Supplementary information
Stromal cells as trend-setters for cells migrating into the lymph node
Dr. Manuela Buettner1, Dr. Oliver Dittrich-Breiholz2, Prof. Christine S. Falk3, Dr. Matthias
Lochner4, Anna Smoczek5, Franziska Menzel1, Melanie Bornemann1, Dr. Ulrike Bode1
1 Functional and Applied Anatomy, Hannover Medical School, 30625 Hannover, Germany
2 Institute of Physiological Chemistry, Hannover Medical School, 30625 Hannover, Germany
3 Institute of Transplant Immmunology, IFB-Tx, Hannover Medical School, 30625 Hannover,
Germany
4 Institute of Infection Immunology, TWINCORE, Centre for Experimental and Clinical
Infection Research; a joint venture between the Medical School Hannover (MHH) and the
Helmholtz Centre for Infection Research (HZI), 30625 Hannover, Germany
5 Institute of Laboratory Animal Science, Hannover Medical School, 30625 Hannover,
Germany
Address correspondence to:
Dr. Manuela Buettner
Functional and Applied Anatomy, OE 4120
Medizinische Hochschule Hannover
Carl-Neuberg-Str.1
30625 Hannover, Germany
Phone:
+49-511-532-7392
Fax:
+49-511-532-16 6741
E-Mail:
Buettner.Manuela@MH-Hannover.de
Running Title
Transplantation and regeneration of stromal cells
1
Methods
Animals
Female C57BL/6, C57BL/6-Tg (ACTbEGFP) (designated here EGFP mice),
C57BL/6.129P2(Cg)-Rorctm2Litt/J (designated here RORt mice) and C57BL/6-Tg(Tcra
Tcrb)425Cbn-Ptprca (designated here OT-II mice; T cells of these mice selectively recognize
Ova peptide presented in the context of MHC class II) mice were bred at the central animal
laboratory of Hannover Medical School and were used at a weight of 18-25g. All animal
experiments were performed in accordance with the institutional guidelines and had been
approved by the Niedersächsisches Landesamt für Verbraucherschutz und
Lebensmittelsicherheit (No. 33.9-42502-04-09/1667).
SC isolation
For isolation of CD45- SCs, the mLN or the pLN of EGFP or wt mice were removed and LN
were digested at 37° for 30 min with 1mg/ml Collagenase 8 (Sigma-Aldrich, St. Louis, USA)
in RPMI 1640/10% FCS. CD45- cells were isolated using the MACS technique following the
instructions provided by Miltenyi (Bergisch-Gladbach, Germany). The mean value of purity
of CD45- cells was 97.4% ± 2.0 for mLN cells and 97.5% ± 2.2 for pLN. The SCs were used
for mRNA isolation or embedded on a collagen sponge (CS-35; Koken, Tokyo, Japan) and
transplanted into donor mice.
Microarray analysis
In two independent experiments, CD45- cells from pLN and mLN were isolated and total
RNA was isolated according to the manufacturer´s protocol (RNeasy Micro Kit, Qiagen,
Hilden, Germany). Samples from all individuals of the same genotype were pooled. The
Whole Mouse Genome Oligo Microarray 4x44K (G4122F, design ID 014868, Agilent
Technologies, Santa Clara, USA) was employed in this study. 80ng of total RNA was used to
2
prepare Cy3-labeled cRNA (Amino Allyl MessageAmp™ II Kit; Life Technologies,
Karlsruhe, Germany) as recommended by the company. cRNA fragmentation, hybridization,
and washing steps were carried out according to Agilent’s One-Color Microarray-Based Gene
Expression Analysis Protocol V5.7, except that 400ng of each labeled cRNA sample was used
for hybridization. Slides were scanned on the Agilent Micro Array Scanner G2505 B at two
different PMT settings (100 % and 5 %) to increase the dynamic range of the measurements.
Data extraction was performed with the “Feature Extraction Software V9.5.3.1” by using the
recommended default extraction protocol file: GE1-v5_95_Feb07.xml. Processed intensity
values (“ProcessedSignal” or “PS”) were globally normalized by a linear scaling approach:
All PS values of one sample were multiplied by an array-specific scaling factor. This scaling
factor was calculated by dividing a “reference 75th Percentile value” (set as 1500 for the
whole series) by the 75th Percentile value of the particular Microarray (“Array i” in the
formula shown below). Accordingly, normalized PS values for all samples (microarray data
sets) were calculated by the following formula:
normalized PSArray i = PSArray i X (1500 / 75th PercentileArray i)
A lower intensity threshold was defined as 1% of the reference 75th Percentile value (= 15).
All normalized PS values that fell below this intensity border were substituted by the
respective surrogate value of 15. Normalized PS values of on-chip replicate probes were
averaged arithmetically prior to ratio calculation.
Whole data were filtered for transcripts that fulfilled the following criteria: 1) fold difference
in processed signal intensities calculated from each possible pair of mLN vs pLN samples >
2-fold (consistent and unidirectional); 2) arithmetic mean of processed signal intensities
calculated from each possible pair of mLN vs pLN samples > 100; 3) technical impairment, as
defined by the entry “IsFeatNonUnifOL” (Feature extraction software) absent (=0) in each of
the 4 samples analyzed.
3
Intestinal surgery
CD45- SCs from mLN and pLN were isolated from C57BL/6 or EGFP mice and used as
donors for C57BL/6 mice and RORt mice. Under the combined anesthesia with Ketamine
(Gräub AG, Bern, Switzerland) and xylazine 2% (Bayer Health Care, Leverkusen, Germany),
the mLN of the small and large intestine or the popliteal LN of the host were excised and
donor SCs Neotx-mLN or axillary and brachial LN (Neotx-pLN) were transplanted into these
regions.
Immunization
Purified cholera toxin (CT, Sigma-Aldrich, Taufkirchen, Germany) was administered as
described previously with some modifications (16): Eight weeks after transplantation mice
with Neotx mLN or pLN were immunized orally with 10µg CT (in 50µl of 0.01M PBS
containing 0.2% gelatine) on day 0, 8 and 14. On day 19 the mice were exsanguinated, cell
suspensions were made and analyzed via flow cytometry as described below (n=3-8).
Adoptive transfer
Cell suspensions of the spleen from OT-II Ly5.1 transgenic mice expressing TCR recognizing
Ovalbumin (Ova) were made; cells were labelled with CFSE (Invitrogen, Karlsruhe,
Germany) and injected intravenously into Neotx mice. Mice received a single dose of 100 mg
Ova Grade III (Sigma-Aldrich) by gavage and 10 mg Ova by injection depending on the
transplanted region (mesentery and popliteal fossa), respectively (n=4-7).
Antibodies for flow cytometry
After isolation the purity of the SCs was analyzed using anti-CD45-PE-Cy7 (BD Biosciences,
Heidelberg, Germany), anti-Podoplanin-FITC (gp38; Biozol, Eching, Germany), or anti4
CD31-APC (Biolegend, San Diego, USA). FDC were detected using biotinylated anti-FDCM2 (ImmunoKontact, Oxon, UK) and revealed by PerCP.
Cell suspensions from Neotx-mLN and Neotx-pLN (n=3-8) were made and about 5x105 cells
were incubated with anti-CD8-PE-Cy7, anti-IgA-PE (both Serotec, Oxford, UK), anti-CD4APC, anti-CD19-APC-H7, anti-CD11c-APC, anti-CD45-PE-Cy7, anti-CD21/35-APC (all
acquired from BD Biosciences), anti-Podoplanin-PE (Biozol) and anti-Lyve-1 (kindly
provided by R. Förster, Institute of Immunology, Hannover Medical School, Germany) which
was shown by using a goat anti-rabbit antibody coupled with Cy3 (Dianova, Hamburg,
Germany).
In three independent experiments (n=7-8) OTII cells were identified by anti-CD45.1-PE-Cy7
(BD Biosciences) and the induction of homing molecules was performed using anti-CCR9-PE
(Biolegend) and anti-47 integrin-PE (BD Biosciences). All FACS analyses were performed
on a FACSCanto (BD Biosciences). Isotype-matched monoclonal antibodies served as
controls.
Quantification of mRNA expression
Total RNA of Neotx-mLN and Neotx-pLN (n= 3-5) was isolated according to the
manufacturer´s protocol (ZyGEM, Hamilton, New Zealand) and cDNA synthesis was
performed with 50 µM oligo primer, 0.1 M DTT, 5x first strand buffer, 10mM dNTP mix,
40 U/µl Rnase inhibitor and 200U/µl Superscript III reverse transcriptase (all obtained from
Invitrogen) in a total volume of 20µl at 50°C for 50 min. With this cDNA quantitative real
time PCR was performed using the QuantiTect SYBR-Green protocol from Qiagen. The
primer sequences and amplicon sizes of RALDH2 (5´- GACTTGTAGCAGCTGTCTTCACT
-3´ and 5´- TCACCCATTTCTCTCCCATTTCC -3´), IL-18 (5´GAGGAAATGGATCCACCTGA-3´ and 5´- ACAAACCCTCCCCACCTAAC-3´), CXCL14
(5´- TACCCACACTGCGAGGAGAAGA -3´ and 5´- CGCTTCTCGTTCCAGGCATTGT 5
3´), LTa (5´-TTCTTTGGAGCCTTTGCACT -3´ and 5´-ACCCTTGAAACAACGGTCAG 3´), LTbR (5´-CCAGCACCTTCTTTCTGAGG -3´ and 5´-GCTAGTGTCCGGTTCTGCTC 3´), CXCL13 (5´-CATAGATCGGATTCAAGTTACGCC -3´ and 5´GTAACCATTTGGCACGAGGATTC -3´) and -actin (5´- AGCCATGTACGTAGCCATCC
-3´ and 5´- CTCTCAGCTGTGGTGGTGAA -3´) for the housekeeping gene were used.
Immunohistochemistry
Cryostat sections of Neotx-mLN as well as Neotx-pLN (n=4-5) were fixed in
acetone/methanol solution (1:1, 10 min, -20°C). Immunofluorescence histochemistry was
performed according to standard protocols. Briefly, sections were rehydrated in TBST (0.1 M
Tris pH 7.5, 0.15 M NaCl, 0.1% Tween-20), pre-incubated with TBST containing 5% swine
serum (Dako, Hamburg, Germany) and stained with anti CD3-APC, CD11c-APC, B220,
LTR, CD11b, (all BD Biosciences), CXCL13 (R&D Systems, Minneapolis, USA), CCL21
(Serotec, Oxford, UK), ERTR-7 (BMA, Augst, Switzerland),FDC-M2 (ImmunoKontact,
Frankfurt, Germany), CD45-APC (Caltag, Buckingham, UK), CD31-APC (Biolegend), Dlk-1
(Abcam, Cambridge, UK), gp38-Cy5, MAdCAM-1, Lyve-1 (all kindly provided by R.
Förster) in 2.5% serum/TBST. Proliferation was visualized using anti-Ki67 (Epitomice,
Burlingame, USA). Unconjugated antibodies were visualized in a second step by a goat antirat Cy3 (Invitrogen). To increase the EGFP signal of the transplanted cells in the regeneration
experiments, an anti-GFP antibody was used and visualized by an anti-rabbit Alexa Fluor 488
(both kindly provided by C. Mühlfeld). Nuclei were visualized by DAPI staining (1μg/ml
DAPI/TBST), and sections were mounted with Fluorescent Mounting Medium (Dako).
Images were acquired using an Axiovert 200M microscope, an AxioCam MRm camera,
objectives with 5x, 40x and 100x magnification and pictures were acquired with AxioVision
4.8 software (all Carl Zeiss, Jena, Germany).
6
Protein multiplex analysis for the quantification of cytokines
The cytokine levels of IL-18, CXCL14 and IL-6 in the supernatants of short time SC cultures
(24 h) were measured using Bio-Plex Pro cytokine multiplex assays (Bio-Rad, Hercules,
USA). The assay was performed according to the manufacturer's instructions. In brief, 50µl
supernatant was applied to color-coded beads covered with capture antibodies for IL-18,
CXCL14 or IL-6. After incubation and washing, bead-bound cytokines were quantified by the
biotinylated detection antibodies followed by streptavidin-PE staining. Concentrations were
measured by parallel standard curves for each parameter.
Data analysis
Calculations, statistical analysis and graphs were performed with the software Graphpad
Prism 4.0 (Graphpad Software Inc., San Diego, USA). Statistical differences were calculated
in the unpaired t-test and are indicated by *, P< 0.05; **, P< 0.01; ***, P< 0.001.
7
Legends
Suppl. Tab. 1
In two independent experiments, CD45- cells from pLN and mLN were isolated, total RNA
was extracted and mRNA expression analysis was performed using the Whole Mouse
Genome Oligo Microarray 4x44K (G4122F, design ID 014868, Agilent Technologies),
according to a single-color design. Raw data were processed and normalized as described in
the methods section. Normalized PS values of on-chip replicate probes were averaged
arithmetically prior to calculation of respective “fold difference values”.
Measurements for genes, encoding interleukins and chemokines are depicted. Normalized
Processed Signal intensities (nPS) as well as fold difference values (pLN / mLN) are given for
both independent experiments performed (columns 4-6 and 7-9). Agilent’s ProbeIDs,
accession numbers, gene symbols (columns 1-3) as well as gene descriptions (column 10) are
provided. In cases in which more than one probe directed against the same transcript was
present on the microarray, the complete set of resulting probe measurements is presented.
Measurements for genes, fulfilling the applied filter criteria for differential mRNA expression
in mLN versus pLN stromal cells (see methods), are depicted in bold type (see also Fig.1C).
Suppl. Fig. 1
Global mRNA expression differences between pLN and mLN samples
Microarray-based mRNA expression analysis was conducted as described in Methods. (A.)
Normalized fluorescence intensity data from pLN and mLN samples, each analyzed using true
biological duplicates (n=2), were imported into GeneSpring Expression software (v12.6.1,
Agilent Technologies) for scatterplot visualization. In the course of data import measurements
were log2-transformed and values from replicated conditions were averaged arithmetically.
Differentially expressed chemokine or cytokine transcripts from Fig. 1B were highlighted in
black and were labeled accordingly. Green reference lines represent twofold differences in
8
mRNA expression. (B.) Normalized fluorescence intensity data from pLN and mLN samples
as well as from various subpopulations are represented in bar graph profiles. Graphs from 5
Chemokine - or Cytokine Transcripts identified as differentially expressed between pLN and
mLN samples were depicted. All microarray datasets generated were systematically numbered
from M1-M12. Along with gene symbols on top of the panels, Agilent probe IDs as well as
feature numbers were given.
DN = ”double negative”, FRC = “fibroblastic reticular cells”, LEC = “lymph endothelial
cells”, BEC = “blood endothelial cells”
Suppl. Fig. 2
Dendritic cells from the draining area populate the NeotxLN
Eight weeks after transplantation flow cytometry analysis of DC subpopulations showed
similar DC subpopulations in control mLN and NeotxLN independent of SCs from mLN or
pLN were transplanted. (A.) Dot Plots of the gating are shown. (B.) Means and standard error
are given from 5-7 independent experiments. Significant differences in the unpaired t-test are
indicated by *: P < 0.05; **: P < 0.01; ***: P < 0.001.
Suppl. Fig. 3
Stromal cell subpopulations are able to generate lymph node like structures
Isolated stromal cell subpopulations (FRC, LEC, BEC and the DN fraction of gp38 and CD31
staining) from mLN and pLN transplanted into the mesentery were removed eight weeks after
transplantation and stained for hematoxylin and eosin (H&E). Small lymphoid aggregates
were found after FRC and lymph node like structures after BEC transplantation. However, no
similar structures were detectable after LEC, DN or sponge without cell (mock) transplantion
(n=3).
9
Suppl. Fig. 4
Sorting conditions for EGFP positive cells
Neotx-LNs were removed eight weeks after transplantation and EGFP+ and EGFP- cells were
sorted. Dot plots of Neotx-LN before and after sorting are shown.
Suppl. Fig. 5
Transplanted stromal cells remain in NeotxLN
EGFP+ stromal cells from mLN and pLN transplanted into the mesentery were removed one,
two or four days after transplantation and stained for stromal cell or immune cell markers. For
an overview of the transplanted sponge DAPI staining was used. Bar 100µm. Shortly after
transplantation some immune cells were detectable in the border of the NeotxLN but already
two days after transplantation small clusters were visible. At all analyzed time points almost
all stromal cell subsets were found to be EGFP+. Stromal cell subsets were distinguished
using gp38 for FRC, FDC-M2 as a marker for FDC, Lyve-1 for lymphatic endothelial cells
and CD31 for blood endothelial cells (n=3-4).
Suppl. Fig. 6
Dlk-1 positive cells are found permanently in mesenteric lymph nodes
Mesenteric lymph nodes of untreated control mice were excised and stained for Dlk-1. These
cells were not of hematopoietic origin as they were CD45- but also CD11c-. Stromal cell
markers were also stained to identify a specific cell subset positive for Dlk-1. Dlk-1+ cells
were found to be negative for CD31 and FDC-M2. Co-staining of gp38 and Dlk-1 showed not
only Dlk-1+ gp38- cells but also Dlk-1+ gp38+ cells (n=3).
Suppl. Fig. 7
LTR, LT and CXCL13 are involved in lymph node formation in the first days
10
SC were transplanted into the mesentery and removed one, two and four days after
transplantation. mRNA was isolated and real time PCR in triplets was performed. The data
are normalized to the housekeeping gene -actin and given from 3 animals.
11