jbi12320-sup-0002-AppendixS2

advertisement
1
SUPPORTING INFORMATION
The role of physical geography and habitat type in shaping the biogeographical
history of a recent radiation of Neotropical marsupials (Thylamys: Didelphidae)
Thomas C. Giarla and Sharon A. Jansa
Journal of Biogeography
Appendix S2 Supplementary methods.
Designing new intron markers
Table S1 Primers used to amplify and sequence introns from four protein-coding genes. These
markers were developed using the same bioinformatics protocol as used to develop the OGT
marker (Giarla et al., 2014).
Primer name
PPIC-F1
PPIC-R1
SLC38-F1
SLC38-R1
P4HB-F1
P4HB-R1
KREMEN2-F1
KREMEN2-R1
Primer sequence
5'- CCCAAGACTGTGGAGAATTTC
5'- CAACAGTAAAGTCTCCACCTTGAA
5'- TGGTTTCAGTGGTGCTTATT
5'- CAATCAGAAAGAACACCATACACA
5'- GCAGTTAAGGTTCACAGTTTCCCT
5'- ATCTTGTCCACCACTCTCCAG
5'- TGTTGCTGTTGCTACCCCCTAACCT
5'- GGTAGTCCGCCCCATTCACCTGG
Choice of biogeographical areas
The biome-based areas are modified from Olson et al.’s (2001) global terrestrial ecoregion
designations. We defined the barrier-based areas by the natural boundaries formed by the large
rivers of the Río de la Plata basin (the Río Paraguay, Río Paraná and Río Uruguay) and, further
west, the western cordillera of the Andes. The Río de la Plata basin is among the largest river
basins in the world, and the three rivers we chose to focus on are the largest constituent rivers in
the basin when measured by overall discharge rate (Garcia & Vargas, 1996). The north-eastern
part of Argentina bounded by these three rivers on all sides is commonly referred to as the
‘Mesopotamian Region’, and we use that terminology here as well. Finally, we note that the
boundary between ‘West of the Río Paraguay’ and ‘East of the Río Paraguay’ becomes irrelevant
north of the Paraguay–Bolivia border, where only T. karimii occurs north of the source of the Río
Paraguay in Brazil.
2
Determining area assignments for Thylamys taxa
The geographical range of each taxon included in this study (including morphologically cryptic
haplogroups within the named species T. pallidior, T. pusillus, T. sponsorius, and T. venustus)
was based on georeferenced Thylamys and Lestodelphys collecting localities recorded in recent
taxonomic and phylogenetic studies (Fig. S2.1; Braun et al., 2005; Carmignotto & Monfort,
2006; Teta et al., 2009; Giarla et al., 2010; Formoso et al., 2011). In order to assign previously
sequenced individuals to intraspecific haplogroups defined by Giarla et al. (2010), all CYTB
sequences from Braun et al. (2005) and Teta et al. (2009) were downloaded from GenBank and
combined in a single dataset with CYTB sequences from Giarla et al. (2010) for phylogenetic
analysis. This dataset of 181 sequences [including five outgroup sequences from Giarla et al.
(2010)] was analysed in a Bayesian framework using MRBAYES 3.2 (Ronquist et al., 2012). The
GTR+I+ nucleotide substitution model fit the data best according to JMODELTEST 2.1.3
(Darriba et al., 2012), and this model was specified for the full CYTB dataset in MRBAYES for a
single Markov chain Monte Carlo (MCMC) run of 20 million generations with four Metropoliscoupled chains. Previously unassigned sequences from Braun et al. (2005) and Teta et al. (2009)
clustered unambiguously with the haplogroups defined in Giarla et al. (2010) and were assigned
accordingly (Fig. S2.2). Once all sequences were assigned to species or haplogroups, the
georeferenced localities were added to the range map (Fig. S2.1).
Several taxa discussed in Giarla et al. (2010) are based on specimen records from a
limited portion of the suspected total range of the haplogroup (e.g. Thylamys pusillus A, B, and
C). In order to expand the number of localities for these poorly sampled haplogroups,
unsequenced material from Teta et al. (2009) and Formoso et al. (2011) was considered. Teta et
al. include locality records of specimens from several taxa considered synonyms of T. pusillus by
Giarla et al.: T. citellus, T. bruchi, and T. pulchellus. As discussed in Giarla et al. (2010), T.
citellus corresponds to T. pusillus C and both T. bruchi and T. pulchellus correspond to T.
pusillus B. Specimens referred to simply as ‘T. pusillus’ by Teta et al. correspond to T. pusillus
A as defined by Giarla et al. (2010). Although the assignment of these specimens to particular
haplogroups would best be accomplished by phylogenetic analysis of DNA sequences, the
geographical distributions of unsequenced specimens concord with sequenced specimens and
most occur within a single defined area (e.g. tropical savannah). ‘Thylamys pusillus’ localities
3
from Teta et al. all occur north of the Río Bermejo and west of the Río Paraguay, in the same
region as the sequenced specimens assigned to T. pusillus A by Giarla et al. Teta et al.’s T.
bruchi and T. pulchellus locales are all recorded in central Argentina south of the Río Bermejo
and west of the Río Paraguay, the same broad area inhabited by Giarla et al.’s T. pusillus B.
Finally, Teta et al.’s T. citellus localities all occur between the Ríos Paraná and Uruguay in
north-eastern Argentina, the same isolated area as the sequenced specimens assigned to T.
pusillus C by Giarla et al. Given these distributions, we assigned Teta et al.’s unsequenced
material to the corresponding Giarla et al. haplogroup and add the georeferenced localities to the
range map (Fig. S2.1).
Although Giarla et al. (2010) sequenced a broadly distributed sample of 30 T. pallidior
individuals, the southern and eastern extent of T. pallidior haplogroup B’s range was not robustly
sampled. As such, all T. pallidior localities from Formoso et al. (2011) were assigned to
haplogroup B based on their geographical distribution in the far south of T. pallidior B’s range.
We assign Formoso et al.’s T. pallidior samples to T. pallidior B because these individuals could
not plausibly be assigned to the more northerly haplogroup A. Finally, we also included all
records of Lestodelphys halli reported in Formoso et al. (2011) to bolster our sample size for that
taxon.
Verification and modification of biogeographical area maps
Satellite imagery from Google Earth was used to verify and refine ecoregion assignments for
localities near ecoregion boundaries and in regions where Olson et al.’s (2001) line maps were
not sufficiently precise (Särkinen et al., 2011). Biome assignments for Thylamys pallidior B
were revised based on satellite imagery. Six T. pallidior B collecting locales occur within the
boundaries of Olson et al.’s ‘Tropical and Subtropical Savannah, Grassland, and Shrubland’
biome. Upon closer inspection, each record can be found to occur on isolated mountain ridges
within the Sierras de Córdoba in San Luis and Córdoba provinces. Satellite imagery from these
localities show that these isolated montane habitats are quite distinct from the surrounding
lowlands and would be more appropriately classified in montane or temperate biomes. As such,
T. pallidior is not assigned to the Tropical Savannah biome.
We did not follow Olson et al. (2001) and distinguish between montane elements of
moist broadleaf forests and tropical dry forests in southern Bolivia and northern Argentina
4
(Yungas forests). These two forest types distinguished by Olson et al. are contiguous, more
similar to each other than to any other adjacent biomes (e.g. montane grasslands and lowland
savannah), and so different from the other more open habitats that Thylamys inhabits that we join
them into the general category of ‘Montane Forest’. In addition, we did not consider Olson et
al.’s Atlantic forest and flooded grasslands ecoregions in our analysis, because Thylamys species
that are purported to inhabit these areas based on collecting localities all occur near the
boundaries of included biomes and likely represent marginal populations.
REFERENCES
Braun, J.K., Van Den Bussche, R.A., Morton, P.K. & Mares, M.A. (2005) Phylogenetic and
biogeographic relationships of mouse opossums Thylamys (Didelphimorphia, Didelphidae)
in southern South America. Journal of Mammalogy, 86, 147–159.
Carmignotto, A.P. & Monfort, T. (2006) Taxonomy and distribution of the Brazilian species of
Thylamys (Didelphimorphia: Didelphidae). Mammalia, 70, 126–144.
Darriba, D., Taboada, G.L., Doallo, R. & Posada, D. (2012) jModelTest 2: more models, new
heuristics and parallel computing. Nature Methods, 9, 772.
Formoso, A.E., Sauthier, D.E.U., Teta, P. & Pardiñas, U.F.J. (2011) Dense-sampling reveals a
complex distributional pattern between the southernmost marsupials Lestodelphys and
Thylamys in Patagonia, Argentina. Mammalia, 75, 371–379.
Garcia, N.O. & Vargas, W.M. (1996) The spatial variability of runoff and precipitation in the
Río de la Plata basin. Hydrological Sciences Journal, 41, 279–299.
Giarla, T.C., Voss, R.S. & Jansa, S.A. (2010) Species limits and phylogenetic relationships in the
didelphid marsupial genus Thylamys based on mitochondrial DNA sequences and
morphology. Bulletin of the American Museum of Natural History, 346, 1–67.
Giarla, T.C., Voss, R.S. & Jansa, S.A. (2014) Hidden diversity in the Andes: comparison of
species delimitation methods in montane marsupials. Molecular Phylogenetics and
5
Evolution, 70, 137-151.
Olson, D.M., Dinerstein, E., Wikramanayake, E.D., Burgess, N.D., Powell, G.V.N., Underwood,
E.C., D'Amico, J.A., Itoua, I., Strand H .E., Morrison, J.C., Loucks, C.J., Allnutt, T.F.,
Ricketts, T.H., Kura, Y., Lamoreux, J.F., Wettengel, W.W., Hedao, P. & Kassem, K.R.
(2001) Terrestrial ecoregions of the world: a new map of life on Earth. BioScience, 51, 933–
938.
Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling, A., Hohna, S., Larget, B.,
Liu, L., Suchard, M.A. & Huelsenbeck, J.P. (2012) MrBayes 3.2: efficient Bayesian
phylogenetic inference and model choice across a large model space. Systematic Biology, 61,
539–542.
Särkinen, T., Pennington, R.T., Lavin, M., Simon, M.F. & Hughes, C.E. (2011) Evolutionary
islands in the Andes: persistence and isolation explain high endemism in Andean dry tropical
forests. Journal of Biogeography, 39, 884–900.
Teta, P., D'Elía, G., Flores, D.A. & de La Sancha, N. (2009) Diversity and distribution of the
mouse opossums of the genus Thylamys (Didelphimorphia, Didelphidae) in north-eastern
and central Argentina. Gayana, 73, 180–199.
6
Figure S2.1 Terrestrial biomes of central and southern South America from Olson et al. (2001),
with Thylamys and Lestodelphys collecting localities. Each species receives its own symbol
colour, with different shades of that colour and symbols (circle, square, diamond) defining
intraspecific haplogroups.
-75
-70
-65
-60
-55
-50
-45
-40
-10
-15
-20
P
ilc
om
ayo
Riv
Berm
er
ejo
Ri
ve
r
Paragu
ay R
i
-25
v
gu
a
ru
r
ive
U
ar
a n á Rive
r
er
-30
yR
P
Lestodelphys
macrurus
velutinus
tatei
karimii
sp.
pusillus A
elegans
pusillus B*
pallidior A
pusillus C**
pallidior B
venustus A
sponsorius A
venustus B
sponsorius B
venustus C
-35
*Includes “bruchi” and “pulchellus”
**Includes “citellus”
Montane Grasslands and Shrublands
Includes High Monte, Puna, and Andean Steppe
Temperate Grasslands, Savannas, and Shrublands
Includes Patagonian Steppe, Low Monte, Espinal, and Pampas
-40
Tropical and Subtropical Grasslands, Savannas, and Shrublands
Includes Uruguayan Savanna, Chaco, Beni Savanna, and Cerrado
Flooded Grasslands and Savannas
Includes Paraná Flooded Savanna, Mesopotamian Savanna, and Pantanal
Deserts and Xeric Shrublands
Include Atacama Desert, Sechura Desert, and Caatinga
Tropical and Subtropical Moist Broadleaf Forests
-45
Includes Yungas Forest, Amazonian Forest, and Atlantic Forest
Tropical and Subtropical Dry Broadleaf Forests
Includes Montane Dry Forest, Chiquitano Dry Forest, ad Atlantic Dry Forest
Temperate Broadleaf and Mixed Forests
Includes Valdivian Temperate Forest and Magellanic Subpolar Forests
Mediterranean Forests, Woodlands, and Scrub
Includes Chilean Matorral
7
Figure S2.2. Phylogenetic tree of Thylamys and Lestodelphys based on Bayesian analysis of
CYTB sequences gathered from GenBank. Filled circles () represent sequences generated by
Braun et al. (2005) and Teta et al. (2009). Only posterior probabilities at key nodes are shown.
Tips on the tree are labelled with a taxon identifier, voucher number, and GenBank number.
Scale bar units are in substitutions per site.
Download