Supplementary Materials and Methods
Plasmid Construction
The plasmid pA58c-TR (Supplementary Figure 1) used for constructing the fatty acid producing E.
coli strain was constructed from pE8a-fadR and pKS1 using a modified Golden Gate DNA
assembly method (Steen et al., 2010; Zhang et al., 2012a; Zhang et al., 2012b). The araC gene
together with the PBAD-fadR operon from pE8a-fadR was PCR amplified using the following
primers: FZ_fRP5, TTTTTTGGTCTCACTCATTATGACAACTT GAC GGCTACATC; FZ_fRP3,
TTTTTTGGTCTCACGAAGCGGGGTTTTTTGCGTTTGGA TCCT TATCGCCCCTG. Similarly,
pKS1 was linearized by PCR amplification using the following primers: FZ_A5c3,
TTTTTTGGTCTCATGAGCGCAACGCAATTAATGTAAG;
FZ_A5c5,
TTTTTTGGTCTCATTCGGCGGGGTTTTTTCGCCGATCTTCCCCATCGGTGP CR. Products
were purified and followed by one-pot BsaI digestion and DNA T4 ligase ligation. A synthetic
terminator BBa_B1002 (Registry for Standard Biological Parts, http://partsregistry. org/Main_Page)
was split and embedded in both primer FZ_fRP3 and FZ_A5c5. Upon ligation, BBa_B1002 was
placed 3’ of the fadR gene. The E. coli fadR is under the control of PBAD. A truncated version of
the E. coli thioesterase gene tesA ('tesA; leader sequence deleted) is under the control of PlacUV5.
Composition of M9 MOPS Minimal Medium
M9 MOPS minimal medium (Neidhardt et al., 1974) was used in this study. The medium contained
per liter: 30 g [1,2-13C]glucose (99% isotopic purity, Sigma-Aldrich), 6.8 g Na2HPO4, 3.0 g
KH2PO4, 0.58 g NaCl, 3.96 g (NH4)2SO4, supplemented with 50 ml of 1 M MOPS with pH
adjusted to 7.4 with KOH, 1 ml of 1 M MgSO4, 1 ml of 0.1 mM CaCl2, 1ml of trace elemental
solution containing 2.4 g MnSO4·4H2O, 2.4 g ZnSO4·7H2O, 0.26 g CoCl2, 0.48 g CuSO4·5H2O,
0.24 g Na2MoO4·2H2O, 3 g H3BO3, 8.4 g FeSO4·7H2O, 20.6 g Na3EDTA per liter, 10 ml of RPMI1640 [100X] vitamin solution (R7256, Sigma-Aldrich) and 1 ml of 25 mg∙l-1 of chloramphenicol.
1
The supplements were filter-sterilized and added separately. All chemicals were purchased from
Sigma-Aldrich.
Analysis of Cell Growth and Growth Parameters
The optical density of the cell culture was measured on a Cary 60 UV-Vis spectrophotometer
(Agilent Technologies) at 600 nm (OD600). The relationship of dry cell weight (DCW) and OD600
was determined from 5 ml of chilled culture broth of known OD600 in triplicate (0.34 g·l-1·OD600-1
was determined). Exactly, the culture broth was centrifuged at 13,000 × g for 10 min at 4 °C,
washed three times with 0.9% NaCl, resuspended in 5 ml of double distilled water, and dried on a
pre-weighted aluminum plate at 90 °C to constant weight. Glucose and acetate concentrations were
measured using commercial kits (Roche). The rates of biomass formation, substrate consumption
and product formation were determined by linear regression of the concentrations of the
corresponding substances versus time during the exponential growth phase with the rates as the
regression coefficients (Sauer et al., 1999). The yields of biomass, fatty acid, and acetic acid on
glucose were determined as the regression coefficients of the concentrations of biomass, acetic acid,
and fatty acid versus the concentration of glucose during the time course of the exponential growth
phase. The biomass elemental compositions of the control and the engineered E. coli were assumed
to be the same and remained constant during cell growth (Leighty and Antoniewicz, 2012).
Analysis of Fatty Acid
175 μl of culture spiked with 100 mg∙l-1 of pentadecanoic acid (C15:0) as the internal standard was
acidified using 5 µl of concentrated HCl and extracted with 400 µl of methanol-chloroform (1:1).
The organic phase containing fatty acids separated by centrifugation was transferred to a new tube
and the solvent evaporated under vacuum. Fatty acids were methylated in a solution containing 10
µl of concentrated HCl, 20 µl of 2 M of (trimethyulsily) diazomethane solution and 170 µl of
methanol at 40 ºC for 2 h. The methyl esters of fatty acids were extracted by dual phase separation
in 200 µl of 0.9% NaCl and 350 µl of ethyl acetate and analyzed using a gas chromatograph mass
2
spectrometer (GC-MS) (Hewlett Packard 7890A and 5975C, Agilent Technologies) equipped with a
DB5-MS column (J&W Scientific). The GC-MS program was as follows: the column temperature
initially held at 80 ºC for 1 min, raised to 280 ºC at 30 ºC·min-1 and held at 280 ºC for 3 min.
Helium was used as the carrier gas. The mass spectra were analyzed using the Enhanced Data
Analysis software (Agilent Technologies). The fatty acids were quantified based on the standard
curve of methyl fatty acid (F.A.M.E. Mix, C8-C24, Sigma-Aldrich).
References
Neidhardt, FC, Bloch, PL, Smith, DF. 1974. Culture Medium for Enterobacteria. J Bacteriol
119:736-747.
Sauer, U, Lasko, DR, Fiaux, J, Hochuli, M, Glaser, R, Szyperski, T, Wüthrich, K, Bailey, JE. 1999.
Metabolic flux ratio analysis of genetic and environmental modulations of Escherichia coli
central carbon metabolism. J Bacteriol 181:6679-6688.
Steen, EJ, Kang, Y, Bokinsky, G, Hu, Z, Schirmer, A, McClure, A, del Cardayre, SB, Keasling, JD.
2010. Microbial production of fatty-acid-derived fuels and chemicals from plant biomass.
Nature 463:559-562.
Zhang, F, Carothers, JM, Keasling, JD. 2012a. Design of a dynamic sensor-regulator system for
production of chemicals and fuels derived from fatty acids. Nat Biotechnol 30:354-359.
Zhang, F, Ouellet, M, Batth, TS, Adams, PD, Petzold, CJ, Mukhopadhyay, A, Keasling, JD. 2012b.
Enhancing fatty acid production by the expression of the regulatory transcription factor FadR.
Metab Eng 14:653-660.
3