Sample Assignment 1(a)

advertisement
U5: Genetics
T2(b): Molecular Biology
From Gene to Protein
A7(a): Cracking the Genetic Code
The RNA Codon
Name _________________________________________________
Period _____ Date _______________________
Objective: To construct an explanation based on reasoning for how the structure of nucleic
acids determines the structure of proteins.
I. Anticipatory Set (Warm-up)
An example of a code is binary code, used in computer science. Computers
communicate in binary language, using just 1s and 0s. People communicate through text,
based on characters. For computers and people to talk to one another, one language must
be translated to the other. Different combinations of two digits, 1 and 0, arranged in blocks
of eight, can be used to represent the different characters. For example, the combination
01000001 codes for upper case “A”. A total of 28 = 256 combinations are available for
characters, more than are needed.
1. There are ____ binary digits, 1 and 0.
2. There are at least ____ characters that need to be coded for.
3. In computer science, different combinations of ____ 1s and 0s can represent each of a
possible _____ characters.
U5: Genetics
A7(a): Cracking the Genetic Code
T2(b): Molecular Biology
The RNA Codon
From Gene to Protein
4. Using the handout key, translate the following message from binary to text:
01000100010011100100000100100000011010010111001100100000011101000
11010000110010100100000011000110110111101100100011001010010000001
101111011001100010000001101100011010010110011001100101
5. Information encoded in binary language can be ____________________________ into text.
II. Background
Biologists suspected that the information encoded in nucleic acids is translated into
proteins, which do the work of the cells. Just as binary code is made of long chains of 1s
and 0s, ______________________ are made of long chains of nucleotides. Just as text is made of
long chains of characters, ______________________ are made of long chains of amino acids.
There were 4 types of nucleotides that needed to code for 20 types of amino acids. The
puzzle was to figure out (a) how many combinations of nucleotides represented each of 20
amino acids and (b) how many nucleotides were in each combination.
U5: Genetics
T2(b): Molecular Biology
From Gene to Protein

A7(a): Cracking the Genetic Code
The RNA Codon
Sample DNA sequence:
AAATCGGGAAATGGCAGTACCAATAGCACA
TTTAGCCCTTTACCGTCATGGTTATCGTGT

Complementary RNA sequence:

Protein sequence:
Phe-Ser-Pro-Leu-Pro-Ser-Try-Leu-Ser-Cys
U5: Genetics
T2(b): Molecular Biology
From Gene to Protein
A7(a): Cracking the Genetic Code
The RNA Codon
III. Activity: Using Reasoning to Crack the Code
1. There are _____ types of nucleotides found in nucleic acids.
2. There are _____ types of amino acids found in protein.
A. Hypothesis 1: A single nucleotide codes for each amino acid
3. If 1 nucleotide codes for 1 amino acid, then a total of 41 = _____ amino acids can be
coded for.

Example: A
4. Does this coding scheme work? Explain.
B. Hypothesis 2: A combination of 2 nucleotides codes for each amino acid.
5. Write out each unique pair of nucleotides below. Hint: Arrange the nucleotides on
the lab bench in groups of 2 until you have all possible unique combinations.

Example: AA
6. There are 42 = _____ unique combinations of nucleotide pairs. Each pair of
nucleotides can represent each of _____ amino acids.
7. Does this coding scheme work? Explain.
U5: Genetics
T2(b): Molecular Biology
From Gene to Protein
A7(a): Cracking the Genetic Code
The RNA Codon
C. Hypothesis 3: A combination of 3 nucleotides codes for each amino acid.
8. Write out each unique triplet of nucleotides below. Hint: Arrange the nucleotides on
the lab bench in groups of 3 until you have all possible unique combinations.

Example: AAA
9. There are 43 = _____ unique combinations of nucleotide triplets. Each triplet of
nucleotides can represent each of _____ amino acids.
10. Does this coding scheme work? Explain.
D. Hypothesis 4: A combination of 4 nucleotides codes for each amino acid.
11. There are ______ = ______ unique combinations of nucleotide quadruplets. Each
quadruplet of nucleotides can represent each of _____ amino acids.
U5: Genetics
A7(a): Cracking the Genetic Code
T2(b): Molecular Biology
The RNA Codon
From Gene to Protein
12. Does this coding scheme work? Is it necessary to have this many combinations?
Explain.
IV. Drawing Conclusions Using Argument from Reasoning
13. Construct an explanation based on reasoning for how the structure of nucleic acids
could determine the structure of proteins. In your answer,
a. Identify the building blocks of nucleic acid and protein and describe how
they are arranged.
b. Identify the best hypothesis that explains how nucleic acids code for
proteins:
c. Explain why this is the best hypothesis.
d. Explain why the other hypotheses are not the best.
Image Sources:
http://www.biotopics.co.uk/JmolApplet/jcontentstable.html
http://www.commons.wikimedia.org
Download