APPENDIX
Supplemental Methods
Cell Culture: Human aortic endothelial cells (HAECs) (Cell Applications, San Diego, CA)
were maintained in endothelial cell growth medium (Cell Applications) and passages 2
and 8 were used for all experiments. For all experiments, endothelial cells were washed
once and the appropriate reagents were applied for 24 hours.
Quantification of HAEC Proliferation: Proliferation was quantified by the BrdU Cell
Proliferation Assay (Merck KGaA, Darmstadt, Germany) at 24 hours as previously
described (1). This assay was conducted in 96 well culture plates and proliferation was
quantified by measuring absorbance at dual wavelengths of 450-540 nm. Results were
normalized to HAEC controls.
Apoptosis Assay: 24 hours after drug treatment were applied in endothelial cell basal
medium (Cell Applications), HAEC were trypsinized, centrifuged, and resuspended at a
concentration of 106 cells/ml in binding buffer (BD Bioscience, San Jose, CA). 100 l of
the suspension was stained with 5 l Annexin-FITC and 2 l Propridium Iodide (BD
Bioscience, San Jose, CA) and was incubated for 15 minutes at room temperature and
an additional 400 l of binding buffer was added. In addition a positive control was
constructed from heat shocked HAEC and similarly stained. Flow cytometry was used to
1
analyze cells stained positive for Annexin-FITC and Propridium Iodide indicating cells
undergoing late/definite apoptosis.
Cell Viability Assay: Cell viability was quantified with the MTT Assay (Trevigen,
Gaithersburg, MD) at 24 hours after drug treatment in basal media (2). This assay was
conducted in 96 well culture plates and proliferation was quantified by measuring
absorbance at 570 nm. Results were normalized to HAEC controls.
Pharmacologic Inhibition of mTOR in Cultured Human Aortic Endothelial Cells:
Endothelial cells were exposed to increasing doses of Mf (0 – 50 mM), SRL (0 – 500
nM), EVL (0 – 500 nM), A769662 (0 – 1000 M) and 5-aminoimidazole-4-carboxamide1-b-d-ribofuranosyl 3’-5’cyclic-monophosphate (AICAR) (0 – 10 mM) in addition to full
serum growth media (Sigma-Aldrich). HAEC proliferation was measured at 24 hours to
establish a proliferation dose response curve. Doses of Mf (30 mM), A769662 (100 M)
and AICAR (2 mM) that inhibited ~ 50% of cell proliferation (as compared to control)
was used for subsequent experiments. A dose of 30 mM Mf was also approximated
steady state serum concentrations in patients on chronic Mf therapy (3). SRL was
chosen for mTOR inhibition because arterial wall tissue levels after SRL eluting stent
placement have been determined in previous studies in the rabbit in which local tissue
concentrations averaged 1.5 μg per gram of tissue at 8 days (4). This tissue
concentration corresponds to 1.6 M at an assumed tissue density of 1 g/cm3.
Because SRL tissue concentrations are known to decline thereafter, we chose a dose of
500 nM (5). EVL dose was chosen at the same range as SRL for comparison given its
similar structure and chemical weight. Additionally proliferation under normoglycemic
2
and hyperglycemic conditions was determined after first exposing EC to normal glucose
(5 mM) or high glucose (30 mM) for 48 hours followed by Mf, SRL or EVL alone and in
combination for an additional 24 hours.
siRNA Mediated Inhibition of the mTOR Signaling Pathway in HAECs: HAECs were
plated in 50% confluence for transfection the next day. Target proteins for siRNA were
confirmed with western blots (Figure S2).
Table 1. Target siRNA sequences
siRNA
1st sequence (sense, antisense)
2nd sequence (sense, antisense)
AMPK 1/2
5’AAGAAUGGUACUCUUUCAGGAUGGG3’,
5’AAACUUCAGCCAUAAUGUCAUACGG3’,
5’CCCAUCCUGAAAGAGUACCAUUCUU3’
5’CCGUAUGACAUUAUGGCUGAAGUUU3’
5’GAUACCCCGAUGACGCACAAUUUGAA3’,
5’UAGAUGUCCAUUUCAAAUUGUGCGU3’,
5’UUCAAAUUGUGCGUCAUCGGGUAUC3’
5’ACGCACAAUUUGAAAUGGACAUCUA3’
5’UAUCAAACUGGCUCCACGUCCUCCUC3’,
5’CCCAGAUGACUCAACUCUCAGUGAA3’,
5’GAGGAGGACGUGAGCCAGUUUGAUA3’
5’CCUUGAGUAUCUCAGUGGAGGAGAA3’
4EBP3
S6K1
Target siRNA sequences were constructed and validated by Invitrogen (Table S1).
Negative, non-targeting siRNA sequences (Scr) were obtained from Invitrogen with
similar GC content as targeting siRNA sequences. Transfection into adherent
endothelial cells was done with the HiPerfect reagent system (Qiagen, Valencia, CA)
and HAEC proliferation was measured at 24 hours after transfection. For all siRNAs
used, experiments were repeated using a second sequence, confirming similar
knockdown and functional effect (data not shown).
3
Construction of In Vitro Stent Strut Assays and Quantitation of Endothelialization: HAEC
were seeded in 24-well plates at 40,000 cells per well with a goal confluency of 50-70%.
Lentiviruses encoding shRNAs for raptor in addition to control shRNA under control of a
Tet-on inducible U6 promoter (America Pharma Source, Gaithersburg, MD) were used
to infect the endothelial cells with the mentioned shRNA at a titer of 1 x 10 6 viral
particles/ml (6). After 8 hours, cells were washed twice and media replaced. The initial
transduction efficiency of endothelial cells using this system was approximately 80%.
Cells were then placed in media supplemented with 1ug/ml doxycycline for 4 hours.
After 72 hours cells were used for experimentation. Bare metal stents (Driver, Medtronic
Vascular) were coated with collagen at a concentration of 0.1mg/ml (Sigma-Aldrich) and
then placed in culture dishes with transduced HAECs and 5% fetal calf serum media.
Our in vitro stent strut assays were harvested after 14 days and assessed for
endothelialization with PECAM-1/CD31 as quantified by on-cell ELISA. After fixation,
stents were incubated overnight with a primary antibody against anti-human PECAM1/CD31 (Cell Signaling, Danvers, MA). The following day, stents were washed and an
anti-rabbit horseradish peroxidase (HRP) conjugated secondary antibody was added
(Santa Cruz Biotechnology, Santa Cruz, CA). p-Nitrophenyl Phosphate (PNPP)
substrate (Thermo Fischer Scientific) was added with 2N NaOH added to stop the
reaction 15 minutes later. The absorbance of the solution was measured at 405 nM.
Separate sets of stents were prepared for immunohistochemistry using a fluorescent
secondary antibody.
4
Plasmid Mediated Overexpression of S6K and Cyclin D1 in Cultured HAEC: HAECs
were plated at 50% confluence for transfection the next day. Plasmids overexpressing
wild-type (pc DNA-Myc S6K, Addgene plasmid 26610) (7), SRL-resistant mutant of S6K
(pc DNA3 S6K2 E388 D3E, Addgene plasmid 17731) (8) and wild-type Cyclin D
(Rc/CMV cyclin D1, Addgene plasmid 8962) (9) in addition to control plasmid (pCI-neo
Mammalian Expression Vector, Promega, Madison, WI) were generated from bacterial
stabs, purified with Miniprep filtration system (Qiagen) and transfected into adherent
endothelial cells with Lipofectamine reagent system (Invitrogen) as for 24 hours. Cell
proliferation was quantified at 24 hours and normalized to control.
Immunoblotting for Products of the mTOR Signaling Pathway and Cyclin D1: Protein
from 14-day stented rabbit iliac arteries and HAECs were processed and separated on
polyacrylamide gel as previously reported (5). Blot membranes were incubated with
commercially available antibodies against phospho-AMPK (Thr 172), AMPK, phosphoS6K (Thr 389), S6K, phospho-Akt (Ser 473), Akt, phospho-4E-BP (Ser 65), 4E-BP,
Cyclin D and beta-actin (Cell Signaling, Danvers, MA). Reactive bands were detected
by chemiluminescence and quantified using area x density analysis with Quantity One
4.5.2 1-D Analysis Software (Bio-Rad, Hercules, CA). For each experimental group, a
ratio of phosphorylated protein to total protein was calculated and normalized to control.
Experiments were repeated three times in the stented iliac arteries (n = 3 arteries per
group) and four times with HAECs (n = 4 per group) unless otherwise stated.
5
Measurement of mRNA expression of Cyclin D1 in Cultured HAECs Using QRT-PCR:
Quantitative real time polymerase chain reaction (QRT-PCR) was performed using ABI
7500 fast real time PCR system (Applied Biosystems, Foster City, CA) as previously
described. Gene specific Taqman primer for human Cyclin D1 was previously validated
(10) (sense: GGATGCTGGAGGTCTGCGA, anti-sense:
AGAGGCCACGAACATGCAAG) (IDT, Coralville, IA). The internal reference gene of
cyclophilin was used to normalize the amount of RNA from all samples. The relative
expression of target genes was as fold change compared to with control.
Rabbit Model of Iliac Artery Stenting: The study protocol was reviewed and approved
the Emory Institutional Animal Care and Use Committee (Atlanta, GA) and experiments
conducted according to the National Institutes of Health Guide for the Care and Use of
Laboratory Animals. Briefly, anesthetized adult male New Zealand White rabbits
underwent endothelial denudation of both iliac arteries using an angioplasty balloon
catheter (Maverick, 3.0 × 12 mm, Boston Scientific, Boston, MA). Subsequently, 3.0 x
12-mm zotarolimus-eluting stent (ZES) (Endeavor, Medtronic, Minneapolis, MN) or 3.0 
12-mm bare metal stent (BMS) (Driver, Medtronic) were deployed at a target stent-toartery ratio of 1.3:1 in each iliac artery, respectively. Rabbits were randomized to
receive oral Mf (100 mg/kg/day) or placebo starting one week prior to the stent
procedure and continuing until sacrifice at 14 days. The rabbit dose of Mf is equivalent
to the therapeutic dose of 2 gm/day in humans based on body surface area calculations
and has been shown to activate AMPK in vivo (11,12). Animals treated with Mf did not
have any incidence of hypoglycemia (i.e. blood glucose < 60 mg/dl) or significantly
6
different blood glucose levels than animals that were placebo treated. All animals
received aspirin (40 mg/day, orally) 7 days before catheterization with continued dosing
throughout the study while a single dose of intra-arterial heparin (150 IU/kg) was
administered at the time of catheterization (Figure S3). All stents were successfully
deployed in our animal model without incidence of dissection or thrombosis by poststenting angiography. All animals remained healthy for the duration of the 14 day
experiment.
Stent Harvest: Stents were harvested at 14-days after implantation. 14 days was
chosen as the time point for harvest based upon previous work conducted by our group
in the rabbit model where differences in healing between DES and BMS were more
apparent at 14 versus 28 days (13). For evaluation of endothelial coverage and
proliferation, the stented arteries were fixed in situ with 4% paraformaldehyde after
perfusion with 0.9% normal saline. The samples were further fixed by immersion and
then bisected longitudinally and processed for scanning electron microscopy (SEM) or
confocal microscopy for PECAM-1/CD-31 and BrdU staining. Stents harvested for
western blotting were immediately removed after perfusion with 0.9% normal saline and
immediately processed or snap frozen in liquid nitrogen.
Endothelial Cell (EC) Proliferation on Implanted Stents: Animals received
bromodeoxyuridine (BrdU) 18 and 12 hours before euthanasia and harvest as
previously described (4). Immunostaining of whole-mount specimens were achieved by
overnight incubation with an antibody cocktail containing primary antibodies against
7
platelet-endothelial cell adhesion molecule 1/CD-31 (PECAM1/CD31) at 1:20 dilution
(Dako, Carpentaria, CA) and BrdU (Santa Cruz Biotechnology, Santa Cruz, CA).
Specific binding was visualized using a secondary antibody cocktail consisting of
donkey-anti mouse Alexa Fluor 488 and donkey-anti-rat Alexa Fluor 633 antibodies at
1:200 dilution (Invitrogen, Grand Island, NY). Small bowel was used as a positive
control for BrdU. Confocal microscopy of whole-mount specimens were analyzed to
quantify EC proliferation by calculating the ratio of BrdU positive cells to PECAM1/CD31 positive cells per high power field (100x) as previously described (14). A blinded
reviewer (SY) counted four fields from the proximal, middle, and distal segments of the
stent, respectively which were averaged and expressed as a percentage.
Assessment of Endothelial Coverage of Implanted Stents with Scanning Electron
Microscopy (SEM): Arteries were longitudinally sectioned and both halves processed for
SEM. Composites of serial en face SEM images acquired at low power (15x) were
digitally assembled to provide a complete view of the entire stent surface. The images
were further enlarged (200x) allowing direct visualization of endothelial cells. The
extent of endothelial strut surface coverage was traced and measured by morphometry
software (IP Lab, Rockville, MD) by a reviewer blinded to study groups (MN) as
previously reported (5). For 14-day SEM analysis, 1 artery in the ZES-control and BMSMf, respectively, was excluded because of processing artifact.
8
Statistical Analysis: Statistical analysis was performed with JMP Pro v10 (SAS, Cary,
North Carolina). All data was expressed as mean + SD. Comparison among groups was
made using:
1) Unpaired Student’s t test: transfected HAEC experiments (figures 3D, 4A-D; 5B-D)
2) One-way ANOVA: HAEC western blots for p70, Akt, 4E-BP, AMPK, cyclin D1
(figures 1A-D, 5A); HAEC proliferation assay with A-769662/AICAR (figure 3C);
MTT and apoptosis assays with EVL/SRL/Mf (figures S1A,C)
3) Two-way ANOVA: HAEC proliferation with SRL/EVL/Mf in both hyper- and
normoglycemic conditions (figures 2C-D); rabbit arterial western
blots/SEM/proliferation assay (6A-D; Table 1 and 2, respectively)
For 2) and 3), if the F-test was significant (p < 0.05) post hoc analysis was made with
Tukey-Kramer honest significance difference test. A p-value of < 0.05 was considered
statistically significant. Sample size calculations was performed by G*Power v3
(Dusseldorf, Germany) (15). For both in vitro and in vivo experimental groups, a large
effect size (> 2) was determined based on data previously published (i.e. SEM and
western blots) and laboratory experience with the assays utilized (5,16). With the
criterion of significance set at 0.05, a sample size of 3 per groups was determined for
each experiment to achieve a power of 0.8.
9
Supplemental Figures
Figure 1
Endothelial Cell Viability is Differentially Inhibited by Mf in Combination with mTOR
inhibition however Apoptosis is not (A) Human aortic endothelial cells (HAEC) were
incubated in the presence of increasing doses of Mf (0 - 50 mM) in addition to Mf (30
mM) in combination with SRL (500 nM) and EVL (500 nM) for 24 hours in basal media
and cell viability was measured by MTT assay (n = 4 per group). (B) HAEC were
incubated in the presence of increasing doses of SRL (0 - 500 nM) and EVL (0 – 500
10
nM) for 24 hours and viability was measured (n = 4 per group). (C) HAECs were
incubated in the presence of increasing doses of Mf (0 - 50 mM) in addition to Mf (30
mM) in combination with SRL (500 nM) and EVL (500 nM) for 24 hours in basal media
and apoptosis was measured by flow cytometric analysis with propridium iodide and
Annexin V-FITC staining (n = 3 per group). Representative bivariate plots of Mf (30
mM), Mf + SRL (500 nM) and Mf + EVL (500 nM) are shown on the left, from top to
bottom, respectively. (D) HAEC were incubated in the presence of increasing doses of
SRL (0 - 500 nM) and EVL (0 – 500 nM) for 24 hours and apoptosis was measured by
flow cytometric analysis with propridium iodide and Annexin V-FITC staining (n = 3 per
group). Representative bivariate plot of SRL (500 nM) and EVL (500 nM) are shown on
the far left, from top to bottom, respectively.
11
Figure 2
12
Figure 2. Confirmation of Overexpression and siRNA Knockdown in HAECs by Western
Blotting. (A) Overexpression of wildtype S6K, HA-tagged SRL-resistant mutant S6K,
and cyclin D1 wild-type via plasmid transfection of HAECs was confirmed by western
blotting for S6K, HA and Cyclin D1, respectively. (B) Silencing of AMPK 1/2, 4E-BP3
and S6K1 via siRNA transfection of HAECs was confirmed by western blotting of AMPK
1/2, 4E-BP3 and S6K1, respectively. (C) Silencing of raptor via lentiviral short hairpin
RNA (shRNA) transduction of HAECs was confirmed by western blotting for raptor.
Representative blots shown.
13
Figure 3
Figure 3. Experimental Design of Animal Experiments. Male New Zealand White rabbits
were given metformin (100 mg/kg/day) or placebo for 7 days prior to stent placement in
addition to aspirin (40 mg/kg/day). Stent placement occurs on day 7 with intra-arterial
heparin given and drug treatment resumes until day 21. BrdU was intra-muscularly
administered at 18 and 12 hours prior to harvest. Animals are harvested and stents
analyzed for endothelialization with scanning electron microscopy and confocal
microscopy for BrdU staining.
14
Figure 4
Figure 4. Proposed Mechanism of Mf on Endothelial Cell Proliferation. Exposure to Mf
leads to the inhibition of mTORC1/S6K axis through activation of AMPK while SRL and
analogs (i.e. EVL) directly inhibits mTORC1. S6K in turn acts on proliferation through
regulation of Cyclin D1 expression. Inhibition of mTORC1/4E-BP by sirolimus and Mf is
likely transient with prolonged inhibition leading to resistance and rephosphorylation.
The combination of Mf and SRL not only differentially suppresses mTORC1/S6K axis
may also lead to feedback activation of Akt.
15
Supplemental References
1.
Muir D, Varon S, Manthorpe M. An enzyme-linked immunosorbent assay for
bromodeoxyuridine incorporation using fixed microcultures. Analytical
biochemistry 1990;185:377-82.
2.
van de Loosdrecht AA, Beelen RH, Ossenkoppele GJ, Broekhoven MG,
Langenhuijsen MM. A tetrazolium-based colorimetric MTT assay to quantitate
human monocyte mediated cytotoxicity against leukemic cells from cell lines and
patients with acute myeloid leukemia. Journal of immunological methods
1994;174:311-20.
3.
Graham GG, Punt J, Arora M et al. Clinical pharmacokinetics of metformin.
Clinical pharmacokinetics 2011;50:81-98.
4.
Finn AV, Kolodgie FD, Harnek J et al. Differential response of delayed healing
and persistent inflammation at sites of overlapping sirolimus- or paclitaxel-eluting
stents. Circulation 2005;112:270-8.
5.
Finn AV, John M, Nakazawa G et al. Differential healing after sirolimus,
paclitaxel, and bare metal stent placement in combination with peroxisome
proliferator-activator receptor gamma agonists: requirement for mTOR/Akt2 in
PPARgamma activation. Circulation research 2009;105:1003-12.
6.
Sarbassov DD, Guertin DA, Ali SM, Sabatini DM. Phosphorylation and regulation
of Akt/PKB by the rictor-mTOR complex. Science 2005;307:1098-101.
7.
Fang Y, Vilella-Bach M, Bachmann R, Flanigan A, Chen J. Phosphatidic acidmediated mitogenic activation of mTOR signaling. Science 2001;294:1942-5.
16
8.
Lee-Fruman KK, Kuo CJ, Lippincott J, Terada N, Blenis J. Characterization of
S6K2, a novel kinase homologous to S6K1. Oncogene 1999;18:5108-14.
9.
Hinds PW, Mittnacht S, Dulic V, Arnold A, Reed SI, Weinberg RA. Regulation of
retinoblastoma protein functions by ectopic expression of human cyclins. Cell
1992;70:993-1006.
10.
Yang C, Ionescu-Tiba V, Burns K et al. The role of the cyclin D1-dependent
kinases in ErbB2-mediated breast cancer. The American journal of pathology
2004;164:1031-8.
11.
Package insert: Metformin hydrochloride. Bristol-Myers Squibb. New York, NY.
12.
Sasaki H, Asanuma H, Fujita M et al. Metformin prevents progression of heart
failure in dogs: role of AMP-activated protein kinase. Circulation 2009;119:256877.
13.
Joner M, Nakazawa G, Finn AV et al. Endothelial cell recovery between
comparator polymer-based drug-eluting stents. Journal of the American College
of Cardiology 2008;52:333-42.
14.
Finn AV, Gold HK, Tang A et al. A novel rat model of carotid artery stenting for
the understanding of restenosis in metabolic diseases. Journal of vascular
research 2002;39:414-25.
15.
Faul F, Erdfelder E, Lang AG, Buchner A. G*Power 3: a flexible statistical power
analysis program for the social, behavioral, and biomedical sciences. Behavior
research methods 2007;39:175-91.
17
16.
Finn AV, Nakano M, Polavarapu R et al. Hemoglobin directs macrophage
differentiation and prevents foam cell formation in human atherosclerotic
plaques. Journal of the American College of Cardiology 2012;59:166-77.
18