Activity 1.3.1: Student Response Sheet
PART A- Restriction Enzymes
Restriction enzymes are a tool that allows us to pinpoint human identity down to single
differences in our DNA. Work through the following simulation so you can see these
molecular scissors in action.
Find out more about restriction enzymes by viewing the animation and reading the
article listed below.
o Dolan DNA Learning Center: Restriction Enzymes
http://www.dnalc.org/ddnalc/resources/restriction.html
o Access Excellence Classic Collection: Restriction Enzymes
Background Paper
http://www.accessexcellence.org/AE/AEC/CC/restriction.php
1. From what organism are restriction enzymes derived? What role do these enzymes
play in this natural host?
2. In this lab activity, you are digesting your DNA samples with two specific restriction
enzymes- EcoRI and HindIII. How does each of these enzymes get its unique names?
3. Each enzyme recognizes a very specific sequence in DNA.
For example, the enzyme PstI recognizes the sequence:
CTGCAG
GACGTC
The enzyme scans DNA for this sequence and makes a cut as indicated by the arrows.
Visit the list of restriction enzymes found at the bottom of the page on
http://en.wikipedia.org/wiki/Restriction_enzymes. Find the unique sequence
(restriction site) that is recognized by EcoRI and by HindIII. Write the double-stranded
© 2014 Project Lead The Way, Inc.
Human Body Systems Activity 1.3.1 Student Response Sheet – Page 1
sequence below and draw an arrow between the base pairs to indicate where the
enzyme would make its cut.
EcoRI:
HindIII:
4. What do you notice about each restriction site? What does the word palindrome
mean?
5. Using the information above, digest the DNA samples for Person 1 and Person 2
using EcoRI. Scan the strand for the restriction site and draw an arrow any place this
enzyme would make a cut. Beneath each strand indicate the number of fragments that
would be created and also the size of each fragment (in base pairs). Some of the pieces
will have bases overhanging the edge. Use only the bases that are paired up when
completing your count. For example, for a piece that looks like
ATTCAACCC
GTTGGGAA
the size of the fragment would be listed as 6 base pairs (6bp).
Person 1:
GGAATTAAGCTTATTGAATTCTTATAGAATTCGGGGCCCAAGCTTATGAATTCAATT
CCTTAATTCGAATAACTTAAGAATATCTTAAGCCCCGGGTTCGAATACTTAAGTTAA
Number of restriction fragments (pieces of DNA after digestion): _________
Size of restriction fragments (in bp) - listed from largest to smallest
______________________________________________________________________
© 2014 Project Lead The Way, Inc.
Human Body Systems Activity 1.3.1 Student Response Sheet – Page 2
Person 2:
CCATATAGAATTCAAGCTTAAGAATTCGGGGGAACGTTGAATTCAATTAATTGGG
GGTATATCTTAAGTTCGAATTCTTAAGCCCCCTTGCAACTTAAGTTAATTAACCC
Number of restriction fragments (pieces of DNA after digestion): _________
Size of restriction fragments (in bp) - listed from largest to smallest
______________________________________________________________________
PART B: Gel Electrophoresis of Restriction Fragments
After you have reviewed the principles of electrophoresis, use what you know to
complete the following:
1. “Run” your restriction fragments from both Person 1 and Person 2 on the gel drawn
below. Use the DNA marker lane to help you draw in the bands you would see in each
lane of the gel.
2. Place a large “+” on the end of the gel diagram where the positive electrode would
go. Place a large “-“ on the end of the gel diagram where the negative electrode would
go. Using what you know about the structure of DNA, explain why this placement is
crucial to separating the fragments.
© 2014 Project Lead The Way, Inc.
Human Body Systems Activity 1.3.1 Student Response Sheet – Page 3
3. Use an asterisk (*) to indicate the smallest fragment shown on the gel.
4. Compare the DNA fingerprint of Person 1 and Person 2. Explain how this fingerprint
would have looked different if you had digested the DNA of each person with HindIII
instead of EcoRI.
Think about these principles as you analyze your actual gel results from the missing
person experiment. Remember that in the actual lab you digested each sample with two
different restriction enzymes in separate reactions.
© 2014 Project Lead The Way, Inc.
Human Body Systems Activity 1.3.1 Student Response Sheet – Page 4