombin (Hirsh
et al., 2008).
When compared with LMWH for treatment of non-ST-segment elevation ACS,
fondaparinux was associated with a 50% reduction in major bleeding, which resulted in a
17% decrease in mortality at 30 days (Yusuf et al., 2006a). There also was an overall
reduction in 30-day mortality or reinfarction when fondaparinux was compared with
heparin or placebo in patients with ST-segment elevation myocardial infarction (Yusuf et
145
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
al., 2006b). However, the risk of catheter thrombosis was higher with fondaparinux than
with LMWH or heparin in ACS patients who underwent PCI (Mehta et al., 2007), and
because of this problem, fondaparinux was of no benefit in patients undergoing urgent
PCI (Yusuf et al., 2006b). These findings highlight the need for new strategies to
eliminate the requirement for potent systemic anticoagulants during PCI, or to render
agents such as fondaparinux more effective. One approach to this problem is to modify
the surface of PCI catheters so as to make them less thrombogenic.
Blood coagulation is initiated by two distinct pathways, the tissue factor pathway
and the contact factor pathway, which are triggered by activation of factor (f) VII or fXII,
respectively. FVII is activated when tissue factor is exposed at sites of atherosclerotic
plaque rupture, whereas fXII is activated by RNA, polyphosphates or sulfatides released
from cells or platelets, or by surface-adsorbed fibrinogen or fibrin (Kannemeier et al.,
2007; Smith et al., 2006; Tans and Griffin, 1982; Sanchez et al., 2008). Artificial
surfaces are known to activate the contact factor pathway in a fXII-dependent manner
through hydrophobic or hydrophilic interactions (Zhuo et al., 2006), consistent with the
observation of elevated levels of fXIIa in patients undergoing PCI (Altieri et al., 2005).
FXIIa triggers coagulation by initiating the sequential activation of factors XI, IX, X, and
prothrombin. The resultant thrombin then converts fibrinogen to fibrin, the structural
backbone of the thrombus (de la Cadena et al., 1994). Because of its initiating role, fXIIa
represents an attractive target for prevention of contact pathway-initiated thrombosis.
146
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Recently, we identified fXIIa as an attractive target for prevention of catheterinitiated clotting (Yau et al., 2009; Yau et al., 2011).
Thus, we showed that the
prothrombotic activity of catheters is fXII-dependent because catheters have a minimal
effect on clotting in plasma deficient in fXII or fXI, key components of the contact
pathway. Furthermore, we demonstrated that corn trypsin inhibitor (CTI), a 12 kDa
Kunitz-type inhibitor of fXIIa, attenuates catheter-induced clotting in a plasma system
(Yau et al., 2009; Yau et al., 2011). CTI reversibly interacts with the active site of fXIIa
with a Ki of 24 nM, and does not inhibit other proteases (Hojima et al., 1980). Because of
its small size, CTI is well suited for immobilization on the surface of catheters (Yau et al.,
2009).
As first steps to explore the utility of CTI coating, polyethylene glycol (PEG) was
conjugated with CTI and then immobilized onto gold or polyurethane model surfaces
(Alibeik et al., 2011; Alibeik et al., 2012a; Alibeik et al., 2012b). On both surfaces,
immobilization of CTI conjugates attenuated protein adsorption from buffer or plasma
and prolonged the plasma clotting time. Building on this information, we set out to
determine whether the results with model surfaces could be applied to catheters and
whether the protein resistance and antithrombotic properties of CTI coating in vitro would
result in reduced thrombosis when CTI-coated catheters were implanted in the jugular
veins of rabbits. We also investigated whether CTI-coated catheters would promote the
antithrombotic activity of fondaparinux which, on its own, has no effect on catheterinduced clotting in vitro or in vivo (Yau et al., 2011).
147
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
6.3 Materials and Methods
6.3.1 Materials
CTI and human fXII, fXIIa, fXI, and fibrinogen were from Enzyme Research
Laboratories Inc. (South Bend, IN). Glycidyl methacrylate and ovalbumin were from
Sigma-Aldrich, Inc. (St. Louis, MO). 2,2’-azobis(isobutyronitrile) (AIBN) was from
DuPont (Mississauga, ON). Pefachrome XIIa, Pefafluor APC, and Prionex were from
Pentapharm Ltd. (Basel, Switzerland). A 3500 Da polyethylene glycol (PEG) spacer with
activated maleimide at one terminus, and a primary amine at the other, was purchased
from JenKem Technologies USA Inc. (Allen, TX). Unilamellar phosphatidylcholinephosphatidylserine (PCPS) vesicles (75%/25% w/w, respectively) were prepared and
characterized as previously described (Anderson et al., 2001).
Fondaparinux was
obtained from GlaxoSmithKline (Mississauga, ON). 6 Fr Mach1 PCI guide catheters,
composed of polyether block amide and polytetrafluoroethylene (Ross, 6 A.D.), were a
generous gift from Boston Scientific, Inc. (Natick, MA), whereas 7 Fr unmodified
polyurethane (PU) single lumen catheters with slightly rounded distal tips (Solo-Cath PUC70) were purchased from Solomon Scientific (Plymouth Meeting, PA). Prothrombin
time and activated partial thromboplastin time assays were performed on a STA compact
analyzer (Diagnostica Stago, Asnieres-sur-Seine, France) using Innovin, which contains
relipidated recombinant human tissue factor (TF), and Actin FSL (Siemens Dade),
respectively.
Citrated plasma was obtained from 10 healthy donors and pooled as
described (Kretz et al., 2010).
148
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
6.3.2 Preparation of 125I-labeled proteins
CTI, ovalbumin, fXII, and fibrinogen were radiolabeled with Na125I (McMaster
University Nuclear Reactor, Hamilton, ON) using Iodo-beads (Pierce Chemical Co.,
Rockford, IL) as described (Fredenburgh et al., 2001).
Briefly, one Iodo-bead was
incubated with 1 mCi of Na125I in phosphate-buffered saline for 10 min. The bead was
removed, and 200 µg of protein was added to the Na125I solution.
After 10 min
incubation, the reaction was terminated by the addition of 40 mM sodium metabisulfite
and unbound
125
I was removed by applying the sample to a PD-10 column (GE
Healthcare) equilibrated with 20 mM Tris-HCl, 150 mM NaCl, pH 7.4, containing 0.01%
Tween 20 and 0.6% polyethylene glycol 8000. The column was eluted under gravity, and
0.5-ml fractions were collected. The fractions were measured for absorbance at 280 nm
and for radioactivity. Protein-containing fractions were pooled, and the concentration
was determined spectrophotometrically. The specific radioactivities of
125
I-labelled CTI,
ovalbumin, fXII, and fibrinogen were 6.2 x 108, 3.31 x 109, 9.8 x 109, and 8.5 x 108
cpm/mg, respectively.
6.3.3 Preparation of PEG conjugated CTI
To facilitate catheter surface modification, CTI was conjugated to a 3500 Da PEG spacer;
as a control, ovalbumin was used in place of CTI. To convert primary amine groups to
sulfhydryl groups, CTI or ovalbumin was incubated for 1 h at 23ºC in 20 mM sodium
phosphate, pH 8.0, 150 mM NaCl (PBS) containing 2 mM EDTA and a 10-fold molar
149
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
excess of 2-iminothiolane-HCl (Pierce Biotechnology, Inc., Rockford, IL). After dialysis
against PBS, pH 6.5, containing 2 mM EDTA, 2-iminothiolane-modified CTI or
ovalbumin was incubated with a 20-fold molar excess of the maleimide-containing PEG
spacer for 1 h at 23ºC. Excess PEG was removed by passage of the reaction mixtures
over PD10 columns equilibrated with PBS, pH 7.4. The column was eluted under
gravity, and fractions of 0.5-ml were collected. Based on absorbance at 280 nm, proteincontaining fractions were identified, pooled, and concentrated using a Speed-vac
(ThermoFisher Scientific Inc., Waltham, MA) (Fredenburgh et al., 2001).
6.3.4 Catheter modification
Two types of catheter were used; PCI guide catheters were evaluated in vitro and were
subjected to physical and biological characterization, whereas the smaller caliber, more
flexible PU catheters were used in the rabbit model.
PCI and PU catheters were first
rinsed with deionized water and cut into 2 and 15 cm segments, respectively. The open
ends of the PCI catheters were sealed with implant-grade silicone adhesive (Rhodia,
Ventura, CA). Using the procedure of Du et al. (Du et al., 2007), a basecoat was first
applied by immersing the catheter segments in a 10 ml solution of glycidyl methacrylate
containing 0.1 g AIBN for 20 min at 23ºC. After removing the catheters, excess solution
was blotted with filter paper and the catheters were incubated at 80°C for 40 min
followed by an annealing step at 50°C for 20 min. Syringes were used to inject solutions
containing 10 µM PEG or conjugates of PEG with CTI or ovalbumin into the lumens of
150
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
PU catheters. Base-coated PU and PCI catheters were then submerged in the coating
solutions, and incubated overnight at 4°C. A 10 µM concentration and a 24 h incubation
were chosen because preliminary studies using radiolabeled CTI or ovalbumin indicated
that the extent of coating was both concentration and time dependent, but reached a
plateau at 10 µM and 24 h incubation, respectively. At the end of the incubation period,
catheters were washed three times with PBS, pH 7.4.
Surfaces were either used
immediately for experiments, or were dried and stored under argon until use.
6.3.5 Surface density of immobilized CTI
125
I-labeled CTI or ovalbumin was mixed with a 20-fold molar excess of unlabeled CTI or
ovalbumin, respectively. Base-coated catheter segments were incubated with
125
125
I-CTI or
I-ovalbumin at concentrations ranging from 0 to 10 µM for 24 h at 23ºC. Catheter
segments were then washed three times with PBS, blotted dry, and counted for
radioactivity. Radioactivity per unit surface area was determined in triplicate for each
type of catheter segment.
6.3.6 X-ray photoelectron spectroscopy (XPS)
Three unmodified, PEG-, CTI-, or ovalbumin-coated catheter segments were submitted to
Surface Interface Ontario at the University of Toronto for XPS analysis using a Theta
Probe XPS spectrometer (ThermoFisher Scientific Inc., Waltham, MA) with a
monochromatic Al/K-α x-ray source. Charge compensation was provided by utilizing the
151
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
combined e-/Ar+ flood gun. The position of the energy scale was adjusted to place the
main C1s feature (C-C) at 285.0 eV. A low resolution analysis was performed with a
scan width of 200 eV at a takeoff angle of 90º (sampling depth ~10 nm). Raw data were
analyzed and quantified using the instrument software (Avantage) and the relative
contents of carbon, oxygen, nitrogen and fluorine were determined.
6.3.7 Water contact angle
To examine the effect of surface modification on hydrophobicity, advancing and receding
sessile drop water contact angles were measured using a goniometer (Rame Hart NRL
C.A., Mountain Lakes, NJ) with Milli-Q water (18 mΩ/cm) and a drop volume of 0.01
ml.
Results represent the mean of six measurements from at least three separate
preparations of each catheter type.
6.3.8 fXII or fibrinogen adsorption
Adsorption of
125
I-labeled fXII or fibrinogen onto modified catheter segments was
compared with that onto unmodified catheters. Catheter segments were incubated for 3 h
at 23ºC in tubes containing 600 µl of a 1:1 mixture of human citrated plasma and PBS
containing 1.5 μg/ml 125I-fXII or 150 μg/ml 125I-fibrinogen; concentrations that represent
about 5% of their endogenous concentrations in plasma. After rinsing three times with
PBS, excess liquid was blotted, and the catheter segments were counted for radioactivity
152
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
to determine the surface density of bound protein. Each adsorption study was performed
in triplicate.
6.3.9 fXIIa binding
The capacity of unmodified or modified catheter segments to bind fXIIa was compared
using a chromogenic assay. Three catheter segments were incubated in 600 μl of PBS
containing 4 µg/ml fXIIa, 2 mM CaCl2, 12.5 μM ZnCl2, and 0.1% Prionex for 1 h at 23ºC
with constant mixing. 150-μl aliquots from each solution were transferred to wells of a
96-well plate and 50 μl of 1.6 mM Pefachrome XIIa was then added and absorbance was
monitored at 405 nm using a plate reader (Molecular Devices, Sunnyvale, CA). The
concentration of residual fXIIa was calculated using the specific chromogenic activity
value, which was determined in a separate experiment.
6.3.10 Activity of fXIIa generated in situ
To determine whether surface modification attenuates the activity of fXIIa generated in
situ, three catheter segments were incubated in 600 μl of PBS containing 80 µg/ml fXII, 2
mM CaCl2, and 12.5 μM ZnCl2 for 3 h at 23ºC with constant mixing. 150-μl aliquots
from each solution were transferred to wells of a 96-well plate and 50 μl of 1.6 mM
Pefachrome XIIa was added. The fXIIa activity was determined as described above.
153
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
6.3.11 fXI activation
To determine the extent to which CTI coating attenuates fXIIa activity, fXI activation by
in situ generated fXIIa was examined. Catheter segments were first incubated for 30 min
at 23ºC in 600 µl PBS containing 30 µg/ml fXII, 2 mM CaCl2, 12.5 µM ZnCl2 and 0.1%
Prionex. Catheters were removed, washed three times with saline, and then incubated for
30 min at 23ºC in 600 µl of PBS containing 5 µg/ml fXI, 2 mM CaCl 2, 12.5 µM ZnCl2
and 0.1% Prionex. 175-µl aliquots from each solution were transferred to wells of a 96well plate containing CTI (final concentration, 8 µM) to block any residual fXIIa. fXIa
activity was determined by adding 25 µl of 3.2 mM Pefafluor-APC and monitoring its
hydrolysis in a Gemini fluorescent plate reader (Molecular Devices, Sunnyvale, CA)
(excitation wavelength 342 nm, emission wavelength 440 nm, cut-off filter 420 nm). The
concentration of fXIa was calculated by comparison with a standard curve generated with
known concentrations of fXIa.
6.3.12 Prothrombotic activity of catheters in plasma
The prothrombotic activity of unmodified and modified catheter surfaces was compared
using a plasma based clotting assay; studies were performed in multiwell plates. After
incubation of two catheter segments of each type in 700 μl of human plasma diluted with
an equal volume of PBS containing 50 μM PCPS vesicles for 15 min at 37°C, 200-µl
aliquots of the solution were removed and added to wells of a 96-well polystyrene plate
(Evergreen Scientific, Los Angeles, CA) containing 5 μl of 1 M CaCl2. Where indicated,
154
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
0 – 3 anti-Xa U/ml of fondaparinux was added to the plasma prior to calcium addition.
Under all conditions, absorbance was monitored at 340 nm for 4 h at 37°C, and the
clotting time was calculated using the instrument software as the time required to reach
half maximal absorbance.
6.3.13 In vivo characterization of coated PU catheters
A rabbit model of accelerated catheter thrombosis was used to compare the prothrombotic
activity of modified and unmodified catheters. Studies were approved by the Animal
Research Ethics Board at McMaster University and all procedures were in compliance
with the Canadian Council on Animal Care guidelines.
As recently described in detail
(Yau et al., 2011), PU catheters were inserted into the right jugular vein, advanced toward
the heart for 7 cm, and secured in place with a ligature. Using a syringe, 3 ml of blood
was slowly withdrawn from the catheter, maintained within the syringe for 2 minutes, and
then slowly re-injected. The catheter was then flushed with 2 ml of saline. This cycle
was repeated every 5 min. A pressure transducer, placed between the catheter and the
syringe, was used to quantify pressure within the catheter. The time to catheter occlusion
was taken as the time when blood could no longer be withdrawn from the catheter and the
transducer recorded a pressure greater than 15 mm Hg.
In the first set of studies, male New Zealand white rabbits (3 - 3.5 kg), purchased
from Charles River Canada (n = 5 per group), were implanted with unmodified catheters,
or catheters coated only with basecoat, with basecoat plus PEG, or with basecoat plus
155
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
ovalbumin or CTI. In a second study, rabbits (n = 5 per group) were given an intravenous
bolus injection of saline or 70 anti-fXa U/kg fondaparinux, a dose previously shown to
have no effect on the time to occlusion of unmodified catheters, immediately prior to
implantation of unmodified, ovalbumin-coated or CTI-coated catheters.
6.3.14 Statistical Analyses
Results are presented as means ± standard deviation (SD). Unless otherwise stated,
experiments were performed at least three times. Comparison of means of paired data
was performed using Student’s t-tests. Two-way analysis of variance (ANOVA) was
used to compare the effects of varying concentrations of fondaparinux on clotting times.
Testing was conducted using log-transformed clotting time data to stabilize the variance
and indeterminate clotting time values were omitted. For all analyses, p-values less than
0.05 were considered statistically significant.
6.4 Results
6.4.1 Surface density of CTI and ovalbumin
In this study, PEG-conjugated CTI (CTI) or PEG-conjugated ovalbumin (ovalbumin) was
attached to the surface of the catheters via a glycidyl methacrylate basecoat, a priming
agent that facilitates conjugate immobilization onto the catheter surface. We elected to
immobilized preformed conjugates because our previous work with model surfaces
revealed greater surface density of CTI with this method than with a sequential method
156
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
wherein initial PEG immobilization was followed by subsequent attachment of CTI
(Alibeik et al., 2012a). A time course was performed to assess the influence of incubation
time on the efficiency of
125
I-CTI or
125
I-ovalbumin immobilization on the catheter
surface. Basecoat modified catheters were incubated with
125
I-CTI or
125
I-ovalbumin for
up to 24 h. Increasing immobilization to the catheter segment was observed for periods
up to 24 h and further incubation did not increase immobilization (not shown). In a
similar assay, the influence of concentration was evaluated. At concentrations up to 10
µM, binding of
125
I-CTI or 125I-ovalbumin onto the catheter segments was concentration-
dependent and reached surface densities of 40 ± 18 and 51 ± 3 ng/cm2, respectively. In
all subsequent preparations, catheter segments were incubated with 10 µM CTI or
ovalbumin for 24 h. There was no significant change in the surface density of
125
I-CTI
immobilized on the catheter surface when the catheters were washed with 2% SDS, a
finding consistent with the covalent attachment of the CTI conjugate to the catheter
surface.
6.4.2 XPS analysis
The extent of surface modification was assessed by determining the surface
elemental composition using XPS. Low resolution XPS data for the stages of catheter
modification are shown in Table 6.1. The unmodified catheter surface consisted of 59.3,
27.1, 2.2, and 11.4% carbon, fluorine, nitrogen, and oxygen, respectively. The presence
of carbon, oxygen, and nitrogen is consistent with the ether and amide groups in the
157
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
polyether block amide polymer of the catheter, whereas fluorine is derived from the
tetrafluoroethylene component (Wang et al., 2000). Basecoat-modified catheters revealed
a higher percentage of carbon and oxygen and less fluorine and nitrogen compared with
unmodified catheters, confirming successful modification with the methacrylate basecoat
polymer. Additional differences were observed upon immobilization of PEG spacer and
CTI or ovalbumin. Compared with catheters with only the basecoat, the carbon and
oxygen contents were significantly higher on PEG, ovalbumin, and CTI coated catheters.
The increase in the oxygen content of PEG-modified segments is consistent with results
reported for other PEG-grafted surfaces (Archambault and Brash, 2004; Chen et al.,
2005c). The nitrogen content was significantly higher on ovalbumin and CTI coated
catheters compared with those containing only the PEG spacer.
This increase is
consistent with incorporation of protein on the catheter surface (Sousa et al., 2004). Thus,
the XPS data confirm modification of the catheter surfaces by PEG and the protein-PEG
conjugates.
158
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Catheter Type
Element
Unmodified Basecoat
PEG
Ovalbumin
CTI
(% of total)
Carbon
59.3 ± 2.8
60.1 ± 3.9
66.8 ± 3.7
67.7 ± 2.8
66.1 ± 2.9
Fluorine
27.1 ± 3.2
17.6 ± 7.9
6.2 ± 1.8*
2.3 ± 0.7*,†
3.6 ± 1.3*,†
Nitrogen
2.2 ± 0.2
1.8 ± 0.6
1.5 ± 0.6*
4.9 ± 0.5†
3.0 ± 0.1†
Oxygen
11.4 ± 0.6
20.5 ± 3.7
25.6 ± 1.0*
25.0 ± 1.1*
27.4 ± 1.0*
Table 6.1. X-ray photoelectron spectroscopy (XPS) analysis of unmodified or
modified PCI catheter surfaces. Values are expressed as a percentage of the total of the
four elements for each surface. The values represent the mean ± SD of at least 3
determinations. * denote p < 0.05 compared with basecoat catheter segments, whereas †
denote p < 0.05 compared with PEG modified catheters.
159
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
6.4.3 Water contact angle
As expected with a hydrophobic surface (Vogler, 1999), unmodified catheters exhibited
high advancing and receding water contact angles of 88.8 ± 4.2 and 79.0 ± 3.8°,
respectively (Figure 6.1). Addition of the methacrylate basecoat had little effect on
advancing or receding angles. Consistent with its hydrophilic properties, addition of the
PEG spacer decreased the advancing and receding water contact angles to 78.7 ± 5.9 and
70.4 ± 5.7, respectively (p < 0.001 compared with the unmodified surface). Likewise,
compared with unmodified catheters, modification with ovalbumin or CTI also produced
a statistically significant (p < 0.001) decrease in advancing and receding water contact
angles to 73.6 ± 4.9 and 63.4 ± 4.9, and to 77.5 ± 5.4 and 67.9 ± 5.0°, respectively.
Similar decreases in advancing and receding water contact angles were observed after
PEG or CTI immobilization on gold surfaces (Alibeik et al., 2011), and the reduction in
surface hydrophobicity after immobilization of ovalbumin is consistent with previous
findings for albumin-coated surfaces (Kang et al., 1993; de Queiroz et al., 1997; Vogler et
al., 1995a).
160
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 6.1: Advancing and receding water contact angles with unmodified or
modified PCI catheters. Advancing (black) and receding (white) water contact angles
were determined using a sessile drop method with water droplets of 0.01 ml. The bars
represent the mean of at least 6 separate determinations, while the lines above the bars
reflect the SD. Asterisks denote p < 0.05 compared with unmodified catheters.
161
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
6.4.4 Adsorption of 125I-fXII or 125I-fibrinogen to catheters in plasma
The effect of surface modification on protein adsorption was examined in plasma
containing
125
I-labeled fXII or fibrinogen. These proteins were chosen because they
represent important factors in the contact and common pathways of coagulation,
respectively. Unmodified catheters adsorbed 125I-fXII or 125I-fibrinogen from plasma with
surface densities of 3.3 and 64.5 ng/cm2, respectively (Figure 6.2). In contrast, on the
PEG, ovalbumin, and CTI coated catheters, surface densities of only 1.7, 2.1, and 1.8
ng/cm2 of fXII and 36.0, 29.9, and 32.2 ng/cm2 of fibrinogen were found, respectively.
Therefore, PEG-modification significantly (p < 0.05) reduced 125I-fXII and 125I-fibrinogen
adsorption compared with unmodified catheters, consistent with what was found when
PEG or CTI was immobilized on gold surfaces (Alibeik et al., 2011). These results
reveal that unmodified catheters adsorb fXII and fibrinogen from plasma, and that such
adsorption is attenuated by about 50% after surface modification with PEG, consistent
with the reduction in hydrophobicity. Taken together, the protein repellant activity of
PEG was maintained after immobilization of CTI or ovalbumin onto catheter surfaces.
162
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
163
Ph.D. Thesis – J. Yau
Figure 6.2: Adsorption of
PCI catheters in plasma.
McMaster University – Biomedical Engineering
125I-fXII
or
125I-fibrinogen
onto unmodified or modified
After incubating catheters for 3 h at 23°C in plasma
supplemented with (A) 1.5 µg/ml
125
I-fXII, or (B) 150 µg/ml
125
I-fibrinogen (125I-Fg),
catheters were washed and counted for radioactivity to determine the surface density of
adsorbed protein. The bars represent the mean of at least 3 determinations, while the
lines above the bars reflect the SD. Asterisks reflect p < 0.05 compared with unmodified.
164
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
6.4.5 Effect of surface modification on fXIIa binding
To determine whether CTI immobilized on the catheter surface retains its capacity to bind
fXIIa, unmodified or modified catheters were incubated with 2.4 µg of fXIIa for 1 h and
residual fXIIa chromogenic activity in the buffer was used as an index of bound fXIIa.
CTI-coated catheters bound fXIIa with a surface density of 1.0 ± 0.3 µg/cm2; a significant
(p < 0.05) 10-, 2.6-, and 5-fold increase in fXIIa density compared with that bound to
unmodified, PEG-, or ovalbumin-coated catheters (0.1 ± 0.1, 0.39 ± 0.09, and 0.2 ± 0.1
µg/cm2, respectively), and 3-fold higher than the surface density of fXIIa that bound to
CTI-modified gold surfaces (0.32 µg/cm2) (Alibeik et al., 2011). Increased fXIIa binding
to CTI coated catheters is consistent with the ability of this inhibitor to interact
specifically with fXIIa. When corrected for the amount of fXIIa bound to PEG-coated
catheters, the molar ratio of fXIIa bound to the immobilized CTI was 1:1, suggesting that
immobilized CTI retains its capacity to bind fXIIa.
6.4.6 Effect of surface modification on the activity of fXIIa generated in situ
To investigate the influence of catheter modification on fXII autoactivation, unmodified
or modified catheter segments were incubated with 80 µg/ml fXII for 3 h and subsequent
fXIIa activity was quantified by chromogenic assay. In the absence of catheters, 0.23 ±
0.03 µg/ml of fXII was activated (Figure 6.3). With unmodified catheters, fXIIa activity
increased 6-fold to 1.30 ± 0.08 µg/ml, consistent with the procoagulant properties of the
165
Ph.D. Thesis – J. Yau
catheter.
McMaster University – Biomedical Engineering
In contrast, fXIIa activity with PEG- or ovalbumin-coated catheters was
significantly (p < 0.001) reduced by 75 and 80% (to 0.32 ± 0.05 and 0.26 ± 0.05 µg/ml
fXIIa, respectively). The findings suggest that PEG immobilization alone reduces fXII
autoactivation. With CTI-coated catheters, fXIIa activity was reduced by 98% to 0.03 ±
0.03 µg/ml, a value not only significantly (p < 0.005) lower than that measured in the
presence of PEG- or ovalbumin-coated catheters, but also significantly (p < 0.001) lower
than that determined in the absence of catheters. These results confirm that immobilized
CTI is functional and demonstrate its capacity to attenuate catheter-induced fXIIa activity
is greater than that of immobilized PEG alone; a finding similar to what was observed
with gold surfaces (Alibeik et al., 2011).
166
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 6.3: Activity of fXIIa generated in situ in the presence of unmodified or
modified PCI catheters. Two 2-cm catheter segments of the types indicated were
incubated with 80 µg/ml fXII for 3 h at 23°C. Aliquots from the solution were removed
and residual fXIIa activity was quantified using a chromogenic assay. The bars represent
the mean of at least 3 experiments, while the lines above the bars reflect the SD.
Asterisks indicate p < 0.001 compared with unmodified.
167
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
6.4.7 Effect of surface modification on fXI activation
To assess the impact of reduced fXIIa generation on the propagation of coagulation, we
used a two-stage assay to examine the effect of surface modifications on fXI activation by
newly formed fXIIa. Unmodified or modified catheters were first pre-incubated with
fXII. After washing, the catheters were then incubated with fXI, and fXIa generation was
quantified using a fluorogenic assay. Unmodified catheters generated 17 pg/ml of fXIa
(Figure 6.4). Compared with unmodified catheters, fXIa generation was reduced by 55%
with catheters coated with PEG alone (p < 0.05) and by 78% with ovalbumin-coated
catheters (p < 0.001). FXIa generation with CTI-coated catheters was reduced by 92%
with CTI-coated catheters to a level significantly lower than that with unmodified
catheters (p < 0.001) and PEG- or ovalbumin-coated catheters (p < 0.005).
Thus,
immobilization of CTI on the catheter surface attenuates catheter-induced fXIa generation
by surface-activated fXII.
168
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 6.4: Effect of surface modification on fXIIa-mediated activation of fXI. After
incubating two 2-cm catheter segments with 30 µg/ml fXII for 30 min, the segments were
washed and then incubated with 5 µg/ml fXI for an additional 30 min. Aliquots were
removed and fXIa generation was quantified using a fluorogenic assay. As a control,
unmodified catheters were incubated in buffer in the absence of fXII (no fXII). As an
additional control, fXII was incubated in buffer in the absence of catheters (no catheter).
The bars represent the mean of at least 3 determinations, while the lines above the bars
reflect the SD. Asterisks reflect p < 0.001 compared with unmodified.
169
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
6.4.8 Effect of surface modification on the in vitro prothrombotic activity of catheters
Unmodified catheters promoted clotting of recalcified citrated plasma as evidenced by a
statistically significant (p < 0.05) reduction in the clotting time from 1380 ± 257 to 580 ±
109 s (Figure 6.5). Compared with unmodified catheters, ovalbumin-coated catheters
significantly (p < 0.05) prolonged the clotting time by 1.6-fold, whereas PEG-coated
catheters had no significant effect.
In contrast, CTI-coated catheters prolonged the
clotting time by 3.5-fold; yielding clotting times significantly (p < 0.05) longer than those
obtained in the absence of catheters or in the presence of ovalbumin-coated catheters (p <
0.05). CTI-coated catheters prolonged the clotting time to a greater extent than CTI
immobilized on gold or polyurethane surfaces (Alibeik et al., 2011; Alibeik et al., 2012b;
Alibeik et al., 2012a), likely reflecting the greater activity of catheter-bound CTI as
evidenced by enhanced fXIIa binding. Thus, like the findings with model surfaces,
immobilization of CTI on the catheter surface markedly attenuates their prothrombotic
activity.
170
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 6.5: Plasma clotting times in the absence or presence of unmodified or
modified PCI catheters. Plasma was incubated at 37°C in the absence or presence of
two catheter segments of the indicated type. After 15 min, the plasma samples were
transferred to a multi-well plate and CaCl2 was added to 25 mM. Absorbance was
measured and clotting time was determined as the time to reach half maximal absorbance.
The bars represent the mean of at least 3 determinations, while the lines above the bars
reflect the SD. Asterisks denote p < 0.05 compared with unmodified.
171
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
6.4.9 Effect of fondaparinux on the prothrombotic activity of catheters in vitro
Building on our previous observation that fondaparinux has minimal effect on the
prothrombotic activity of unmodified catheters in vitro (Yau et al., 2011), we next sought
to determine whether the same is true with CTI-coated catheters. Consistent with our
previous findings, fondaparinux had minimal activity, prolonging clotting times of control
catheters by a maximum of 2.5-fold at a concentration of 3 anti-fXa U/ml (Figure 6.6). In
contrast, fondaparinux significantly (p < 0.001) prolonged the clotting times with CTIcoated catheters, where no clotting was observed for up to 4 h with fondaparinux
concentrations above 0.6 anti-fXa U/ml. Fondaparinux also significantly (p < 0.001)
prolonged the clotting time with ovalbumin-coated catheters, but only inhibited clotting at
a concentration of 1.2 anti-fXa U/ml or higher. These results suggest that catheter surface
modification augments fondaparinux activity and that immobilized CTI is most effective.
172
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 6.6: Effect of fondaparinux on the procoagulant activity of unmodified or
modified PCI catheters.
Two unmodified (circles), PEG modified (triangles),
ovalbumin modified (squares), or CTI modified (diamonds) catheter segments were
incubated in 0.1 ml human plasma containing varying concentrations of fondaparinux for
15 min at 37°C. Aliquots of plasma were removed and clotting was initiated by addition
of CaCl2 to 25 mM. Absorbance was monitored up to a maximum of 10000 s and clotting
was determined as the time to reach half maximum absorbance. The symbols represent
the mean of at least 3 separate experiments, while the lines above and below the symbols
reflect the SD.
173
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
6.4.10 Effect of surface modifications on the prothrombotic activity of PU catheters in
rabbits
A rabbit model of accelerated catheter thrombosis was used to determine whether our in
vitro findings also apply in vivo. PU catheters were used in this model because PCI
catheters lack the flexibility to maneuver the anatomy of the rabbit venous system. Like
PCI catheters, PU catheters also are prothrombotic in vitro and shorten the plasma
clotting time 2-fold (from 147.5 ± 3.5 to 78.5 ± 13.4 min; p < 0.05). As illustrated in
Figure 6.7, the time to occlusion of unmodified catheters in vivo was similar to that of
PEG- or ovalbumin-coated catheters (50.8 ± 7.6, 52.0 ± 14.8 and 46.6 ± 13.5 min,
respectively). In contrast, the time to occlusion of CTI-coated catheters was significantly
(p < 0.05) prolonged by 2.5-fold to 126.2 ± 12.9 min. To exclude the possibility that
extension of the time to occlusion was the result of leaching of CTI from the catheter
surface, coagulation assays were performed on blood samples taken before catheter
implantation and again before the termination of the study. Neither the activated partial
thromboplastin time nor the prothrombin time changed after catheter insertion (26 ± 3 and
24 ± 2 s, respectively and14 ± 2 and 14 ± 3 s, respectively), making it unlikely that there
was systemic leaching of CTI. Thus, immobilization of CTI on the PU catheter surface
attenuates their prothrombotic activity in vivo as well as in vitro. In contrast, even though
coating with PEG or ovalbumin attenuates the prothrombotic activity of catheters in vitro,
these modifications have minimal effects in vivo.
174
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Next, we examined the effect of an intravenous bolus of 70 anti-fXa U/kg
fondaparinux on the time to occlusion of unmodified, ovalbumin-coated or CTI-coated
catheters. Fondaparinux had no significant effect on the time to occlusion of unmodified
or ovalbumin-coated PU catheters (Figure 6.8).
In contrast, compared with saline,
fondaparinux significantly (p < 0.05) prolonged the time to occlusion of CTI-coated
catheters by 4.2-fold, which represents a 1.7-fold prolongation (p < 0.05) over that
achieved with CTI catheters alone. Thus, in the presence of CTI catheters, fondaparinux
exhibits antithrombotic activity.
175
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 6.7: Time to occlusion of unmodified or modified PU catheters in rabbits.
The distal 7 cm portions of the catheters were inserted into the right atrium via the right
jugular vein. A 3 ml syringe was attached to the proximal end of the catheters and blood
was withdrawn every 5 minutes, held for 2 minutes, and slowly re-injected. When blood
could no longer be withdrawn, the experiment was terminated, and occlusion times were
recorded. The catheter type is noted below each bar. The bars represent the mean of at
least 5 determinations, while the lines above the bars reflect the SD. Asterisk denotes p <
0.05 compared with unmodified.
176
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 6.8: Effect of systemic fondaparinux on the time to occlusion of unmodified
or CTI-coated PU catheters in rabbits. Rabbits were given an intravenous injection of
saline or 70 anti-fXa U/kg fondaparinux prior to insertion of unmodified or CTI-coated
catheters into the right jugular veins and the times to catheter occlusion were determined
as described in the legend to Figure 7. The bars represent the mean of at least 5
determinations, while the lines above the bars reflect the SD. Asterisk denotes p < 0.05
compared with unmodified.
177
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
6.5 Discussion
Catheters are prothrombotic, which can lead to catheter thrombosis unless potent
anticoagulants are administered. The purpose of our study was to modify the surface of
catheters so as to render them less thrombogenic in an attempt to minimize or obviate the
need for systemic anticoagulant therapy to prevent catheter thrombosis. Previously, we
demonstrated that catheters initiate clotting by activating fXII and that CTI prolongs the
catheter-induced plasma clotting time in a concentration-dependent fashion (Yau et al.,
2011). Based on these observations, we first examined the effect of CTI immobilization
on model surfaces. When attached via a PEG spacer, immobilized CTI reduced
adsorption of fibrinogen and fXII and attenuated procoagulant activity (Yau et al., 2009;
Alibeik et al., 2011; Alibeik et al., 2012a; Alibeik et al., 2012b). In this study, we set out
to determine whether similar results could be obtained with CTI immobilization on
catheters and whether reduced in vitro prothrombotic activity would translate into
attenuated catheter thrombosis in rabbits.
Compared with unmodified catheter segments, CTI-coated catheters exhibited a
43-fold reduction in fXIIa activity after catheter-induced autoactivation and a 13-fold
decrease in fXIIa-mediated fXI activation, consistent with the concept that immobilized
CTI attenuates catheter-induced contact activation.
In addition, coating with CTI
significantly attenuated the procoagulant activity of catheters in plasma. This reflects the
specificity of CTI to inhibit fXIIa and attenuate fXIIa-mediated clotting, since PEG and
ovalbumin coatings failed to attenuate clotting to the same extent.
178
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Building on our in vitro data, we then used a rabbit model of accelerated catheter
thrombosis to determine whether these findings also apply in vivo. This model has been
successfully used to demonstrate the efficacy of various anticoagulants and
antithrombotic coatings to abrogate catheter-induced clotting (Du et al., 2005; Yau et al.,
2011). Compared with unmodified or ovalbumin-coated catheters, the time to occlusion
of CTI-coated catheters was prolonged 2.5-fold.
This result suggests that the
prothrombotic activity of catheters can be attenuated by a CTI coating. These findings
also confirm our in vitro data that CTI coating endows catheters with antithrombotic
properties and identify fXIIa as a viable target for strategies to prevent catheter-induced
clotting.
Previous attempts at rendering blood-contacting surfaces non-thrombogenic have
included approaches aimed at (a) reducing protein adsorption with agents such as PEG,
polyethylene oxide, or albumin, (b) inhibiting platelet activation by coating surfaces with
apyrase, (c) attenuating surface-induced clotting by coating with various anticoagulants,
or (d) enhancing fibrinolysis by immobilizing lysine to promote the binding of
plasminogen and/or tissue plasminogen activator (Chen et al., 2005b; Chen et al., 2005c;
Chen et al., 2009; Nilsson et al., 2010). In our studies, we used a combination of PEG
and CTI, which were immobilized onto a basecoat catheter surface.
The basecoat
provides a linking surface that ensures mechanical stability. Like other investigators, we
demonstrate that PEG coating decreases hydrophobicity and reduces surface adsorption of
fibrinogen and fXII (Chen et al., 2005c; Chen et al., 2005a). Although we observed no
179
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
additional reduction in protein adsorption when catheters were coated with ovalbumin or
CTI, catheters with the various coatings exhibited disparate procoagulant effects in the in
vitro clotting assay. However, only CTI-coating prolonged the catheter clotting time
beyond the baseline value in the in vitro assay and extended the occlusion time of
catheters in vivo. Our observation that neither PEG nor ovalbumin coating had any effect
on the time to catheter occlusion in the rabbit model is consistent with previous work,
which demonstrated no reduction in device-related thrombosis with polyethylene oxide or
albumin coating (Park et al., 2000; Marois et al., 1996). Taken together, our findings
highlight the limitations of in vitro assays to evaluate those surface modifications that
attenuate the thrombogenic properties of blood-contacting devices in vivo.
Previous work with anticoagulants has focused on immobilizing agents such as
heparin,
covalent
heparin-antithrombin
complexes,
hirudin
or
D-Phe-Pro-Arg
chloromethylketone, which mainly target fXa and/or thrombin, downstream enzymes in
the coagulation pathway (Alibeik et al., 2010; Du et al., 2005; Maitz et al., 2010).
Although heparin also accelerates the rate of fXIIa inhibition by antithrombin, the
heparin-catalyzed rates of fXa and thrombin inhibition by antithrombin are 4000- and
28,300-fold faster than that of fXIIa, respectively (Colman et al., 1989). In plasma
systems, C1-inhibitor is a more important regulator of fXIIa than antithrombin (Colman
et al., 1989). We have taken a different approach and have used immobilized CTI to
target fXIIa. Our observation that CTI coating attenuates the prothrombotic properties of
catheters in vitro and in vivo supports the concept that fXIIa is the root cause of device180
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
related thrombosis and identifies CTI as an attractive candidate to attenuate this
phenomenon (Vogler and Siedlecki, 2009; Yau et al., 2011). In addition, we show
synergy between CTI-coated catheters and fondaparinux in vitro and in vivo. Thus,
fondaparinux had little effect on catheter-induced clotting times with unmodified
catheters, even at concentrations that far exceed therapeutic levels. In contrast, with CTIcoated catheters, therapeutic levels of fondaparinux prolonged the clotting time beyond
that of CTI-coated catheters or fondaparinux alone.
Likewise, in the rabbit model,
systemic fondaparinux failed to alter the occlusion time of unmodified catheters, whereas,
with CTI-coated catheters, systemic fondaparinux prolonged the time to occlusion. The
synergy between CTI-coated catheters and fondaparinux probably reflects the fact that
CTI and fondaparinux block distinct steps in the coagulation pathway; by inhibiting
fXIIa, CTI attenuates the initiation of clotting, whereas by targeting fXa, fondaparinux
prevents thrombin generation.
CTI-coated catheters have potential advantages over unmodified catheters in the
clinical setting. First, the observation that CTI-coating prolongs the catheter clotting time
beyond the baseline value in the in vitro assay and extends the occlusion time of catheters
in vivo raises the possibility that the use of CTI-coated catheters may obviate or reduce
the need for systemic anticoagulants, such as heparin, to prevent catheter thrombosis in
patients undergoing PCI. Eliminating the need for adjunctive heparin, or facilitating the
use of lower-dose heparin regimens, has the potential to reduce the risk of bleeding.
Second, the synergy between CTI-coated catheters and fondaparinux raises the possibility
181
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
that the use of CTI-coated catheters may reduce or eliminate the risk of catheter
thrombosis in fondaparinux-treated patients to the point where supplemental heparin is no
longer required. This would be advantageous because it would not only lower the risk of
bleeding, but might also render fondaparinux of benefit in urgent PCI; a possibility that
deserves further investigation. Finally, the beneficial effect of coating catheters with CTI
suggests that the same method could reduce the prothrombotic potential of other bloodcontacting devices, such as vascular stents, mechanical heart valves or membrane
oxygenators.
182
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Chapter 7: General Discussion
Thrombotic events are a major complication associated with blood-contacting
medical devices. For example, patients with a central venous catheter (CVC) are prone to
catheter-associated upper extremity deep vein thrombosis (DVT) and subsequent
pulmonary embolism (PE) (Lee and Kamphuisen, 2012).
Similarly, patients with a
coronary catheter are susceptible to catheter thrombosis (Chan et al., 2009). Thrombosis
in these patients can be exacerbated when coupled with independent risk factors, such as
cancer and acute coronary syndrome (ACS), respectively. While anticoagulant drugs are
the mainstay treatment for the prevention of arterial and venous thrombosis, they are less
effective for prevention of device-associated thrombosis. For example, fondaparinux, a
fXa-specific inhibitor, is associated with a lower risk of bleeding than enoxaparin, a lowmolecular-weight-heparin (LMWH), and heparin in patients with unstable angina or nonST-elevation myocardial infarction (MI), but fondaparinux-treated patients undergoing
percutaneous coronary intervention (PCI) are susceptible to catheter thrombosis (Yusuf et
al., 2006b).
Similarly, dabigatran, a thrombin-specific inhibitor, is effective for
prevention of stroke and systemic embolism in patients with atrial fibrillation or for
prevention of venous thromboembolism (Connolly et al., 2009; Schulman et al., 2009;
Schulman et al., 2013a). Yet, when compared with warfarin, dabigatran is associated
with a trend for more strokes in patients with mechanical heart valves (Eikelboom et al.,
2013). Taken together, medical devices can induce coagulation, and inhibition of fXa and
183
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
thrombin alone is insufficient to prevent device-associated thrombosis. Therefore, novel
approaches are needed for the prevention of device-associated thrombosis.
Our studies are undertaken to understand the mechanism of device-associated
thrombosis, and develop strategies for its prevention.
coagulation?
How do devices trigger
The blood coagulation cascade is triggered by the tissue factor (TF)
pathway or the contact pathway via factor (f) VII or fXII activation, respectively, which
culminate in the generation of fXa and thrombin. Earlier studies have focused on the
presence of TF-bearing monocytes on polyvinylchloride surfaces in whole blood (Hong et
al., 1999), suggesting a possible role of the TF pathway in device-associated thrombosis.
Based on this observation, the TF pathway is cited as the main contributor to deviceassociated thrombosis, down-playing the contribution of the contact pathway. Our results
challenge this concept and provide evidence that the contact pathway plays a major role
in device-associated thrombosis.
The goals of this project are to (1) investigate the mechanism by which catheters
trigger coagulation, (2) compare the effect of multi-targeted anticoagulants and singletarget anticoagulants on catheter-induced clotting, and (3) examine the effect of surface
modification on catheter-induced clotting. Our studies show that PCI catheters, like other
blood-contacting devices, trigger coagulation by adsorbing and activating fXII, thereby
initiating the contact pathway of coagulation. We focus on fXII because it is implicated
as the major contributor to the poor hemocompatibility of blood-contacting devices
(Vogler et al., 1995a; Vogler and Siedlecki, 2009). Furthermore, our studies also show
184
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
that fondaparinux and dabigatran do not attenuate catheter-induced clotting, except at
supra-therapeutic concentrations, an observation in line with clinical data. We speculate
that because of the multiple amplification steps that occur in the intrinsic pathway, fXa
and thrombin are generated in concentrations that exceed the capacity of anticoagulants
that target fXa or thrombin to inhibit them. Based on these observations, we suspect that
targeting the contact pathway is an alternative approach for prevention of catheter
thrombosis.
Selective knockdown of fXI and fXII using antisense oligonucleotides
(ASOs) attenuate catheter-induced thrombosis in rabbits, suggesting that targeting contact
factor components is a viable method for prevention of device-associated thrombosis.
Furthermore, we coat surfaces with corn trypsin inhibitor (CTI), a fXIIa-specific
inhibitor, attached to a polyethylene glycol (PEG) spacer and evaluate these CTI-coated
surfaces for prevention of coagulation. Our results show that CTI coated surfaces have a
greater fXIIa inhibitory effect and longer plasma clotting times than surfaces coated with
PEG alone or with a PEG-albumin conjugate. Taken together, our results support the role
of the contact pathway in catheter thrombosis, and suggest that targeting contact pathway
components using systemic knockdown and/or surface modifications may be viable
method for prevention of catheter thrombosis.
7.1 Contribution of the contact and TF pathway on catheter-induced clotting
In the classic model of blood coagulation, clotting is initiated via two distinct
pathways: the TF or extrinsic pathway and the contact or intrinsic pathway, which
185
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
induces clotting via fVII and fXII activation, respectively. While the extrinsic pathway is
essential for hemostasis, its role in device-associated thrombosis has not been fully
understood.
Two lines of evidence point to a role for the extrinsic pathway as an initiator of
device-associated thrombosis.
First, while polyvinlychloride surfaces demonstrate
negligible thrombin-antithrombin formation in platelet-poor and platelet-rich plasma,
significant thrombin-antithrombin formation occurs in whole blood - a medium
containing leukocytes, specifically tissue factor-bearing monocytes (Hong et al., 1999).
Second, markers of activation, such as L-selectin, CD11b, and TF, are up-regulated on
leukocytes in patients following angioplasty, hemodialysis, and cardiopulmonary bypass.
Based on these observations, the extrinsic pathway has been identified as the primary
initiator of device-associated thrombosis (Gorbet and Sefton, 2004; Chan et al., 2009).
As shown in Chapters 3 and 4, our studies challenge the contribution of the
extrinsic pathway to catheter-associated thrombosis. Three lines of evidence support the
concept that the prothrombotic activity of catheters reflects their capacity to activate the
contact pathway of coagulation. First, catheter-induced clotting is abolished in plasma
deficient in fXII or fXI, key components of the contact pathway. Second, the addition of
CTI, a specific fXIIa inhibitor, attenuates the prothrombotic properties of catheter
segments, consistent with the observation that blood-contacting medical devices adsorb
and activate fXII (Vogler and Siedlecki, 2009). Lastly, we show that knockdown of fXI
or fXII using ASOs prolongs the time to catheter occlusion, whereas fVII knockdown
186
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
does not, nor does concomitant knockdown of fVII and fXI extend the time to catheter
occlusion beyond that produced by fXI knockdown alone. While the small amount of
circulating fVII that remains after fVII knockdown in rabbits may be sufficient to trigger
the extrinsic pathway, it may not explain why fVII knockdown has no effect on the time
to catheter occlusion. Consistent with our results in rabbits, we demonstrate that catheterinduced clotting is attenuated in plasma deficient in fXI or fXII, but not in plasma
deficient in fVII. These results are consistent with observations seen in clinical trials. In
a phase II study in patients with ACS, there was more catheter thrombosis with nematode
anticoagulant protein (NAP) c2, a potent inhibitor of fVIIa, than with heparin (Giugliano
et al., 2007); a finding that suggests that extrinsic pathway inhibition fails to prevent
catheter thrombosis. Taken together, these findings suggest that catheter thrombosis is
driven by the contact pathway and that the extrinsic pathway plays a minor part in this
process.
7.2 Comparison of the effect of single-target and multi-target anticoagulants on
catheter-induced clotting
7.2.1 Effect of thrombin inhibition on catheter-induced clotting
Thrombin has been a long standing target of anticoagulant drugs because of its
role in clotting and feedback.
Although heparin and LMWH are effective against
thrombin, they have limitations, including the risk of bleeding and thrombocytopenia. As
an alternative, thrombin specific inhibitors have shown promise. Bivalirudin, an analog
187
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
of hirudin, is a thrombin inhibitor that when given with antiplatelet therapy, demonstrates
similar efficacy to heparin for reduction in mortality, MI, urgent revascularization, and
severe bleeding in patients undergoing PCI (Lincoff et al., 2003; Kastrati et al., 2008).
However, bivalirudin alone is associated with increased acute stent thrombosis compared
with heparin and concomitant antiplatelet therapy (Stone et al., 2008).
Similarly,
dabigatran etexilate is an oral thrombin inhibitor that has been shown to be effective for
the prevention of stroke in patients with atrial fibrillation (Connolly et al., 2009), and
treatment of acute venous thromboembolism (Schulman et al., 2009; Schulman et al.,
2013a). Yet, dabigatran is not effective for prevention of thrombotic events in patients
with mechanical heart valves (Eikelboom et al., 2013). Taken together, these findings
suggest that thrombin inhibition alone is insufficient to prevent device-associated
thrombosis.
Our results show that dabigatran is effective at peak concentrations but loses
efficacy at trough levels or given with supplemental fondaparinux or heparin,
respectively. The limited capacity of dabigatran to attenuate catheter-induced thrombin
generation or to prolong the time to catheter occlusion is consistent with our hypothesis
that the concentration of thrombin generated on the surface of the catheters can readily
exceed that of dabigatran, which inhibits thrombin in a 1:1 stoichiometric fashion
(Hankey and Eikelboom, 2011). There are two reasons why heparin may be more
effective than dabigatran in this setting. First, because it activates antithrombin in a
catalytic fashion, heparin can inhibit high concentrations of thrombin and fXa. Second, in
188
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
addition to inhibiting thrombin and fXa, heparin also promotes inhibition of factors XIIa,
XIa, and IXa.
7.2.2 Effect of factor Xa inhibition on catheter-induced clotting
FXa, which is located at the junction of the intrinsic and tissue factor pathways,
has been an alternative target to thrombin for prevention of thrombosis.
While
fondaparinux is an alternative to enoxaparin for treatment of patients with non-STsegment elevation acute coronary syndromes, the potential for catheter thrombosis in
fondaparinux-treated patients who require PCI has dampened the enthusiasm for the use
of this drug in patients who are managed invasively.
Unlike heparin, fondaparinux does not inhibit catheter-induced clotting in vitro
and in vivo, even at concentrations that far exceed those used clinically. Similar to
heparin, enoxaparin inhibited catheter-induced clotting in vitro in a concentrationdependent fashion (Figure 3.3), but its effect was intermediate between that of heparin
and fondaparinux both in vitro and in vivo.
Since the peak anti-Xa levels for
fondaparinux, enoxaparin, and heparin were the same (Figure 7.1) and fondaparinux and
LMWH have longer half-lives than heparin (Samama and Gerotziafas, 2003), the
disparate effects of all three anticoagulants in the rabbit model are unlikely to be the
result of differences in the anti-Xa activities or half-lives of these agents. Our results with
fondaparinux are in agreement with the results of a previous study, wherein clotting
occurred in catheters perfused with blood from fondaparinux-treated volunteers, but not
189
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
in catheters perfused with blood from heparin-treated subjects (Schlitt et al., 2008). The
intermediate effect of enoxaparin in our studies is consistent with the results of the
OASIS-5 trial (Yusuf et al., 2006a), which demonstrated catheter thrombosis in
enoxaparin-treated patients, albeit at a lower rate than that observed in patients given
fondaparinux, suggesting that enoxaparin does not eliminate this complication.
Prevention of catheter thrombosis with enoxaparin requires an adequate dose of the drug.
Because catheter thrombosis has been reported despite subcutaneous enoxaparin doses of
50 anti-Xa U/kg (Buller et al., 2006; Chen et al., 2009), most patients who are undergoing
PCI are given intravenous enoxaparin at doses ranging from 75 to 100 anti-Xa U/kg.
190
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 7.1: Effect of fondaparinux, enoxaparin, and heparin on the anti-Xa levels of
rabbits. Rabbits (n = 5 per group) were given an intravenous bolus of 70 anti-Xa U/kg
fondaparinux (●), enoxaparin (▼), or heparin (■) prior to insertion of a PU catheter into
their jugular veins. 2 ml of blood were taken at specified times and plasma anti-Xa levels
were determined using a chromogenic assay. The symbols represent the mean and the
lines above the symbols reflect the standard deviation.
191
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
7.2.3 Effect of supplemental upstream inhibition on catheter-induced clotting
Building on our observations that dabigatran and fondaparinux have limited
inhibitory activity against proteases in the contact pathway, and is ineffective at
preventing catheter-induced clotting, we examined whether the addition of agents, such as
heparin, that target multiple enzymes including components of the contact pathway would
render dabigatran and fondaparinux effective against catheter-induced clotting.
When low-dose heparin is co-administered with low-dose dabigatran, the time to
catheter occlusion is prolonged, whereas neither agent has an effect on its own; a finding
consistent with synergy between the two agents. This finding is supported by the results
of a small randomized trial that compared pre-procedural oral dabigatran (in doses of 110
or 150 mg twice-daily) with conventional intra-procedural intravenous heparin in patients
undergoing elective PCI (Vranckx et al., 2013). Plasma levels of prothrombin fragment
1+2 and thrombin-antithrombin complexes, markers of activation of coagulation, were
higher in patients given dabigatran than in those randomized to heparin (Vranckx et al.,
2013); findings consistent with our in vitro data that dabigatran is less effective than
heparin at inhibiting catheter-induced thrombin generation. In contrast to dabigatran,
which only targets thrombin, heparin not only inhibits fXa and thrombin, but also
attenuates thrombin generation, thereby decreasing the concentration of thrombin that
requires inhibition by dabigatran. Therefore, their complementary mechanism of action
likely explains the more than additive effects of dabigatran and heparin when used in
combination.
192
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Similar to dabigatran, addition of a low dose of heparin to fondaparinux inhibited
the prothrombotic activity of catheters both in vitro and in vivo, an observation seen in
clinical trials wherein catheter thrombosis was attenuated in fondaparinux-treated patients
undergoing PCI and given adjunctive heparin. This reflects, at least in part, the capacity
of heparin to inhibit thrombin because addition of bivalirudin, a specific thrombin
inhibitor, with fondaparinux also attenuated the prothrombotic activity of catheters in
plasma. In addition, however, heparin also inhibits contact pathway coagulation enzymes
upstream of fXa, thereby attenuating fXa generation.
Supporting the concept that
attenuation of fXa generation through upstream inhibition contributes to the capacity of
low dose heparin to promote the activity of fondaparinux is the observation that
combining CTI with fondaparinux also inhibited catheter-induced clotting in plasma.
These findings raise the possibility that targeted inhibition of fXIIa or thrombin with CTI
or bivalirudin, respectively, or adjunctive therapy with these agents or low dose heparin
may prevent catheter thrombosis in fondaparinux-treated patients. Whether direct factor
Xa inhibitors prevent catheter thrombosis or thrombosis induced by other bloodcontacting medical devices to a greater extent than fondaparinux is unknown. However,
the observation that compared with placebo, rivaroxaban reduced the risk of stent
thrombosis when added to dual antiplatelet therapy in patients with stabilized acute
coronary syndrome (Mega et al., 2012) certainly raises this possibility.
Upstream inhibition above the level of fXa is important because fondaparinux,
which only targets fXa in an antithrombin-dependent fashion, also failed to prolong the
193
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
time to catheter occlusion in this rabbit model. Because of the synergy, it is likely that
even low doses of heparin will be sufficient to prevent catheter thrombosis in dabigatrantreated or fondaparinux-treated patients undergoing PCI.
7.3 Targeting the contact pathway of coagulation
Most antithrombotic strategies involve targeting fXa or thrombin.
However,
upstream factors such as fXIIa may remain active and continuously promote coagulation,
thus overwhelming fXa and thrombin control. Targeting the contact pathway offers
potential benefits over conventional anticoagulant therapies. Although individuals with
contact protein deficiencies lack severe bleeding disorders (Saito, 1987; Pauer et al.,
2004), several studies suggested that the contact factor pathway may contribute to
thrombotic complications in murine and non-human primate models (Renne et al., 2005;
Kleinschnitz et al., 2006; Cheng et al., 2010). These studies support the essential role of
fXII in contact-mediated coagulation. Since congenital deficiency of fXII, prekallikrein
(PK), or high-molecular-weight kininogen (HK) is not associated with bleeding, targeting
these proteins might be safe alternative to the currently available antithrombotic drugs.
However, a detailed analysis on the effect of contact factor inhibition on catheter-induced
clotting is lacking. Our studies evaluate the efficacy of contact factor inhibition using
ASOs and surface modifications.
194
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
7.3.1 Effect of selective depletion of fXI and fXII using antisense oligonucleotides on
catheter-induced clotting
Recent studies using ASO technology have identified roles for fXI, fXII, and
prekallikrein in arterial and venous thrombosis in mice and non-human primates (Zhang
et al., 2010; Revenko et al., 2011; Younis et al., 2012; Crosby et al., 2013). Since ASOs
are species specific, we developed ASOs that target rabbit coagulation factors.
Consistent with previous investigations in other species, fXI- and fXII-directed ASO
treatment reduced mRNA, protein expression and procoagulant activity in a targeted
fashion. Importantly, fXI- and fXII-directed ASO treatment bestowed an antithrombotic
phenotype in rabbits, as shown by the prolongation of the time to occlusion. Therefore,
fXII, fXI, HK and fVII directed ASOs can be added to the list of effective ASOs for study
in rabbits and these can be used to examine the effect of contact factor and fVII
knockdown in models of thrombosis.
Although the delayed knockdown with ASOs limits their utility in the acute
setting, inhibitory antibodies against fXIa (Tucker et al., 2009), fXII (Matafonov et al.,
2014), and fXIIa (Larsson et al., 2014), small molecule inhibitors of fXIa (Lin et al.,
2006), inhibitory nanobodies against fXIIa (de Maat et al., 2013), and RNA aptamers
targeting fXII (Woodruff et al., 2013) offer promise for the future. The utility of these
agents for prevention and treatment of catheter thrombosis requires further investigation.
195
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
7.3.2 Effect of surface modification on catheter-induced clotting
The finding that catheters trigger coagulation via the contact pathway is consistent
with the observation that blood-contacting medical devices adsorb and activate fXII,
thereby initiating the contact pathway of coagulation. It is hypothesized that surface
modification with PEG and appropriate bioactive molecules will improve blood
compatibility. The following points indicate the thinking behind this hypothesis. First,
PEG-modified biomaterials have been studied extensively on the basis of their protein
resistant properties (Lee et al., 1995). Second, bioactive molecules have been used to
create surfaces that promote specific protein-surface interactions that are advantageous
for blood compatibility (Brash, 2000). CTI coated catheters demonstrated an attenuation
of plasma clotting in vitro.
Further experiments were carried out to assess CTI
immobilization and characterize the blood compatibility of CTI coated surfaces. CTI
coated surfaces demonstrated a reduction in fibrinogen adsorption in buffer and plasma,
increased fXIIa inhibition, and longer clotting times compared with uncoated control
surfaces. CTI coated polyurethane surfaces were resistant to protein adsorption, showed
greater inhibition of fXIIa activity, and resulted in a longer plasma clotting time
compared with unmodified polyurethane surfaces.
In a rabbit model of accelerated
catheter thrombosis, CTI coated catheters prolonged the occlusion time of venous
catheters 2.5-fold compared with unmodified catheters.
CTI coated catheters also
attenuated catheter occlusion to a greater extent than control PEG- and albumin-coated
196
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
catheters. Taken together, CTI coated surfaces have the potential to be an effective
antithrombotic surface modification.
CTI-coated catheters have potential advantages over unmodified catheters in the
clinical setting. First, the observation that CTI-coating prolongs the catheter clotting time
beyond the baseline value in the in vitro assay and extends the occlusion time of catheters
in vivo raises the possibility that the use of CTI-coated catheters may obviate or reduce
the need for systemic anticoagulants, such as heparin, to prevent catheter thrombosis in
patients undergoing PCI. Eliminating the need for adjunctive heparin, or facilitating the
use of lower-dose heparin regimens, has the potential to reduce the risk of bleeding.
Second, the synergy between CTI-coated catheters and fondaparinux raises the possibility
that the use of CTI-coated catheters may reduce or eliminate the risk of catheter
thrombosis in fondaparinux-treated patients to the point where supplemental heparin is no
longer required. This would be advantageous because it would not only lower the risk of
bleeding, but might also render fondaparinux of benefit in urgent PCI; a possibility that
deserves further investigation. Finally, the beneficial effect of coating catheters with CTI
suggests that the same method could reduce the prothrombotic potential of other bloodcontacting devices, such as vascular stents, mechanical heart valves or membrane
oxygenators.
7.4 Future Directions
In the course of this research, numerous preliminary observations were made. As
197
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
a result, there are several avenues of investigation that extend beyond the boundaries of
this thesis. This section contains a brief explanation of work conducted to-date and
outline directions for future experiments.
Elucidate the role of the contact pathway for other medical devices (ie mechanical heart
valves)
In patients with mechanical heart valves, dabigatran was less effective than
warfarin for prevention of thromboembolism. Preliminary evidence showed that warfarin
suppressed leaflet-induced thrombin generation to a greater extent than dabigatran
(unpublished observations, Dr. Iqbal Jaffer).
If valves trigger clotting via a similar
mechanism as catheters, we hypothesize that valve-induced clotting can be attenuated
with fXII-specific inhibitors.
We have preliminary evidence that leaflet-induced
thrombin generation is reduced with CTI and in fXII- and fXI-deficient plasma, but not in
fVII-deficient plasma (unpublished observations, Dr. Iqbal Jaffer).
Based on these
observations and our studies with catheters, we hypothesize that knockdown of upstream
in the contact pathway will attenuate valve thrombosis whereas knockdown of fVII will
have a minimal effect. Because thrombosis can occur on mechanical heart valves, we
will examine the effect of fXII, fXI, or fVII knockdown using ASOs on heart valve
thrombosis in a porcine aortic valve replacement model; a model that involves
implantation of the heart valve.
198
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Examining the role of cellular components in catheter-induced clotting
We have evidence that catheter surfaces trigger the blood coagulation cascade via
activation of the contact pathway.
While the cascade is responsible for thrombin
generation, circulating cells, such as platelets, provide a surface for further thrombin
generation. Future work should focus on more detailed studies of the cellular interaction
at the blood/device interface. Studies of platelet interactions with surfaces could be
conducted since platelets play a major role in clot formation. Platelet activation and
adhesion is known to occur during cardiopulmonary bypass, hemodialysis, as well as with
vascular grafts and catheters (Gorbet and Sefton, 2004). Activated platelets potentiate
coagulation by binding clotting factors and supporting the assembly of activation
complexes that enhance thrombin generation. Antiplatelet drugs, such as glycoprotein
IIb/IIIa antagonists, are commonly used in patients undergoing PCI. Likewise, tissue
factor-bearing monocytes may also contribute to catheter-induced thrombosis. Longer
time frames for blood-material exposure will provide essential information for long-term
applications. Furthermore, the host response to blood contacting devices is not limited to
thrombosis and clot formation. Other reactions such as inflammation and immunological
responses generally occur and can lead to device failure. Investigation of such responses
could be carried out for uncoated, PEG, and CTI-coated surfaces.
Durability of CTI-coated devices
As demonstrated in Chapter 6, we show that CTI-coated catheters have decreased
199
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
water contact angles, protein adsorption, and procoagulant activity compared with
unmodified catheters. Studies are needed to determine the durability of the CTI coating
after exposure to the blood. Preliminary experiments demonstrate that the aPTT and PT
values for rabbits with CTI-coated catheters are similar to rabbits with unmodified
catheters (Table 7.1), suggesting that the CTI coating is stable even in a physiological
setting.
Other types of PEG could also be studied including PEG with different
functional groups, branched PEG, and multi-arm or star PEG. In addition, different
grafting methods could also be explored as a means to achieve higher densities of PEG
and CTI.
200
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Catheter Coating
aPTT (s; mean ± SD)
PT (s; mean ± SD)
Unmodified
24 ± 2
14 ± 3
Basecoat
25 ± 2
12 ± 2
PEG
22 ± 2
13 ± 1
PEG-albumin
25 ± 3
13 ± 2
PEG-CTI
26 ± 3
14 ± 2
Table 7.1: aPTT and PT for rabbits treated with unmodified and modified catheters.
Blood was withdrawn at the end of the experiment, and plasma was isolated. aPTT and
PT assays were performed to assess plasma clotability. CTI coatings did not affect
systemic anticoagulant activity.
201
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Examine the role of dual-anticoagulant coatings
As shown in Chapter 6, we have evidence that CTI-coated catheters are less
prothrombotic than unmodified catheters in vitro and in a rabbit model of catheter
thrombosis. However, because CTI inhibits fXIIa in a stoichiometric fashion, its capacity
to block fXIIa is dependent on the amount immobilized and any fXIIa that escapes will
trigger clotting.
Consequently, we propose that combining the CTI coating and a
downstream inhibitor, such as heparin, will be superior. We have shown that compared
with unmodified catheters, CTI-coated catheters are less prothrombotic in plasma; an
effect that is enhanced when fondaparinux (Figure 6.8) or heparin (Figure 7.2) is added.
While both fondaparinux and heparin are effective, heparin has been immobilized onto a
variety of surfaces.
Because of this, we believe heparin is an ideal material for
immobilization. Based on preliminary data, we expect that dual-coating will be superior
to coating with CTI or heparin alone because it will better suppress fXIIa activity and fXI
activation on the surface and enable heparin-dependent inactivation of fXa and thrombin.
202
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Figure 7.2: Effect of systemic heparin on the time to occlusion of unmodified or CTIcoated PU catheters in rabbits. Rabbits were given an intravenous injection of saline or
50 anti-fXa U/kg heparin prior to insertion of unmodified (unmod) or CTI-coated
catheters into the external right jugular vein. The distal 7 cm portions of the catheters
were inserted into the right atrium via the right jugular vein. A 3 ml syringe was attached
to the proximal end of the catheters and blood was withdrawn every 5 minutes, held for 2
minutes, and slowly re-injected.
When blood could no longer be withdrawn, the
experiment was terminated, and occlusion times were recorded. The catheter type is
203
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
noted below each bar. The bars represent the mean of at least 5 determinations, while the
lines above the bars reflect the SD. Asterisk denotes p < 0.05 compared with unmodified.
7.5 Conclusion
Blood-contacting medical devices are prone to thrombosis at the blood/surface
interface.
Single-target anticoagulant drugs are less effective than multi-target
anticoagulant drugs for prevention of device-associated thrombosis.
Since patients
undergoing PCI experience guide catheter thrombosis despite anticoagulant therapy, we
first investigated the mechanisms by which these catheters induce coagulation. We found
that catheters are prothrombotic and shortened clotting times in normal plasma. We also
found that fXa and thrombin-directed anticoagulants have minimal effect against catheterinduced clotting, unless given at supra-therapeutic levels.
Our research reveals that
catheter-induced clotting is primarily triggered by the contact pathway whereas the TF
pathway has a minimal effect. Furthermore, selective depletion of fXI or fXII prevents
catheter-induced clotting whereas knockdown of fVII or HK has no effect. Based on
these observations, we developed a non-thrombogenic surface that targets fXIIa. This
fXIIa inhibitory coating has the potential to reduce thrombotic complications associated
with blood-contacting devices, and could lessen the need for concomitant anticoagulant
therapy, a treatment associated with increased bleeding risk. Taken together, we showed
a clear association between our in vitro and in vivo results. Overall, we demonstrate that
204
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
the contact pathway plays an important role in catheter thrombosis, and may be important
for device-associated thrombosis.
205
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Chapter 8 References
Abdelkefi,A., Ben Othman,T., Kammoun,L., Chelli,M., Romdhane,N.B., Kriaa,A.,
Ladeb,S., Torjman,L., Lakhal,A., Achour,W., Ben Hassen,A., Hsairi,M., Ladeb,F., and
Ben Abdeladhim,A. (2004). Prevention of central venous line-related thrombosis by
continuous infusion of low-dose unfractionated heparin, in patients with haematooncological disease. A randomized controlled trial. Thromb. Haemost. 92, 654-661.
al Khaffaf,H. and Charlesworth,D. (1996). Albumin-coated vascular prostheses: A fiveyear follow-up. J Vasc. Surg. 23, 686-690.
Alibeik,S., Zhu,S., and Brash,J.L. (2010). Surface modification with PEG and hirudin for
protein resistance and thrombin neutralization in blood contact. Colloids Surf. B
Biointerfaces. 81, 389-396.
Alibeik,S., Zhu,S., Yau,J.W., Weitz,J.I., and Brash,J.L. (2011). Surface modification with
polyethylene glycol-corn trypsin inhibitor conjugate to inhibit the contact factor pathway
on blood-contacting surfaces. Acta Biomater. 7, 4177-4186.
Alibeik,S., Zhu,S., Yau,J.W., Weitz,J.I., and Brash,J.L. (2012a). Dual surface
modification with PEG and corn trypsin inhibitor: Effect of PEG:CTI ratio on protein
resistance and anticoagulant properties. J. Biomed. Mater. Res. A 100, 856-862.
Alibeik,S., Zhu,S., Yau,J.W., Weitz,J.I., and Brash,J.L. (2012b). Modification of
Polyurethane with Polyethylene Glycol-Corn Trypsin Inhibitor for Inhibition of Factor
XIIa in Blood Contact. J. Biomater. Sci. Polym. Ed 23, 1981-1993.
Altieri,P., Devoto,E., Spallarossa,P., Rossettin,P., Garibaldi,S., Bertero,G., Balbi,M.,
Barsotti,A., Brunelli,C., and Ghigliotti,G. (2005). Acute coronary syndromes do not
promote prolonged in vivo FXII-dependent prothrombotic activity. Thromb. Res. 115, 6572.
Amar,J., Caranobe,C., Sie,P., and Boneu,B. (1990). Antithrombotic potencies of heparins
in relation to their antifactor Xa and antithrombin activities: an experimental study in two
models of thrombosis in the rabbit. Br. J. Haematol. 76, 94-100.
Amlani,S., Nadarajah,T., Afzal,R., Pal-Sayal,R., Eikelboom,J.W., and Natarajan,M.K.
(2010). Mortality and morbidity following a major bleed in a registry population with
acute ST elevation myocardial infarction. J. Thromb. Thrombolysis. 30, 434-440.
Anderson,J.A., Fredenburgh,J.C., Stafford,A.R., Guo,Y.S., Hirsh,J., Ghazarossian,V., and
Weitz,J.I. (2001). Hypersulfated low molecular weight heparin with reduced affinity for
206
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
antithrombin acts as an anticoagulant by inhibiting intrinsic tenase and prothrombinase. J.
Biol. Chem. 276, 9755-9761.
Andersson,J., Sanchez,J., Ekdahl,K.N., Elgue,G., Nilsson,B., and Larsson,R. (2003).
Optimal heparin surface concentration and antithrombin binding capacity as evaluated
with human non-anticoagulated blood in vitro. J. Biomed. Mater. Res. A 67, 458-466.
Archambault,J.G. and Brash,J.L. (2004). Protein resistant polyurethane surfaces by
chemical grafting of PEO: amino-terminated PEO as grafting reagent. Colloids Surf. B
Biointerfaces. 39, 9-16.
Arvidsson,S., Askendal,A., and Tengvall,P. (2007). Blood plasma contact activation on
silicon, titanium and aluminium. Biomaterials 28, 1346-1354.
Baetz,B.E. and Spinler,S.A. (2008). Dabigatran etexilate: an oral direct thrombin inhibitor
for prophylaxis and treatment of thromboembolic diseases. Pharmacotherapy 28, 13541373.
Baker,B.F., Lot,S.S., Condon,T.P., Cheng-Flournoy,S., Lesnik,E.A., Sasmor,H.M., and
Bennett,C.F. (1997). 2'-O-(2-Methoxy)ethyl-modified anti-intercellular adhesion
molecule 1 (ICAM-1) oligonucleotides selectively increase the ICAM-1 mRNA level and
inhibit formation of the ICAM-1 translation initiation complex in human umbilical vein
endothelial cells. J Biol. Chem. 272, 11994-12000.
Bartoli,C.R., Ailawadi,G., and Kern,J.A. (2014). Diagnosis, Nonsurgical Management,
and Prevention of LVAD Thrombosis. J. Card Surg. 29, 83-94.
Baskin,J.L., Pui,C.H., Reiss,U., Wilimas,J.A., Metzger,M.L., Ribeiro,R.C., and
Howard,S.C. (2009). Management of occlusion and thrombosis associated with long-term
indwelling central venous catheters. Lancet 374, 159-169.
Bauersachs,R., Berkowitz,S.D., Brenner,B., Buller,H.R., Decousus,H., Gallus,A.S.,
Lensing,A.W., Misselwitz,F., Prins,M.H., Raskob,G.E., Segers,A., Verhamme,P.,
Wells,P., Agnelli,G., Bounameaux,H., Cohen,A., Davidson,B.L., Piovella,F., and
Schellong,S. (2010). Oral rivaroxaban for symptomatic venous thromboembolism. N.
Engl. J. Med. 363, 2499-2510.
Baugh,R.J., Broze,G.J., Jr., and Krishnaswamy,S. (1998). Regulation of extrinsic pathway
factor Xa formation by tissue factor pathway inhibitor. J. Biol. Chem. 273, 4378-4386.
Beathard,G.A. (2001). Catheter thrombosis. Semin. Dial. 14, 441-445.
207
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Berceli,S.A., Phaneuf,M.D., and LoGerfo,F.W. (1998). Evaluation of a novel hirudincoated polyester graft to physiologic flow conditions: hirudin bioavailability and
thrombin uptake. J. Vasc. Surg. 27, 1117-1127.
Berg, T. A. and Galdonik, J. A. Guide catheter having selected flexural modulus
segments. Boston Scientific Scimed, Inc. 10/816,429[7674411]. 3-9-0010. Minnesota,
United States. 4-1-2004.
Ref Type: Patent
Bernacca,G.M., Gulbransen,M.J., Wilkinson,R., and Wheatley,D.J. (1998). In vitro blood
compatibility of surface-modified polyurethanes. Biomaterials 19, 1151-1165.
Bittl,J.A. (1996). Coronary stent occlusion: thrombus horribilis. J. Am. Coll. Cardiol. 28,
368-370.
Brash,J.L. (2000). Exploiting the current paradigm of blood-material interactions for the
rational design of blood-compatible materials. J. Biomater. Sci. Polym. Ed 11, 11351146.
Brummer-Ziedins,K. and Mann,K.G. (2013). Molecular Basis of Blood Coagulation. In
Hematology: Basic Principles and Practice, R.Hoffman, E.J.Benz Jr, L.E.Silberstein,
H.E.Heslop, J.I.Weitz, and J.Anastasi, eds. (Philadelphia: Elsevier Saunders), pp. 18211841.
Bugge,T.H., Xiao,Q., Kombrinck,K.W., Flick,M.J., Holmback,K., Danton,M.J.,
Colbert,M.C., Witte,D.P., Fujikawa,K., Davie,E.W., and Degen,J.L. (1996). Fatal
embryonic bleeding events in mice lacking tissue factor, the cell-associated initiator of
blood coagulation. Proc. Natl. Acad. Sci. U. S. A 93, 6258-6263.
Buller,C.E., Pate,G.E., Armstrong,P.W., O'Neill,B.J., Webb,J.G., Gallo,R., and
Welsh,R.C. (2006). Catheter thrombosis during primary percutaneous coronary
intervention for acute ST elevation myocardial infarction despite subcutaneous lowmolecular-weight heparin, acetylsalicylic acid, clopidogrel and abciximab pretreatment.
Can. J. Cardiol. 22, 511-515.
Buller,H.R., Davidson,B.L., Decousus,H., Gallus,A., Gent,M., Piovella,F., Prins,M.H.,
Raskob,G., Segers,A.E., Cariou,R., Leeuwenkamp,O., and Lensing,A.W. (2004).
Fondaparinux or enoxaparin for the initial treatment of symptomatic deep venous
thrombosis: a randomized trial. Ann. Intern. Med. 140, 867-873.
Buller,H.R., Davidson,B.L., Decousus,H., Gallus,A., Gent,M., Piovella,F., Prins,M.H.,
Raskob,G., van den Berg-Segers AE, Cariou,R., Leeuwenkamp,O., and Lensing,A.W.
208
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
(2003). Subcutaneous fondaparinux versus intravenous unfractionated heparin in the
initial treatment of pulmonary embolism. N. Engl. J. Med. 349, 1695-1702.
Buller,H.R., Prins,M.H., Lensin,A.W., Decousus,H., Jacobson,B.F., Minar,E.,
Chlumsky,J., Verhamme,P., Wells,P., Agnelli,G., Cohen,A., Berkowitz,S.D.,
Bounameaux,H., Davidson,B.L., Misselwitz,F., Gallus,A.S., Raskob,G.E., Schellong,S.,
and Segers,A. (2012). Oral rivaroxaban for the treatment of symptomatic pulmonary
embolism. N. Engl. J. Med. 366, 1287-1297.
Cannegieter,S.C., Rosendaal,F.R., and Briet,E. (1994). Thromboembolic and bleeding
complications in patients with mechanical heart valve prostheses. Circulation 89, 635641.
Carmeliet,P., Mackman,N., Moons,L., Luther,T., Gressens,P., Van,V., I, Demunck,H.,
Kasper,M., Breier,G., Evrard,P., Muller,M., Risau,W., Edgington,T., and Collen,D.
(1996). Role of tissue factor in embryonic blood vessel development. Nature 383, 73-75.
Cenni,E., Ciapetti,G., Cervellati,M., Cavedagna,D., Falsone,G., Gamberini,S., and
Pizzoferrato,A. (1996). Activation of the plasma coagulation system induced by some
biomaterials. J. Biomed. Mater. Res. 31, 145-148.
Chan,A., Berry,L., O'Brodovich,H., Klement,P., Mitchell,L., Baranowski,B., Monagle,P.,
and Andrew,M. (1997). Covalent antithrombin-heparin complexes with high
anticoagulant activity. Intravenous, subcutaneous, and intratracheal administration. J.
Biol. Chem. 272, 22111-22117.
Chan,J.H., Lim,S., and Wong,W.S. (2006). Antisense oligonucleotides: from design to
therapeutic application. Clin. Exp. Pharmacol. Physiol 33, 533-540.
Chan,M.Y., Weitz,J.I., Merhi,Y., Harrington,R.A., and Becker,R.C. (2009). Catheter
thrombosis and percutaneous coronary intervention: fundamental perspectives on blood,
artificial surfaces and antithrombotic drugs. J. Thromb. Thrombolysis. 28, 366-380.
Chen,H., Brook,M.A., Chen,Y., and Sheardown,H. (2005a). Surface properties of PEOsilicone composites: reducing protein adsorption. J. Biomater. Sci. Polym. Ed 16, 531548.
Chen,H., Chen,Y., Sheardown,H., and Brook,M.A. (2005b). Immobilization of heparin on
a silicone surface through a heterobifunctional PEG spacer. Biomaterials 26, 7418-7424.
209
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Chen,H., Zhang,Y., Li,D., Hu,X., Wang,L., McClung,W.G., and Brash,J.L. (2009).
Surfaces having dual fibrinolytic and protein resistant properties by immobilization of
lysine on polyurethane through a PEG spacer. J. Biomed. Mater. Res. A 90, 940-946.
Chen,H., Zhang,Z., Chen,Y., Brook,M.A., and Sheardown,H. (2005c). Protein repellant
silicone surfaces by covalent immobilization of poly(ethylene oxide). Biomaterials 26,
2391-2399.
Chen,X., Wang,J., Paszti,Z., Wang,F., Schrauben,J.N., Tarabara,V.V., Schmaier,A.H.,
and Chen,Z. (2007). Ordered adsorption of coagulation factor XII on negatively charged
polymer surfaces probed by sum frequency generation vibrational spectroscopy. Anal.
Bioanal. Chem. 388, 65-72.
Cheng,Q., Tucker,E.I., Pine,M.S., Sisler,I., Matafonov,A., Sun,M.F., White-Adams,T.C.,
Smith,S.A., Hanson,S.R., McCarty,O.J., Renne,T., Gruber,A., and Gailani,D. (2010). A
role for factor XIIa-mediated factor XI activation in thrombus formation in vivo. Blood
116, 3981-3989.
Cheng,S.S., Nordenholz,K., Matero,D., Pearlman,N., McCarter,M., Gajdos,C., Hamiel,C.,
Baer,A., Luzier,E., Tran,Z.V., Olson,T., Queensland,K., Lutz,R., and Wischmeyer,P.
(2012). Standard subcutaneous dosing of unfractionated heparin for venous
thromboembolism prophylaxis in surgical ICU patients leads to subtherapeutic factor Xa
inhibition. Intensive Care Med. 38, 642-648.
Clagett,G.P. and Eberhart,R.C. (1994). Artificial Devices in Clinical Practice. In
Hemostasis and Thrombosis: Basic Principles and Clinical Practice, R.W.Colman,
J.Hirsh, V.J.Marder, and E.W.Salzman, eds. (Philadelphia: J.B. Lippincott Company), pp.
1486-1505.
Cohen,D.M., Norberto,J., Cartabuke,R., and Ryu,G. (1999). Severe anaphylactic reaction
after primary exposure to aprotinin. Ann. Thorac. Surg. 67, 837-838.
Colman,R.W. (2006). Are hemostasis and thrombosis two sides of the same coin? J. Exp.
Med. 203, 493-495.
Colman,R.W. and Schmaier,A.H. (1997). Contact system: a vascular biology modulator
with anticoagulant, profibrinolytic, antiadhesive, and proinflammatory attributes. Blood
90, 3819-3843.
Colman,R.W., Scott,C.F., Pixley,R.A., and de la Cadena,R.A. (1989). Effect of heparin
on the inhibition of the contact system enzymes. Ann. N. Y. Acad. Sci. 556, 95-103.
210
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Connolly,S.J., Eikelboom,J., Joyner,C., Diener,H.C., Hart,R., Golitsyn,S., Flaker,G.,
Avezum,A., Hohnloser,S.H., Diaz,R., Talajic,M., Zhu,J., Pais,P., Budaj,A.,
Parkhomenko,A., Jansky,P., Commerford,P., Tan,R.S., Sim,K.H., Lewis,B.S., Van
Mieghem,W., Lip,G.Y., Kim,J.H., Lanas-Zanetti,F., Gonzalez-Hermosillo,A., Dans,A.L.,
Munawar,M., O'Donnell,M., Lawrence,J., Lewis,G., Afzal,R., and Yusuf,S. (2011).
Apixaban in patients with atrial fibrillation. N. Engl. J. Med. 364, 806-817.
Connolly,S.J., Ezekowitz,M.D., Yusuf,S., Eikelboom,J., Oldgren,J., Parekh,A., Pogue,J.,
Reilly,P.A., Themeles,E., Varrone,J., Wang,S., Alings,M., Xavier,D., Zhu,J., Diaz,R.,
Lewis,B.S., Darius,H., Diener,H.C., Joyner,C.D., and Wallentin,L. (2009). Dabigatran
versus warfarin in patients with atrial fibrillation. N. Engl. J Med. 361, 1139-1151.
Crooke,S.T. (2004). Progress in antisense technology. Annu. Rev. Med. 55, 61-95.
Crosby,J.R., Marzec,U., Revenko,A.S., Zhao,C., Gao,D., Matafonov,A., Gailani,D.,
MacLeod,A.R., Tucker,E.I., Gruber,A., Hanson,S.R., and Monia,B.P. (2013).
Antithrombotic effect of antisense factor XI oligonucleotide treatment in primates.
Arterioscler. Thromb. Vasc. Biol. 33, 1670-1678.
Cutlip,D.E., Baim,D.S., Ho,K.K., Popma,J.J., Lansky,A.J., Cohen,D.J., Carrozza,J.P., Jr.,
Chauhan,M.S., Rodriguez,O., and Kuntz,R.E. (2001). Stent thrombosis in the modern era:
a pooled analysis of multicenter coronary stent clinical trials. Circulation 103, 1967-1971.
Davie,E.W., Fujikawa,K., and Kisiel,W. (1991). The coagulation cascade: initiation,
maintenance, and regulation. Biochemistry 30, 10363-10370.
De Cicco,M., Matovic,M., Balestreri,L., Steffan,A., Pacenzia,R., Malafronte,M.,
Fantin,D., Bertuzzi,C.A., Fabiani,F., Morassut,S., Bidoli,E., and Veronesi,A. (2009).
Early and short-term acenocumarine or dalteparin for the prevention of central vein
catheter-related thrombosis in cancer patients: a randomized controlled study based on
serial venographies. Ann. Oncol. 20, 1936-1942.
de la Cadena,R.A., Wachtfogel,Y.T., and Colman,R.W. (1994). Contact Activation
Pathway: Inflammation and Coagulation. In Hemostasis and Thrombosis: Basic
Principles and Clinical Practice, R.W.Colman, J.Hirsh, V.J.Marder, and E.W.Salzman,
eds. (Philadelphia: J.B. Lippincott Company), pp. 219-240.
de Maat,S., van Dooremalen,S., de Groot,P.G., and Maas,C. (2013). A nanobody-based
method for tracking factor XII activation in plasma. Thromb. Haemost. 110, 458-468.
de Queiroz,A.A., Barrak,E.R., Gil,H.A., and Higa,O.Z. (1997). Surface studies of
albumin immobilized onto PE and PVC films. J. Biomater. Sci. Polym. Ed 8, 667-681.
211
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Du,Y.J., Brash,J.L., McClung,G., Berry,L.R., Klement,P., and Chan,A.K. (2007). Protein
adsorption on polyurethane catheters modified with a novel antithrombin-heparin
covalent complex. J. Biomed. Mater. Res. A 80, 216-225.
Du,Y.J., Klement,P., Berry,L.R., Tressel,P., and Chan,A.K. (2005). In vivo rabbit acute
model tests of polyurethane catheters coated with a novel antithrombin-heparin covalent
complex. Thromb. Haemost. 94, 366-372.
Duggan,S.T., Scott,L.J., and Plosker,G.L. (2009). Rivaroxaban: a review of its use for the
prevention of venous thromboembolism after total hip or knee replacement surgery.
Drugs 69, 1829-1851.
Eberhart,R.C. and Clagett,C.P. (1991). Catheter
biocompatibility. Semin. Hematol. 28, 42-48.
coatings,
blood
flow,
and
Edmunds,L.H., Jr. (1996). Is prosthetic valve thrombogenicity related to design or
material? Tex. Heart Inst. J. 23, 24-27.
Eikelboom,J.W., Connolly,S.J., Brueckmann,M., Granger,C.B., Kappetein,A.P.,
Mack,M.J., Blatchford,J., Devenny,K., Friedman,J., Guiver,K., Harper,R., Khder,Y.,
Lobmeyer,M.T., Maas,H., Voigt,J.U., Simoons,M.L., and Van de,W.F. (2013).
Dabigatran versus warfarin in patients with mechanical heart valves. N. Engl. J. Med.
369, 1206-1214.
Eriksson,B.I., Dahl,O.E., Rosencher,N., Kurth,A.A., van Dijk,C.N., Frostick,S.P.,
Kalebo,P., Christiansen,A.V., Hantel,S., Hettiarachchi,R., Schnee,J., and Buller,H.R.
(2007a). Oral dabigatran etexilate vs. subcutaneous enoxaparin for the prevention of
venous thromboembolism after total knee replacement: the RE-MODEL randomized trial.
J. Thromb. Haemost. 5, 2178-2185.
Eriksson,B.I., Dahl,O.E., Rosencher,N., Kurth,A.A., van Dijk,C.N., Frostick,S.P.,
Prins,M.H., Hettiarachchi,R., Hantel,S., Schnee,J., and Buller,H.R. (2007b). Dabigatran
etexilate versus enoxaparin for prevention of venous thromboembolism after total hip
replacement: a randomised, double-blind, non-inferiority trial. Lancet 370, 949-956.
Fair,D.S. and MacDonald,M.J. (1987). Cooperative interaction between factor VII and
cell surface-expressed tissue factor. J. Biol. Chem. 262, 11692-11698.
Falanga,A., Marchetti,M., and Vignoli,A. (2013). Coagulation and cancer: biological and
clinical aspects. J. Thromb. Haemost. 11, 223-233.
212
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Ferguson,J.J., Califf,R.M., Antman,E.M., Cohen,M., Grines,C.L., Goodman,S.,
Kereiakes,D.J., Langer,A., Mahaffey,K.W., Nessel,C.C., Armstrong,P.W., Avezum,A.,
Aylward,P., Becker,R.C., Biasucci,L., Borzak,S., Col,J., Frey,M.J., Fry,E., Gulba,D.C.,
Guneri,S., Gurfinkel,E., Harrington,R., Hochman,J.S., Kleiman,N.S., Leon,M.B., LopezSendon,J.L., Pepine,C.J., Ruzyllo,W., Steinhubl,S.R., Teirstein,P.S., Toro-Figueroa,L.,
and White,H. (2004). Enoxaparin vs unfractionated heparin in high-risk patients with
non-ST-segment elevation acute coronary syndromes managed with an intended early
invasive strategy: primary results of the SYNERGY randomized trial. JAMA 292, 45-54.
Fredenburgh,J.C., Stafford,A.R., and Weitz,J.I. (2001). Conformational changes in
thrombin when complexed by serpins. J. Biol. Chem. 276, 44828-44834.
Freitas,S.C., Barbosa,M.A., and Martins,M.C. (2010). The effect of immobilization of
thrombin inhibitors onto self-assembled monolayers on the adsorption and activity of
thrombin. Biomaterials 31, 3772-3780.
Furie,B. and Furie,B.C. (1988). The molecular basis of blood coagulation. Cell 53, 505518.
Furie,B. and Furie,B.C. (1991). The molecular basis of blood coagulation. In
Hematology: Basic Principles and Practice, R.Hoffman, E.Benz, S.Shattil, B.Furie, and
H.Cohen, eds. (New York: Churchill Livingstone), pp. 1213-1231.
Gailani,D. and Renne,T. (2007). Intrinsic pathway of coagulation and arterial thrombosis.
Arterioscler. Thromb. Vasc. Biol. 27, 2507-2513.
Geng,Y., Verhamme,I.M., Smith,S.B., Sun,M.F., Matafonov,A., Cheng,Q., Smith,S.A.,
Morrissey,J.H., and Gailani,D. (2013). The dimeric structure of factor XI and zymogen
activation. Blood 121, 3962-3969.
Giugliano,R.P., Wiviott,S.D., Stone,P.H., Simon,D.I., Schweiger,M.J., Bouchard,A.,
Leesar,M.A., Goulder,M.A., Deitcher,S.R., McCabe,C.H., and Braunwald,E. (2007).
Recombinant nematode anticoagulant protein c2 in patients with non-ST-segment
elevation acute coronary syndrome: the ANTHEM-TIMI-32 trial. J. Am. Coll. Cardiol.
49, 2398-2407.
Goodman,S.G., Menon,V., Cannon,C.P., Steg,G., Ohman,E.M., and Harrington,R.A.
(2008). Acute ST-segment elevation myocardial infarction: American College of Chest
Physicians Evidence-Based Clinical Practice Guidelines (8th Edition). Chest 133, 708S775S.
213
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Gorbet,M.B. and Sefton,M.V. (2004). Biomaterial-associated thrombosis: roles of
coagulation factors, complement, platelets and leukocytes. Biomaterials 25, 5681-5703.
Gott,V.L., Whiffen,J.D., and Dutton,R.C. (1963). Heparin bonding on colloidal graphite
surfaces. Science 142, 1297-1298.
Granger,C.B., Alexander,J.H., McMurray,J.J., Lopes,R.D., Hylek,E.M., Hanna,M., Al
Khalidi,H.R., Ansell,J., Atar,D., Avezum,A., Bahit,M.C., Diaz,R., Easton,J.D.,
Ezekowitz,J.A., Flaker,G., Garcia,D., Geraldes,M., Gersh,B.J., Golitsyn,S., Goto,S.,
Hermosillo,A.G., Hohnloser,S.H., Horowitz,J., Mohan,P., Jansky,P., Lewis,B.S., LopezSendon,J.L., Pais,P., Parkhomenko,A., Verheugt,F.W., Zhu,J., and Wallentin,L. (2011).
Apixaban versus warfarin in patients with atrial fibrillation. N. Engl. J. Med. 365, 981992.
Griffin,J.H. and Cochrane,C.G. (1976). Mechanisms for the involvement of high
molecular weight kininogen in surface-dependent reactions of Hageman factor. Proc.
Natl. Acad. Sci. U. S. A 73, 2554-2558.
Guidoin,R.G., Awad,J., Brassard,A., Domurado,D., Lawny,F., Barbotin,J.N., Calvor,C.,
and Broun,G. (1976). Blood compatibility of silicone rubber chemically coated with
cross-linked albumin. Biomater. Med. Devices Artif. Organs 4, 205-224.
Guidoin,R.G., King,M.W., Awad,J., Martin,L., Domurado,D., Marois,M., SigotLuizard,M.F., Gosselin,C., Gunasekera,K., and Gagnon,D. (1983). Albumin coated and
critical point dried polyester prostheses as substitutes in the thoracic aorta of dogs. Trans.
Am. Soc. Artif. Intern. Organs 29, 290-295.
Hankey,G.J. and Eikelboom,J.W. (2011). Dabigatran etexilate: a new oral thrombin
inhibitor. Circulation 123, 1436-1450.
Hansson,K.M., Tosatti,S., Isaksson,J., Wettero,J., Textor,M., Lindahl,T.L., and
Tengvall,P. (2005). Whole blood coagulation on protein adsorption-resistant PEG and
peptide functionalised PEG-coated titanium surfaces. Biomaterials 26, 861-872.
Happe,L.E., Rao,S.V., Horblyuk,R., Franklin,M., Lunacsek,O.E., and Menditto,L. (2009).
Consequences of major bleeding in hospitalized patients with non-ST segment elevation
acute coronary syndromes receiving injectable anticoagulants. Curr. Med. Res. Opin. 25,
413-420.
Harrington,R.A., Becker,R.C., Cannon,C.P., Gutterman,D., Lincoff,A.M., Popma,J.J.,
Steg,G., Guyatt,G.H., and Goodman,S.G. (2008). Antithrombotic therapy for non-ST214
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
segment elevation acute coronary syndromes: American College of Chest Physicians
Evidence-Based Clinical Practice Guidelines (8th Edition). Chest 133, 670S-707S.
Hashimoto,J.G., Beadles-Bohling,A.S., and Wiren,K.M. (2004). Comparison of
RiboGreen and 18S rRNA quantitation for normalizing real-time RT-PCR expression
analysis. Biotechniques 36, 54-60.
Hirsh,J., Anand,S.S., Halperin,J.L., and Fuster,V. (2001). Mechanism of action and
pharmacology of unfractionated heparin. Arterioscler. Thromb. Vasc. Biol. 21, 10941096.
Hirsh,J., Bauer,K.A., Donati,M.B., Gould,M., Samama,M.M., and Weitz,J.I. (2008).
Parenteral anticoagulants: American College of Chest Physicians Evidence-Based
Clinical Practice Guidelines (8th Edition). Chest 133, 141S-159S.
Hockin,M.F., Jones,K.C., Everse,S.J., and Mann,K.G. (2002). A model for the
stoichiometric regulation of blood coagulation. J. Biol. Chem. 277, 18322-18333.
Hojima,Y., Pierce,J.V., and Pisano,J.J. (1980). Hageman factor fragment inhibitor in corn
seeds: purification and characterization. Thromb. Res. 20, 149-162.
Hong,J., Nilsson,E.K., Reynolds,H., Larsson,R., and Nilsson,B. (1999). A new in vitro
model to study interaction between whole blood and biomaterials. Studies of platelet and
coagulation activation and the effect of aspirin. Biomaterials 20, 603-611.
Hylek,E.M. (2013). Dabigatran and mechanical heart valves--not as easy as we hoped. N.
Engl. J. Med. 369, 1264-1266.
Janvier,G., Baquey,C., Roth,C., Benillan,N., Belisle,S., and Hardy,J.F. (1996).
Extracorporeal circulation, hemocompatibility, and biomaterials. Ann. Thorac. Surg. 62,
1926-1934.
Jordan,S.W. and Chaikof,E.L. (2007). Novel thromboresistant materials. J. Vasc. Surg. 45
Suppl A, A104-A115.
Kang,I.K., Kwon,B.K., Lee,J.H., and Lee,H.B. (1993). Immobilization of proteins on
poly(methyl methacrylate) films. Biomaterials 14, 787-792.
Kannemeier,C., Shibamiya,A., Nakazawa,F., Trusheim,H., Ruppert,C., Markart,P.,
Song,Y., Tzima,E., Kennerknecht,E., Niepmann,M., von Bruehl,M.L., Sedding,D.,
Massberg,S., Gunther,A., Engelmann,B., and Preissner,K.T. (2007). Extracellular RNA
constitutes a natural procoagulant cofactor in blood coagulation. Proc. Natl. Acad. Sci. U.
S. A 104, 6388-6393.
215
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Kaplan,A.P. and Silverberg,M. (1987). The coagulation-kinin pathway of human plasma.
Blood 70, 1-15.
Karalapillai,D. and Popham,P. (2007). Recombinant factor VIIa in massive postpartum
haemorrhage. Int. J. Obstet. Anesth. 16, 29-34.
Karthaus,M., Kretzschmar,A., Kroning,H., Biakhov,M., Irwin,D., Marschner,N.,
Slabber,C., Fountzilas,G., Garin,A., Abecasis,N.G., Baronius,W., Steger,G.G.,
Sudhoff,T., Giorgetti,C., and Reichardt,P. (2006). Dalteparin for prevention of catheterrelated complications in cancer patients with central venous catheters: final results of a
double-blind, placebo-controlled phase III trial. Ann. Oncol. 17, 289-296.
Kastrati,A., Neumann,F.J., Mehilli,J., Byrne,R.A., Iijima,R., Buttner,H.J., Khattab,A.A.,
Schulz,S., Blankenship,J.C., Pache,J., Minners,J., Seyfarth,M., Graf,I., Skelding,K.A.,
Dirschinger,J., Richardt,G., Berger,P.B., and Schomig,A. (2008). Bivalirudin versus
unfractionated heparin during percutaneous coronary intervention. N. Engl. J. Med. 359,
688-696.
Kishida,A., Ueno,Y., Fukudome,N., Yashima,E., Maruyama,I., and Akashi,M. (1994a).
Immobilization of human thrombomodulin onto poly(ether urethane urea) for developing
antithrombogenic blood-contacting materials. Biomaterials 15, 848-852.
Kishida,A., Ueno,Y., Maruyama,I., and Akashi,M. (1994b). Immobilization of human
thrombomodulin on biomaterials: evaluation of the activity of immobilized human
thrombomodulin. Biomaterials 15, 1170-1174.
Kishida,A., Ueno,Y., Maruyama,I., and Akashi,M. (1994c). Immobilization of human
thrombomodulin onto biomaterials. Comparison of immobilization methods and
evaluation of antithrombogenicity. ASAIO J. 40, M840-M845.
Kleinschnitz,C., Stoll,G., Bendszus,M., Schuh,K., Pauer,H.U., Burfeind,P., Renne,C.,
Gailani,D., Nieswandt,B., and Renne,T. (2006). Targeting coagulation factor XII provides
protection from pathological thrombosis in cerebral ischemia without interfering with
hemostasis. J. Exp. Med. 203, 513-518.
Klement,P., Du,Y.J., Berry,L., Andrew,M., and Chan,A.K. (2002). Blood-compatible
biomaterials by surface coating with a novel antithrombin-heparin covalent complex.
Biomaterials 23, 527-535.
Klement,P., Du,Y.J., Berry,L.R., Tressel,P., and Chan,A.K. (2006). Chronic performance
of polyurethane catheters covalently coated with ATH complex: a rabbit jugular vein
model. Biomaterials 27, 5107-5117.
216
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Komiyama,Y., Pedersen,A.H., and Kisiel,W. (1990). Proteolytic activation of human
factors IX and X by recombinant human factor VIIa: effects of calcium, phospholipids,
and tissue factor. Biochemistry 29, 9418-9425.
Kottke-Marchant,K., Anderson,J.M., Umemura,Y., and Marchant,R.E. (1989). Effect of
albumin coating on the in vitro blood compatibility of Dacron arterial prostheses.
Biomaterials 10, 147-155.
Kretz,C.A., Cuddy,K.K., Stafford,A.R., Fredenburgh,J.C., Roberts,R., and Weitz,J.I.
(2010). HD1, a thrombin- and prothrombin-binding DNA aptamer, inhibits thrombin
generation by attenuating prothrombin activation and thrombin feedback reactions.
Thromb. Haemost. 103, 83-93.
Kudo,F.A., Nishibe,T., Miyazaki,K., Flores,J., and Yasuda,K. (2002). Albumin-coated
knitted Dacron aortic prosthses. Study of postoperative inflammatory reactions. Int.
Angiol. 21, 214-217.
Kurreck,J. (2003). Antisense technologies. Improvement through novel chemical
modifications. Eur. J. Biochem. 270, 1628-1644.
Larsson,M., Rayzman,V., Nolte,M.W., Nickel,K.F., Bjorkqvist,J., Jamsa,A., Hardy,M.P.,
Fries,M., Schmidbauer,S., Hedenqvist,P., Broome,M., Pragst,I., Dickneite,G.,
Wilson,M.J., Nash,A.D., Panousis,C., and Renne,T. (2014). A Factor XIIa Inhibitory
Antibody Provides Thromboprotection in Extracorporeal Circulation Without Increasing
Bleeding Risk. Sci. Transl. Med. 6, 222ra17.
Lassen,M.R., Gallus,A., Raskob,G.E., Pineo,G., Chen,D., and Ramirez,L.M. (2010a).
Apixaban versus enoxaparin for thromboprophylaxis after hip replacement. N. Engl. J.
Med. 363, 2487-2498.
Lassen,M.R., Raskob,G.E., Gallus,A., Pineo,G., Chen,D., and Hornick,P. (2010b).
Apixaban versus enoxaparin for thromboprophylaxis after knee replacement
(ADVANCE-2): a randomised double-blind trial. Lancet 375, 807-815.
Lassen,M.R., Raskob,G.E., Gallus,A., Pineo,G., Chen,D., and Portman,R.J. (2009).
Apixaban or enoxaparin for thromboprophylaxis after knee replacement. N. Engl. J. Med.
361, 594-604.
Lau,A., Berry,L.R., Mitchell,L.G., and Chan,A.K. (2007). Effect of substrate and fibrin
polymerization inhibitor on determination of plasma thrombin generation in vitro.
Thromb. Res. 119, 667-677.
217
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Lee,A.Y. and Kamphuisen,P.W. (2012). Epidemiology and prevention of catheter-related
thrombosis in patients with cancer. J Thromb. Haemost. 10, 1491-1499.
Lee,A.Y. and Peterson,E.A. (2013). Treatment of cancer-associated thrombosis. Blood
122, 2310-2317.
Lee,J.H., Lee,H.B., and Andrade,J.D. (1995). Blood compatibility of polyethylene oxide
surfaces. Prog. Polym. Sci. 20, 1043-1079.
Levy,M. and Hartman,A.R. (1996). Heparin-coated bypass circuits in cardiopulmonary
bypass: improved biocompatibility or not. Int. J. Cardiol. 53 Suppl, S81-S87.
Lin,J., Deng,H., Jin,L., Pandey,P., Quinn,J., Cantin,S., Rynkiewicz,M.J., Gorga,J.C.,
Bibbins,F., Celatka,C.A., Nagafuji,P., Bannister,T.D., Meyers,H.V., Babine,R.E.,
Hayward,N.J., Weaver,D., Benjamin,H., Stassen,F., Abdel-Meguid,S.S., and
Strickler,J.E. (2006). Design, synthesis, and biological evaluation of peptidomimetic
inhibitors of factor XIa as novel anticoagulants. J. Med. Chem. 49, 7781-7791.
Lincoff,A.M., Bittl,J.A., Harrington,R.A., Feit,F., Kleiman,N.S., Jackman,J.D.,
Sarembock,I.J., Cohen,D.J., Spriggs,D., Ebrahimi,R., Keren,G., Carr,J., Cohen,E.A.,
Betriu,A., Desmet,W., Kereiakes,D.J., Rutsch,W., Wilcox,R.G., de Feyter,P.J.,
Vahanian,A., and Topol,E.J. (2003). Bivalirudin and provisional glycoprotein IIb/IIIa
blockade compared with heparin and planned glycoprotein IIb/IIIa blockade during
percutaneous coronary intervention: REPLACE-2 randomized trial. JAMA 289, 853-863.
Lindsey,J.B., Marso,S.P., Pencina,M., Stolker,J.M., Kennedy,K.F., Rihal,C., Barsness,G.,
Piana,R.N., Goldberg,S.L., Cutlip,D.E., Kleiman,N.S., and Cohen,D.J. (2009). Prognostic
impact of periprocedural bleeding and myocardial infarction after percutaneous coronary
intervention in unselected patients: results from the EVENT (evaluation of drug-eluting
stents and ischemic events) registry. JACC. Cardiovasc. Interv. 2, 1074-1082.
Lu,L., Li,Q.L., Maitz,M.F., Chen,J.L., and Huang,N. (2012). Immobilization of the direct
thrombin inhibitor-bivalirudin on 316L stainless steel via polydopamine and the resulting
effects on hemocompatibility in vitro. J. Biomed. Mater. Res. A 100, 2421-2430.
Mackman,N., Tilley,R.E., and Key,N.S. (2007). Role of the extrinsic pathway of blood
coagulation in hemostasis and thrombosis. Arterioscler. Thromb. Vasc. Biol. 27, 16871693.
Maitz,M.F., Sperling,C., and Werner,C. (2010). Immobilization of the irreversible
thrombin inhibitor D-Phe-Pro-Arg-chloromethylketone: a concept for hemocompatible
surfaces? J. Biomed. Mater. Res. A 94, 905-912.
218
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Manoukian,S.V., Voeltz,M.D., and Eikelboom,J. (2007). Bleeding complications in acute
coronary syndromes and percutaneous coronary intervention: predictors, prognostic
significance, and paradigms for reducing risk. Clin. Cardiol. 30, II24-II34.
Marois,Y., Chakfe,N., Guidoin,R., Duhamel,R.C., Roy,R., Marois,M., King,M.W., and
Douville,Y. (1996). An albumin-coated polyester arterial graft: in vivo assessment of
biocompatibility and healing characteristics. Biomaterials 17, 3-14.
Matafonov,A., Leung,P.Y., Gailani,A.E., Grach,S.L., Puy,C., Cheng,Q., Sun,M.F.,
McCarty,O.J., Tucker,E.I., Kataoka,H., Renne,T., Morrissey,J.H., Gruber,A., and
Gailani,D. (2014). Factor XII inhibition reduces thrombus formation in a primate
thrombosis model. Blood 123, 1739-1746.
Mega,J.L., Braunwald,E., Wiviott,S.D., Bassand,J.P., Bhatt,D.L., Bode,C., Burton,P.,
Cohen,M., Cook-Bruns,N., Fox,K.A., Goto,S., Murphy,S.A., Plotnikov,A.N.,
Schneider,D., Sun,X., Verheugt,F.W., and Gibson,C.M. (2012). Rivaroxaban in patients
with a recent acute coronary syndrome. N. Engl. J. Med. 366, 9-19.
Mehta,S.R., Granger,C.B., Eikelboom,J.W., Bassand,J.P., Wallentin,L., Faxon,D.P.,
Peters,R.J., Budaj,A., Afzal,R., Chrolavicius,S., Fox,K.A., and Yusuf,S. (2007). Efficacy
and safety of fondaparinux versus enoxaparin in patients with acute coronary syndromes
undergoing percutaneous coronary intervention: results from the OASIS-5 trial. J. Am.
Coll. Cardiol. 50, 1742-1751.
Mehta,S.R., Steg,P.G., Granger,C.B., Bassand,J.P., Faxon,D.P., Weitz,J.I., Afzal,R.,
Rush,B., Peters,R.J., Natarajan,M.K., Velianou,J.L., Goodhart,D.M., Labinaz,M.,
Tanguay,J.F., Fox,K.A., and Yusuf,S. (2005). Randomized, blinded trial comparing
fondaparinux with unfractionated heparin in patients undergoing contemporary
percutaneous coronary intervention: Arixtra Study in Percutaneous Coronary
Intervention: a Randomized Evaluation (ASPIRE) Pilot Trial. Circulation 111, 13901397.
Meijers,J.C., Vlooswijk,R.A., and Bouma,B.N. (1988). Inhibition of human blood
coagulation factor XIa by C-1 inhibitor. Biochemistry 27, 959-963.
Merrill,E.W. and Salzman,E.W. (1983). Polyethylene oxide as a biomaterial. ASAIO J 6,
1.
Mismetti,P., Mille,D., Laporte,S., Charlet,V., Buchmuller-Cordier,A., Jacquin,J.P.,
Fournel,P., Dutrey-Dupagne,C., and Decousus,H. (2003). Low-molecular-weight heparin
(nadroparin) and very low doses of warfarin in the prevention of upper extremity
219
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
thrombosis in cancer patients with indwelling long-term central venous catheters: a pilot
randomized trial. Haematologica 88, 67-73.
Mitropoulos,K.A. (1999a). High affinity binding of factor XIIa to an electronegative
surface controls the rates of factor XII and prekallikrein activation in vitro. Thromb. Res.
94, 117-129.
Mitropoulos,K.A. (1999b). The levels of factor XIIa generated in human plasma on an
electronegative surface are insensitive to wide variation in the concentration of FXII,
prekallikrein, high molecular weight kininogen or FXI. Thromb. Haemost. 82, 10331040.
Monreal,M., Alastrue,A., Rull,M., Mira,X., Muxart,J., Rosell,R., and Abad,A. (1996).
Upper extremity deep venous thrombosis in cancer patients with venous access devices-prophylaxis with a low molecular weight heparin (Fragmin). Thromb. Haemost. 75, 251253.
Montalescot,G. and Walenga,J.M. (2009). Catheter-related thrombosis: biological and
clinical evidence for risk with currently available anticoagulants. Clin. Appl. Thromb.
Hemost. 15, 183-196.
Montalescot,G., White,H.D., Gallo,R., Cohen,M., Steg,P.G., Aylward,P.E., Bode,C.,
Chiariello,M., King,S.B., III, Harrington,R.A., Desmet,W.J., Macaya,C., and
Steinhubl,S.R. (2006). Enoxaparin versus unfractionated heparin in elective percutaneous
coronary intervention. N. Engl. J. Med. 355, 1006-1017.
Morrissey,J.H., Fakhrai,H., and Edgington,T.S. (1987). Molecular cloning of the cDNA
for tissue factor, the cellular receptor for the initiation of the coagulation protease
cascade. Cell 50, 129-135.
Munakata,M., Teraoka,A., Komiyama,Y., Masuda,M., Murakami,T., and Murata,K.
(1990). Determination of the minimal concentrations of contact activation factors in
deficient substrate plasmas required to assess accurately factor XII, factor XI, factor IX,
and high molecular weight kininogen. Thromb. Res. 57, 197-203.
Niers,T.M., Di Nisio,M., Klerk,C.P., Baarslag,H.J., Buller,H.R., and Biemond,B.J.
(2007). Prevention of catheter-related venous thrombosis with nadroparin in patients
receiving chemotherapy for hematologic malignancies: a randomized, placebo-controlled
study. J. Thromb. Haemost. 5, 1878-1882.
220
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Nilsson,P.H., Engberg,A.E., Back,J., Faxalv,L., Lindahl,T.L., Nilsson,B., and
Ekdahl,K.N. (2010). The creation of an antithrombotic surface by apyrase
immobilization. Biomaterials 31, 4484-4491.
Okorie,U.M., Denney,W.S., Chatterjee,M.S., Neeves,K.B., and Diamond,S.L. (2008).
Determination of surface tissue factor thresholds that trigger coagulation at venous and
arterial shear rates: amplification of 100 fM circulating tissue factor requires flow. Blood
111, 3507-3513.
Oliver,W.C. (2009). Anticoagulation and coagulation management for ECMO. Semin.
Cardiothorac. Vasc. Anesth. 13, 154-175.
Park,K., Shim,H.S., Dewanjee,M.K., and Eigler,N.L. (2000). In vitro and in vivo studies
of PEO-grafted blood-contacting cardiovascular prostheses. J Biomater. Sci. Polym. Ed
11, 1121-1134.
Patel,M.R., Mahaffey,K.W., Garg,J., Pan,G., Singer,D.E., Hacke,W., Breithardt,G.,
Halperin,J.L., Hankey,G.J., Piccini,J.P., Becker,R.C., Nessel,C.C., Paolini,J.F.,
Berkowitz,S.D., Fox,K.A., and Califf,R.M. (2011). Rivaroxaban versus warfarin in
nonvalvular atrial fibrillation. N. Engl. J. Med. 365, 883-891.
Pauer,H.U., Renne,T., Hemmerlein,B., Legler,T., Fritzlar,S., Adham,I., Muller-Esterl,W.,
Emons,G., Sancken,U., Engel,W., and Burfeind,P. (2004). Targeted deletion of murine
coagulation factor XII gene-a model for contact phase activation in vivo. Thromb.
Haemost. 92, 503-508.
Phaneuf,M.D., Berceli,S.A., Bide,M.J., Quist,W.C., and LoGerfo,F.W. (1997). Covalent
linkage of recombinant hirudin to poly(ethylene terephthalate) (Dacron): creation of a
novel antithrombin surface. Biomaterials 18, 755-765.
Phaneuf,M.D., Szycher,M., Berceli,S.A., Dempsey,D.J., Quist,W.C., and LoGerfo,F.W.
(1998). Covalent linkage of recombinant hirudin to a novel ionic poly(carbonate)
urethane polymer with protein binding sites: determination of surface antithrombin
activity. Artif. Organs 22, 657-665.
Pixley,R.A., Schapira,M., and Colman,R.W. (1985a). Effect of heparin on the
inactivation rate of human activated factor XII by antithrombin III. Blood 66, 198-203.
Pixley,R.A., Schapira,M., and Colman,R.W. (1985b). The regulation of human factor
XIIa by plasma proteinase inhibitors. J. Biol. Chem. 260, 1723-1729.
221
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Rand,M.D., Lock,J.B., van't Veer,C., Gaffney,D.P., and Mann,K.G. (1996). Blood
clotting in minimally altered whole blood. Blood 88, 3432-3445.
Ratner,B.D. (2007). The catastrophe revisited: blood compatibility in the 21st Century.
Biomaterials 28, 5144-5147.
Ratner,B.D., Hoffman,A.S., Schoen,J.F., and Lemons,J.E. (2004). Biomaterials Science,
an Introduction to Materials in Medicine. (San Diego: Academic Press), pp. 1-8.
Raybagkar,D.A., Patchipulusu,S., Mast,A.E., and Hall,C.L. (2004). In vitro flow
evaluation of recombinant tissue factor pathway inhibitor immobilized on collagen
impregnated Dacron. ASAIO J. 50, 301-305.
Renne,T., Pozgajova,M., Gruner,S., Schuh,K., Pauer,H.U., Burfeind,P., Gailani,D., and
Nieswandt,B. (2005). Defective thrombus formation in mice lacking coagulation factor
XII. J. Exp. Med. 202, 271-281.
Revenko,A.S., Gao,D., Crosby,J.R., Bhattacharjee,G., Zhao,C., May,C., Gailani,D.,
Monia,B.P., and MacLeod,A.R. (2011). Selective depletion of plasma prekallikrein or
coagulation factor XII inhibits thrombosis in mice without increased risk of bleeding.
Blood 118, 5302-5311.
Rosen,E.D., Chan,J.C., Idusogie,E., Clotman,F., Vlasuk,G., Luther,T., Jalbert,L.R.,
Albrecht,S., Zhong,L., Lissens,A., Schoonjans,L., Moons,L., Collen,D., Castellino,F.J.,
and Carmeliet,P. (1997). Mice lacking factor VII develop normally but suffer fatal
perinatal bleeding. Nature 390, 290-294.
Ross, C. D. Guide catheter. Engineering Resources Group, Inc. 10/955,275[7306585]. 64-0006. United States. 30-9-0004.
Ref Type: Patent
Saber,W., Moua,T., Williams,E.C., Verso,M., Agnelli,G., Couban,S., Young,A., De
Cicco,M., Biffi,R., van Rooden,C.J., Huisman,M.V., Fagnani,D., Cimminiello,C.,
Moia,M., Magagnoli,M., Povoski,S.P., Malak,S.F., and Lee,A.Y. (2011). Risk factors for
catheter-related thrombosis (CRT) in cancer patients: a patient-level data (IPD) metaanalysis of clinical trials and prospective studies. J. Thromb. Haemost. 9, 312-319.
Saito,H. (1987). Contact factors in health and disease. Semin. Thromb. Hemost. 13, 3649.
Sakiyama-Elbert,S.E. and Hubbell,J.A. (2000). Development of fibrin derivatives for
controlled release of heparin-binding growth factors. J. Control Release 65, 389-402.
222
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Samama,M.M. and Gerotziafas,G.T. (2003). Evaluation of the pharmacological properties
and clinical results of the synthetic pentasaccharide (fondaparinux). Thromb. Res. 109, 111.
Sanchez,J., Elgue,G., Larsson,R., Nilsson,B., and Olsson,P. (2008). Surface-adsorbed
fibrinogen and fibrin may activate the contact activation system. Thromb. Res. 122, 257263.
Sanchez,J., Lundquist,P.B., Elgue,G., Larsson,R., and Olsson,P. (2002). Measuring the
degree of plasma contact activation induced by artificial materials. Thromb. Res. 105,
407-412.
Schapira,M., Scott,C.F., and Colman,R.W. (1982). Contribution of plasma protease
inhibitors to the inactivation of kallikrein in plasma. J. Clin. Invest 69, 462-468.
Schiele,F., van Ryn,J., Canada,K., Newsome,C., Sepulveda,E., Park,J., Nar,H., and
Litzenburger,T. (2013). A specific antidote for dabigatran: functional and structural
characterization. Blood 121, 3554-3562.
Schiffer,C.A., Mangu,P.B., Wade,J.C., Camp-Sorrell,D., Cope,D.G., El Rayes,B.F.,
Gorman,M., Ligibel,J., Mansfield,P., and Levine,M. (2013). Central venous catheter care
for the patient with cancer: american society of clinical oncology clinical practice
guideline. J. Clin. Oncol. 31, 1357-1370.
Schlitt,A., Rupprecht,H.J., Reindl,I., Schubert,S., Hauroeder,B., Carter,J.M., Peetz,D.,
Kropff,S.S., Maegdefessel,L., Russ,M., Schmidt,H., Ebelt,H., Werdan,K., and Buerke,M.
(2008). In-vitro comparison of fondaparinux, unfractionated heparin, and enoxaparin in
preventing cardiac catheter-associated thrombus. Coron. Artery Dis. 19, 279-284.
Schmaier,A.H. (2008). The elusive physiologic role of Factor XII. J. Clin. Invest 118,
3006-3009.
Schmaier,A.H. and McCrae,K.R. (2007). The plasma kallikrein-kinin system: its
evolution from contact activation. J. Thromb. Haemost. 5, 2323-2329.
Schulman,S., Kakkar,A.K., Goldhaber,S.Z., Schellong,S., Eriksson,H., Mismetti,P.,
Vedel,C.A., Friedman,J., Le Maulf,F., Peter,N., and Kearon,C. (2013a). Treatment of
Acute Venous Thromboembolism with Dabigatran or Warfarin and Pooled Analysis.
Circulation 129, 764-772.
223
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Schulman,S., Kearon,C., Kakkar,A.K., Mismetti,P., Schellong,S., Eriksson,H.,
Baanstra,D., Schnee,J., and Goldhaber,S.Z. (2009). Dabigatran versus warfarin in the
treatment of acute venous thromboembolism. N. Engl. J Med. 361, 2342-2352.
Schulman,S., Kearon,C., Kakkar,A.K., Schellong,S., Eriksson,H., Baanstra,D.,
Kvamme,A.M., Friedman,J., Mismetti,P., and Goldhaber,S.Z. (2013b). Extended use of
dabigatran, warfarin, or placebo in venous thromboembolism. N. Engl. J. Med. 368, 709718.
Seifert,B., Romaniuk,P., and Groth,T. (1997). Covalent immobilization of hirudin
improves the haemocompatibility of polylactide-polyglycolide in vitro. Biomaterials 18,
1495-1502.
Silverberg,S.A., Nemerson,Y., and Zur,M. (1977). Kinetics of the activation of bovine
coagulation factor X by components of the extrinsic pathway. Kinetic behavior of twochain factor VII in the presence and absence of tissue factor. J. Biol. Chem. 252, 84818488.
Smith,S.A., Mutch,N.J., Baskar,D., Rohloff,P., Docampo,R., and Morrissey,J.H. (2006).
Polyphosphate modulates blood coagulation and fibrinolysis. Proc. Natl. Acad. Sci. U. S.
A 103, 903-908.
Sousa,S.R., Moradas-Ferreira,P., Saramago,B., Melo,L.V., and Barbosa,M.A. (2004).
Human serum albumin adsorption on TiO2 from single protein solutions and from
plasma. Langmuir 20, 9745-9754.
Stangier,J. and Feuring,M. (2012). Using the HEMOCLOT direct thrombin inhibitor
assay to determine plasma concentrations of dabigatran. Blood Coagul. Fibrinolysis 23,
138-143.
Steg,P.G., Jolly,S.S., Mehta,S.R., Afzal,R., Xavier,D., Rupprecht,H.J., LopezSendon,J.L., Budaj,A., Diaz,R., Avezum,A., Widimsky,P., Rao,S.V., Chrolavicius,S.,
Meeks,B., Joyner,C., Pogue,J., and Yusuf,S. (2010). Low-dose vs standard-dose
unfractionated heparin for percutaneous coronary intervention in acute coronary
syndromes treated with fondaparinux: the FUTURA/OASIS-8 randomized trial. JAMA
304, 1339-1349.
Stone,G.W., Witzenbichler,B., Guagliumi,G., Peruga,J.Z., Brodie,B.R., Dudek,D.,
Kornowski,R., Hartmann,F., Gersh,B.J., Pocock,S.J., Dangas,G., Wong,S.C.,
Kirtane,A.J., Parise,H., and Mehran,R. (2008). Bivalirudin during primary PCI in acute
myocardial infarction. N. Engl. J Med. 358, 2218-2230.
224
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Suggs,L.J., Shive,M.S., Garcia,C.A., Anderson,J.M., and Mikos,A.G. (1999). In vitro
cytotoxicity and in vivo biocompatibility of poly(propylene fumarate-co-ethylene glycol)
hydrogels. J. Biomed. Mater. Res. 46, 22-32.
Sun,L.B., Utoh,J., Moriyama,S., Tagami,H., Okamoto,K., and Kitamura,N. (2001).
Pretreatment of a Dacron graft with tissue factor pathway inhibitor decreases
thrombogenicity and neointimal thickness: a preliminary animal study. ASAIO J. 47, 325328.
Tagalakis,V., Wharin,C., and Kahn,S.R. (2013). Comprehensive update on the prevention
and treatment of venous thromboembolism in cancer patients. Semin. Thromb. Hemost.
39, 127-140.
Tang,Y., Ho,G., Li,Y., Hall,M.A., Hills,R.L., Black,S.C., Liang,Y., and Demarest,K.T.
(2012). Beneficial metabolic effects of CB1R anti-sense oligonucleotide treatment in dietinduced obese AKR/J mice. PLoS. One. 7, e42134.
Tankersley,D.L., Alving,B.M., and Finlayson,J.S. (1983). Activation of factor XII by
dextran sulfate: the basis for an assay of factor XII. Blood 62, 448-456.
Tans,G. and Griffin,J.H. (1982). Properties of sulfatides in factor-XII-dependent contact
activation. Blood 59, 69-75.
Teien,A.N. and Lie,M. (1977). Evaluation of an amidolytic heparin assay method:
increased sensitivity by adding purified antithrombin III. Thromb. Res. 10, 399-410.
Tollefsen,D.M. and Blinder,M.A. (1995). Heparin. In Hematology: Basic Principles and
Practices, A.S.Hoffman, E.J.Benz Jr, B.Furie, H.J.Cohen, and L.E.Silberstein, eds. (New
York: Churchill Livingstone, Inc.), pp. 1802-1813.
Toomey,J.R., Kratzer,K.E., Lasky,N.M., Stanton,J.J., and Broze,G.J., Jr. (1996). Targeted
disruption of the murine tissue factor gene results in embryonic lethality. Blood 88, 15831587.
Toschi,V., Lettino,M., Gallo,R., Badimon,J.J., and Chesebro,J.H. (1996). Biochemistry
and biology of hirudin. Coron. Artery Dis. 7, 420-428.
Tucker,E.I., Marzec,U.M., White,T.C., Hurst,S., Rugonyi,S., McCarty,O.J., Gailani,D.,
Gruber,A., and Hanson,S.R. (2009). Prevention of vascular graft occlusion and thrombusassociated thrombin generation by inhibition of factor XI. Blood 113, 936-944.
Tuddenham,E.G., Pemberton,S., and Cooper,D.N. (1995). Inherited factor VII deficiency:
genetics and molecular pathology. Thromb. Haemost. 74, 313-321.
225
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
van der Kamp,K.W., Hauch,K.D., Feijen,J., and Horbett,T.A. (1995). Contact activation
during incubation of five different polyurethanes or glass in plasma. J. Biomed. Mater.
Res. 29, 1303-1306.
van der Kamp,K.W. and van Oeveren,W. (1994). Factor XII fragment and kallikrein
generation in plasma during incubation with biomaterials. J. Biomed. Mater. Res. 28,
349-352.
van Ryn,J., Stangier,J., Haertter,S., Liesenfeld,K.H., Wienen,W., Feuring,M., and
Clemens,A. (2010). Dabigatran etexilate--a novel, reversible, oral direct thrombin
inhibitor: interpretation of coagulation assays and reversal of anticoagulant activity.
Thromb. Haemost. 103, 1116-1127.
van Veen,J.J., Gatt,A., Cooper,P.C., Kitchen,S., Bowyer,A.E., and Makris,M. (2008).
Corn trypsin inhibitor in fluorogenic thrombin-generation measurements is only
necessary at low tissue factor concentrations and influences the relationship between
factor VIII coagulant activity and thrombogram parameters. Blood Coagul. Fibrinolysis
19, 183-189.
Veith,F.J., Gupta,S.K., Ascer,E., White-Flores,S., Samson,R.H., Scher,L.A., Towne,J.B.,
Bernhard,V.M., Bonier,P., Flinn,W.R., and . (1986). Six-year prospective multicenter
randomized comparison of autologous saphenous vein and expanded
polytetrafluoroethylene grafts in infrainguinal arterial reconstructions. J. Vasc. Surg. 3,
104-114.
Verso,M., Agnelli,G., Bertoglio,S., Di Somma,F.C., Paoletti,F., Ageno,W., Bazzan,M.,
Parise,P., Quintavalla,R., Naglieri,E., Santoro,A., Imberti,D., Soraru,M., and Mosca,S.
(2005). Enoxaparin for the prevention of venous thromboembolism associated with
central vein catheter: a double-blind, placebo-controlled, randomized study in cancer
patients. J. Clin. Oncol. 23, 4057-4062.
Videm,V., Mollnes,T.E., Fosse,E., Mohr,B., Bergh,K., Hagve,T.A., Aasen,A.O., and
Svennevig,J.L. (1999). Heparin-coated cardiopulmonary bypass equipment. I.
Biocompatibility markers and development of complications in a high-risk population. J.
Thorac. Cardiovasc. Surg. 117, 794-802.
Visser,A. and Meuleman,D.G. (1990). Inhibition of the early stages of the thrombin
generation reaction by various glycosaminoglycans. Thromb. Res. 58, 469-479.
Vogler,E.A. (1999). Water and the acute biological response to surfaces. J. Biomater. Sci.
Polym. Ed 10, 1015-1045.
226
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Vogler,E.A., Graper,J.C., Harper,G.R., Sugg,H.W., Lander,L.M., and Brittain,W.J.
(1995a). Contact activation of the plasma coagulation cascade. I. Procoagulant surface
chemistry and energy. J. Biomed. Mater. Res. 29, 1005-1016.
Vogler,E.A., Graper,J.C., Sugg,H.W., Lander,L.M., and Brittain,W.J. (1995b). Contact
activation of the plasma coagulation cascade. II. Protein adsorption to procoagulant
surfaces. J. Biomed. Mater. Res. 29, 1017-1028.
Vogler,E.A., Nadeau,J.G., and Graper,J.C. (1998). Contact activation of the plasma
coagulation cascade. III. Biophysical aspects of thrombin-binding anticoagulants. J.
Biomed. Mater. Res. 40, 92-103.
Vogler,E.A. and Siedlecki,C.A. (2009). Contact activation of blood-plasma coagulation.
Biomaterials 30, 1857-1869.
Vranckx,P., Verheugt,F.W., de Maat,M.P., Ulmans,V.A., Regar,E., Smits,P., ten
Berg,J.M., Lindeboom,W., Jones,R.L., Friedman,J., Reilly,P., and Leebeek,F.W. (2013).
A randomised study of dabigatran in elective percutaneous coronary intervention in stable
coronary artery disease patients. EuroIntervention. 8, 1052-1060.
Vroman,L. (1962). Effect of absorbed proteins on the wettability of hydrophilic and
hydrophobic solids. Nature 196, 476-477.
Wang,P.,
Tan,K.L.,
and
Kang,E.T.
(2000).
Surface
modification
of
poly(tetrafluoroethylene) films via grafting of poly(ethylene glycol) for reduction in
protein adsorption. J. Biomater. Sci. Polym. Ed 11, 169-186.
Warkentin,T.E. (2010). Fondaparinux: does it cause HIT? Can it treat HIT? Expert. Rev.
Hematol. 3, 567-581.
Weiss,H.J., Turitto,V.T., Baumgartner,H.R., Nemerson,Y., and Hoffmann,T. (1989).
Evidence for the presence of tissue factor activity on subendothelium. Blood 73, 968-975.
Weitz,J.I., Hudoba,M., Massel,D., Maraganore,J., and Hirsh,J. (1990). Clot-bound
thrombin is protected from inhibition by heparin-antithrombin III but is susceptible to
inactivation by antithrombin III-independent inhibitors. J. Clin. Invest 86, 385-391.
Wendel,H.P. and Ziemer,G. (1999). Coating-techniques to improve the
hemocompatibility of artificial devices used for extracorporeal circulation. Eur. J.
Cardiothorac. Surg. 16, 342-350.
White,H.D. and Chew,D.P. (2008). Acute myocardial infarction. Lancet 372, 570-584.
227
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Wiebe,E.M., Stafford,A.R., Fredenburgh,J.C., and Weitz,J.I. (2003). Mechanism of
catalysis of inhibition of factor IXa by antithrombin in the presence of heparin or
pentasaccharide. J. Biol. Chem. 278, 35767-35774.
Wienen,W., Stassen,J.M., Priepke,H., Ries,U.J., and Hauel,N. (2007). Antithrombotic and
anticoagulant effects of the direct thrombin inhibitor dabigatran, and its oral prodrug,
dabigatran etexilate, in a rabbit model of venous thrombosis. J. Thromb. Haemost. 5,
1237-1242.
Williams,D.F. (2008). On the mechanisms of biocompatibility. Biomaterials 29, 29412953.
Woodruff,R.S., Xu,Y., Layzer,J., Wu,W., Ogletree,M.L., and Sullenger,B.A. (2013).
Inhibiting the intrinsic pathway of coagulation with a factor XII-targeting RNA aptamer.
J Thromb. Haemost. 11, 1364-1373.
Wu,H., Lima,W.F., Zhang,H., Fan,A., Sun,H., and Crooke,S.T. (2004). Determination of
the role of the human RNase H1 in the pharmacology of DNA-like antisense drugs. J.
Biol. Chem. 279, 17181-17189.
Wufsus,A.R., Macera,N.E., and Neeves,K.B. (2013). The hydraulic permeability of blood
clots as a function of fibrin and platelet density. Biophys. J. 104, 1812-1823.
Wyers,M.C., Phaneuf,M.D., Rzucidlo,E.M., Contreras,M.A., LoGerfo,F.W., and
Quist,W.C. (1999). In vivo assessment of a novel dacron surface with covalently bound
recombinant hirudin. Cardiovasc. Pathol. 8, 153-159.
Yang,Z., Tu,Q., Maitz,M.F., Zhou,S., Wang,J., and Huang,N. (2012). Direct thrombin
inhibitor-bivalirudin functionalized plasma polymerized allylamine coating for improved
biocompatibility of vascular devices. Biomaterials 33, 7959-7971.
Yau,J.W., Liao,P., Fredenburgh,J.C., Stafford,A.R., Revenko,A.S., Monia,B.P., and
Weitz,J.I. (2014). Selective depletion of factor XI or factor XII with antisense
oligonucleotides attenuates catheter thrombosis in rabbits. Blood 123, 2102-2107.
Yau,J.W., Stafford,A.R., Fredenburgh,J.C., Brash,J.L., and Weitz,J.I. (2009).
Immobilization of corn trypsin inhibitor reduces the in vitro procoagulant properties of
catheters. J. Thromb. Haemost. 7, PP-MO-428.
Yau,J.W., Stafford,A.R., Liao,P., Fredenburgh,J.C., Roberts,R., Brash,J.L., and Weitz,J.I.
(2012). Corn trypsin inhibitor coating attenuates the prothrombotic properties of catheters
in vitro and in vivo. Acta Biomater. 8, 4092-4100.
228
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Yau,J.W., Stafford,A.R., Liao,P., Fredenburgh,J.C., Roberts,R., and Weitz,J.I. (2011).
Mechanism of catheter thrombosis: comparison of the antithrombotic activities of
fondaparinux, enoxaparin, and heparin in vitro and in vivo. Blood 118, 6667-6674.
Younis,H.S., Crosby,J., Huh,J.I., Lee,H.S., Rime,S., Monia,B., and Henry,S.P. (2012).
Antisense inhibition of coagulation factor XI prolongs APTT without increased bleeding
risk in cynomolgus monkeys. Blood 119, 2401-2408.
Yusuf,S., Mehta,S.R., Chrolavicius,S., Afzal,R., Pogue,J., Granger,C.B., Budaj,A.,
Peters,R.J., Bassand,J.P., Wallentin,L., Joyner,C., and Fox,K.A. (2006a). Comparison of
fondaparinux and enoxaparin in acute coronary syndromes. N. Engl. J. Med. 354, 14641476.
Yusuf,S., Mehta,S.R., Chrolavicius,S., Afzal,R., Pogue,J., Granger,C.B., Budaj,A.,
Peters,R.J., Bassand,J.P., Wallentin,L., Joyner,C., and Fox,K.A. (2006b). Effects of
fondaparinux on mortality and reinfarction in patients with acute ST-segment elevation
myocardial infarction: the OASIS-6 randomized trial. JAMA 295, 1519-1530.
Zhang,H., Lowenberg,E.C., Crosby,J.R., MacLeod,A.R., Zhao,C., Gao,D., Black,C.,
Revenko,A.S., Meijers,J.C., Stroes,E.S., Levi,M., and Monia,B.P. (2010). Inhibition of
the intrinsic coagulation pathway factor XI by antisense oligonucleotides: a novel
antithrombotic strategy with lowered bleeding risk. Blood 116, 4684-4692.
Zhuo,R., Miller,R., Bussard,K.M., Siedlecki,C.A., and Vogler,E.A. (2005). Procoagulant
stimulus processing by the intrinsic pathway of blood plasma coagulation. Biomaterials
26, 2965-2973.
Zhuo,R., Siedlecki,C.A., and Vogler,E.A. (2006). Autoactivation of blood factor XII at
hydrophilic and hydrophobic surfaces. Biomaterials 27, 4325-4332.
Zhuo,R., Siedlecki,C.A., and Vogler,E.A. (2007). Competitive-protein adsorption in
contact activation of blood factor XII. Biomaterials 28, 4355-4369.
229
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Appendix: Publications and Abstracts
Journal Publications (Peer-reviewed)
Shawn M. Petrik, Peng Liao, Jonathan W. Yau. A novel method for exterior port
placement of indwelling jugular venous catheters in rabbits. Laboratory Animal Science
Professional. 2014; (accepted)
Jonathan W. Yau, Peng Liao, James C. Fredenburgh, Robin S. Roberts, and Jeffrey I.
Weitz. Only high levels of dabigatran attenuate catheter thrombosis in vitro and in
rabbits. Thrombosis and Haemostasis. 2014; 112(1): 79-86.
Jonathan W. Yau, Peng Liao, James C. Fredenburgh, Alan R. Stafford, Alexey S.
Revenko, Brett P. Monia, and Jeffrey I. Weitz. Selective depletion of factor XI or factor
XII with antisense oligonucleotides attenuates catheter thrombosis in rabbits. Blood.
2014; 123(13): 2102-2107.
Jonathan W. Yau, Alan R. Stafford, Peng Liao, James C. Fredenburgh, Robin S.
Roberts, John L. Brash, and Jeffrey I. Weitz. Corn trypsin inhibitor coating attenuates the
prothrombotic properties of catheters in vitro and in vivo. Acta Biomaterialia. 2012;
8(11): 4092-4100.
Sara Alibeik, Shiping Zhu, Jonathan W. Yau, Jeffrey I. Weitz, and John L. Brash.
Modification of polyurethane with polyethylene glycol-corn trypsin inhibitor for
inhibition of factor XIIa in blood contact. Journal of Biomaterials Science: Polymer
Edition. 2012; 23(15): 1981-1993.
Jonathan W. Yau, Alan R. Stafford, Peng Liao, James C. Fredenburgh, Robin Roberts,
and Jeffrey I. Weitz. Mechanism of catheter thrombosis: Comparison of the
antithrombotic activities of fondaparinux, enoxaparin, and heparin in vitro and in vivo.
Blood. 2011; 118(25): 6667-6674.
Sara Alibeik, Shiping Zhu, Jonathan W. Yau, Jeffrey I. Weitz, and John L. Brash. Dual
surface modification with PEG and corn trypsin inhibitor (CTI): Effect of PEG:CTI ratio
on protein resistance and anticoagulant properties. Journal of Biomedical Research Part
A. 2011; 100A: 856-862.
Sara Alibeik, Shiping Zhu, Jonathan W. Yau, Jeffrey I. Weitz, and John L. Brash.
Surface modification with polyethylene glycol-corn trypsin inhibitor conjugate for
inhibition of contact factor pathway on blood-contact surfaces. Acta Biomaterialia. 2011;
7(12): 4177-4186.
230
Ph.D. Thesis – J. Yau
McMaster University – Biomedical Engineering
Jessica L. MacQuarrie, Alan R. Stafford, Jonathan W. Yau, Beverly A. Leslie, Trang T.
Vu, James C. Fredenburgh, and Jeffrey I. Weitz. Histidine-Rich Glycoprotein Binds
Factor XIIa with High Affinity and Inhibits Contact-initiated Coagulation. Blood. 2011;
117(15): 4134-4141.
Abstracts (Peer-reviewed)
Jonathan W. Yau, Peng Liao, Alan R. Stafford, James C. Fredenburgh, Alexey S.
Revenko, Brett Monia, and Jeffrey I. Weitz. Selective depletion of contact factors with
antisense oligonucleotides attenuates catheter thrombosis in rabbits. Journal of
Thrombosis and Haemostasis. 2013; 11(Supplement 2): Abstract# AS13.2.
Jonathan W. Yau, Alan R. Stafford, Peng Liao, James C. Fredenburgh, Robin Roberts,
and Jeffrey I. Weitz. Catheter thrombosis with fondaparinux is prevented by thrombin
inhibition in vitro and in rabbits. Journal of Thrombosis and Haemostasis. 2011;
9(Supplement 2): Abstract# P-WE-148.
Jonathan W. Yau, Alan R. Stafford, Peng Liao, James C. Fredenburgh, Robin Roberts,
John L. Brash, and Jeffrey I. Weitz. Corn trypsin inhibitor coating attenuates the
prothrombotic properties of coronary catheters in vitro and in rabbits. Journal of
Thrombosis and Haemostasis. 2011; 9(Supplement 2): Abstract# P-TH-136.
Jonathan W. Yau, Alan R. Stafford, James C. Fredenburgh, John L. Brash, and Jeffrey I.
Weitz. Immobilization of corn trypsin inhibitor reduces the in vitro procoagulant
properties of catheters. Journal of Thrombosis and Haemostasis. 2009; 7(Supplement 2):
Abstract #PP-MO-428.
231