Leader:
Course:
Instructor:
Date:
Pracitce Exam
Unit 2
Supplemental Instruction
Iowa State University
Landon
Bio 212
Essner Becraft
2/26/12
Exam 2 will cover Chapters 6,7,8,11,12
Chapter 7
1. When oxygen is utilized to synthesize ATP, this is known as (P. 137)
A) cellular respiration.
B) metabolism.
C) anaerobic respiration.
D) aerobic synthesis.
E) aerobic respiration.
2. The synthesis of ATP using energy provided by an electrochemical gradient is most accurately referred
to as (P.145)
A) substrate level phosphorylation.
B) reduction.
C) oxidation.
D) oxidative phosphorylation.
E) fermentation.
3. Which of the following is the correct net gain of products from glycolysis? (P. 138)
A) 4 ATP : 2 NADH : 2 Pyruvate
B) 2 ATP : 4 NADH : 4 Pyruvate
C) 2 ATP : 4 NADH : 2 Pyruvate
D) 2 ATP : 2 FADH2 : 2 Pyruvate
E) 2 ATP : 2 NADH : 2 Pyruvate
4. Which of the following would not be considered a form of transport used during oxidative
phosphorylation? (P.145)
A) Chemiosmosis
B) Active transport
C) Protonmotive force
D) Facilitated diffusion
E) All of the choices are forms of transport utilized during oxidative phosphorylation
5. Which one of the following statements about glycolysis is incorrect? (P. 139)
A) Glycolysis involves an energy "investment" phase and an energy "payout" phase
B) A net yield of 2 ATP is achieved per molecule of glucose in glycolysis
C) At the end of glycolysis, the six carbons that originated in glucose are found in one molecule of
pyruvate and three carbon dioxides
D) Glycolysis is essentially the same in all-living organisms
E) Some of the energy liberated during glycolysis is used to reduce NAD+ into NADH
6. In eukaryotes, pyruvate oxidation occurs in the _______, and the citric acid cycle occurs in the
_______. (P. 140-141)
Supplemental Instruction
1060 Hixson-Lied Student Success Center  294-6624  www.si.iastate.edu
A)
B)
C)
D)
E)
cytoplasm; mitochondrial matrix
mitochondrial matrix; mitochondrial matrix
outer mitochondrial membrane; inner mitochondrial membrane
cytoplasm; cytoplasm
outer mitochondrial membrane; mitochondrial matrix
7. Which one of the following is not a product of the citric acid cycle? (P. 143)
A) FADH2
B) NADH
C) Carbon dioxide
D) GTP (then converted to ATP)
E) Water
8. Which of the following will not occur in anaerobic conditions? (P. 151-153)
A) Alcohol fermentation
B) Lactic acid fermentation
C) Glycolysis
D) Chemiosmosis
E) Oxidative phosphorylation
Chapter 8: Photosynthesis
9. Which of the following statements about electromagnetic radiation is incorrect?(p.156)
A) Light in the visible portion of the electromagnetic spectrum powers photosynthesis.
B) Visible light comprises a small percentage of the electromagnetic spectrum of the sun.
C) Photons of visible light can be absorbed by molecules in living cells in a way that does not
permanently harm the molecules.
D) Electromagnetic radiation travels as waves caused by the oscillation of electric and magnetic fields.
E) Electromagnetic radiation with a long wavelength will have greater energy than one with a short
wavelength.
10. The addition of an oxygen molecule to ribulose bisphosphate (RuBP) resulting in phosphoglycolate is
most accurately referred to as (P.172)
A) oxidative phosphorylation.
B) photorespiration.
C) photophosphorylation.
D) aerobic respiration.
E) phosphorespiration.
11. When an electron absorbs energy and exists in an excited state, the electron can (P.161)
A) drop back down to its original energy level and release light.
B) be removed from one molecule and transferred to a different molecule.
C) drop back down to its original energy level and release heat.
D) drop back down to its original energy level and release light and be removed from one molecule and
transferred to a different molecule.
E) drop back down to its original energy level and release light, be removed from one molecule and
transferred to a different molecule, and drop back down to its original energy level and release heat.
12. A primary electron acceptor in Photosystem II is (P.166)
A) P700.
B) D1.
C) CP43.
D) pheophytin.
E) P680.
13. Which of the following statements regarding cyclic electron flow is incorrect? (P.163)
A) Cyclic electron flow is favored when NADPH levels are high
B) ATP is produced via an electrochemical gradient
C) High energy electrons are transferred to QB via ferredoxin
D) Cyclic electron flow results in high levels of NADPH
E) ATP is the final product of cyclic electron flow
14. Which one of the following statements most accurately explains the "enhancement effect" seen in
photosynthesis? (Refer to page 167)
A) The production of protons in photosystem II, combined with the consumption of protons in
photosystem I, produce an electrochemical gradient used to synthesize ATP.
B) The absorption of 1380-nm light results in more than twice the rate of photosynthesis than absorbing
light of 680-nm and 700-nm.
C) 680-nm light activates the pigment in the reaction center of photosystem II, while 700-nm light
activates the pigment in the reaction center of photosystem I.
D) 680-nm light activates the pigment in the reaction center of photosystem I, while 700-nm light
activates the pigment in the reaction center of photosystem II.
E) None of the choices accurately explains the enhancement effect seen in photosynthesis.
15. The production of 1 G3P molecule requires (P.169)
A) 12 ATP : 18 NADPH and 6CO2
B) 12 ATP : 12 NADPH and 6CO2
C) 3 6 ATP : 18 NADPH and 6CO2
D) 6 ATP : 9 NADPH and 3CO2
E) 9 ATP : 6 NADPH and 3CO2
16. The most common storage form of carbohydrate in chloroplasts is (P.169)
A) glucose.
B) sucrose.
C) cellulose.
D) starch.
E) glyceraldehyde-3-phosphate.
17. Which one of the following statements about Rubisco is incorrect? Rubisco (P. 169)
A) is perhaps the most abundant protein on Earth.
B) catalyzes the formation of a six-carbon compound from ribulose bisphosphate and carbon dioxide.
C) has carboxylase activity.
D) is believed to have evolved fairly recently in the evolution of plants.
E) is responsible for the conversion of 3PG to 1,3-BPG.
18. C4 plants are particularly suited for conditions of high temperatures and intense sunlight due to
(P. 174)
A) the presence of altered chlorophyll molecules.
B) the physical separation of mesophyll cells and bundle sheath cells.
C) the ability to convert oxaloacetate to malate for storage at night.
D) the ability of PEP-carboxylase to bind oxygen.
E) the ability to utilize ATP for the regeneration of PEP from pyruvate.
19. The first product synthesized from photosynthesis in CAM plants is (P. 175)
A) glucose.
B)
C)
D)
E)
3-phosphoglycerate (3PG).
oxaloacetate.
RuBP.
malate.
Chapter 11
20. The covalent linkage that connects monomers in a nucleic acid macromolecule is most accurately
referred to as a(n) (P.221)
A) phosphodiester linkage.
B) ester linkage.
C) peptide linkage.
D) phosphoribose linkage.
E) glycosidic linkage.
21. Which of the following scientists was responsible for elucidating the structure of DNA using X-ray
crystallography? (P. 223)
A)
B)
C)
D)
E)
Watson
Franklin
Avery
Crick
Chargaff
22. One strand of a section of DNA reads:5' – TCGGACCTGAC – 3'. Which of the following would be
the complementary strand? (P. 223)
A) 5' – CAGTCCAGGCT – 3'
B) 5' – UCGGACCUGAC – 3'
C) 3' – AGCCTGGACTG – 5'
D) 3' – GTCAGGTCCGA – 5'
E) 5' – AGCCUGGACUG – 3'
23. Which one of the following statements about DNA replication is incorrect? (P.230)
A) DNA replication is initiated at specific sites called origins of replication.
B) There are two replication forks per replication bubble.
C) DNA replication is bidirectional.
D) One daughter strand is synthesized in the direction of the replication fork, and the other daughter
strand is synthesized in the direction away from the fork.
E) Okazaki fragments are synthesized from 3' to 5'
24. An enzyme called ________ is responsible for relieving the supercoiling of DNA caused by the
unwinding of the double helix by ________. (P. 231)
A) helicase; topoisomerase
B) DNA polymerase III; DNA polymerase I
C) topoisomerase; helicase
D) DNA polymerase I; DNA polymerase III
E) ligase; primase
25. Leading strand synthesis is ______________________ and lagging strand synthesis is
________________. (P. 230)
A) discontinuous : continuous
B) conservative : semiconservative
C) continuous : discontinuous
D) semiconservative : conservative
E) rapid : slow
26. Which of the following enzymes is not used in leading strand synthesis? eukaryote?
A) Single strand binding proteins (P. 231)
B)
C)
D)
E)
DNA Polymerase
DNA Ligase
DNA Primase
Topoisomerase
Chapter 12
27. Which one of the following accurately represents the Central Dogma of molecular biology?
A) DNA is translated into protein, which is then transcribed into RNA.
B) RNA is transcribed into DNA, which is then translated into protein.
C) DNA is translated directly into protein.
D) RNA is translated into protein, which is then transcribed into DNA.
E) DNA is transcribed into RNA, which is then translated into protein.
28. Which one of the following events is not part of the maturation of a eukaryotic mRNA? (P. 246)
A) Poly-A tail addition
B) 5' cap addition
C) Intron removal and splicing of exons
D) Attachment to ribosome
29. Which of the following molecules is not directly involved in the synthesis of a polypeptide chain?
A) mRNA
B) Ribosomal proteins
C) tRNA
D) rRNA
E) DNA
30. Which of the following does not play a role in transcription in prokaryotes? (P. 244)
A) Sigma factor
B) Pre-mRNA processing
C) Formation of open complex
D) Termination sequence
E) Regulatory sequence
31. Which of the following applies to both transcription and translation? (P.244 & 256)
A) Promoter and terminator
B) Initiation complex and open complex
C) Activation, regulation and termination
D) Initiation, elongations and termination
E) Activation, processing and termination
32. Match the type of RNA on the left with the specific function on the right.
I tRNA
II mRNA
III rRNA
A)
B)
C)
D)
E)
A. Carries polypeptide sequence according to genetic code
B. Essential component in ribosome construction and function
C. Carries amino acids to growing polypeptide according to
genetic code
i = b; ii = c; iii = a
i = a; ii = b; iii = c
i = c; ii = b; iii = a
i = b; ii = a; iii = c
i = c; ii = a; iii = b
33. Non-coding sequences of DNA can be defined as:
A) exons
B) operons
C) introns
D) both a and b
34. Using the codon sheet to list the chain of amino acids from the mRNA sequence:
AUUCCGUUAUGUUUGGUGCGCGGCGAUAAGGCCUAU