Supplementary Material
Nuclear expression of mitochondrial ND4 leads to protein assembling in complex I and
prevents optic atrophy and visual loss (Cwerman-Thibault et al.)
RESULTS
Evaluation of the AAV2/2-ND4 transduction efficacy in retinas
To evaluate the number of RGCs efficiently transduced after administration of AAV2/2-ND4,
cryostat sections of retinas were immunostained with GFP and BRN3A antibodies. The hrGFP
gene included in the AAV vectors served as a useful marker for detecting transduced cells and
BRN3A is known as a reliable marker of RGCs in adult rodents [1]. RGCs immunolabeled for both
antibodies were counted in 2-3 independent retinal sections per animal in nine animals subjected to
intravitreal injection of AAV2/2-ND4 (1 x 109 or 5 x 109 Vector Genomes, VG, per eye) and
euthanized between 2 to 10 months later. Cytoplasmic GFP immunostaining was mainly
appreciated in the ganglion cell layer (GCL), indicating the effective transgene expression in cells
located in this layer (Fig. S1.A). The proportion of GFP-positive cells among the total BRN3Alabeled cells was 75% (312 ± 12 BRN3A positive cells and 234 ± 10 BRN3A and GFP-positive
cells; Fig. S1.B). Some BRN3A-negative cells were GFP-positives (42 ± 3; 13.4% of the total GFPpositive cells); they could represent astrocytes or displaced amacrine cells which reside in the GCL
(Fig. S1.A, white arrowheads).
We generated a rat model which shares some LHON hallmarks by transduction with mutant ND4
via in vivo ELP [2] and subsequent intravitreal administration of either AAV2/2-GFP (LHON
model) or AAV2/2-ND4 (aimed at preventing RGC loss). It was important to determine whether
AAV2/2 transduction efficiency could be modified in eyes subjected to in vivo ELP first. Hence,
RGC cells which express GFP were counted in five retinal sections from animals transduced with
mutant ND4 via ELP and 10 days later to a single intravitreal injection of AAV2/2-ND4 (1 x 109
1
VG in the same eye). The overall number of RGCs (BRN3A-positive cells) estimated in these rats
euthanized 6 months after AAV2/2-ND4 administration was 311 ± 12 cells and 231 ± 10 cells were
also positive for GFP staining (Fig. S2.C). Thus, 74.4% of RGCs expressed the transgene; the
efficacy of RGC transduction by AAV2/2-ND4 did not change when rat eyes were first subjected to
ELP.
Supplementary Materials and Methods
Common features of the AAV2/2 vectors
The two human ND4 genes expressed in rat eyes were under the control of the cytomegalovirus
(CMV) immediate early promoter since they were originated from the pAAV-IRES-hrGFP plasmid
(Agilent Technologies). All the vectors lead to the synthesis of the hrGFP protein which gene is
located downstream from the internal ribosome entry site (IRES). The product is a humanized form
of the Renilla reniformis protein less toxic than the jellyfish Aequorea victoria EGFP protein.
Since the GFP gene is located downstream from the IRES, its expression is low
(http://www.chem.agilent.com/Library/usermanuals/Public/240071.pdf). We did never found any
toxic effect in retinas when the animals were treated with the vector directly obtained from the
manufacturer either as a plasmid or as an AAV2/2 vector. This is in agreement with the in vivo data
which described transgenic mice derived from murine embryonic stem cells conditionally
expressing the hrGFP gene at the cell surface. Transgenic mice derived from these cells permit the
targeting of GFP-expression to specific tissues, additionally when the CMV promoter was used, the
GFP expression was found ubiquitously and no toxicity was noticed [3].
Relevance of the strategy to obtain the LHON model in adult rats
In a previous publication, we described the induction of RGC loss and visual impairment in adult
rats after G11778A-ND4 plasmid DNA intravitreal injection and transduction of cells in the GCL
by in vivo ELP [2]. The question arises whether in this model of RGC degeneration, AAV2/2mediated gene therapy could be successful and ultimately whether AAV2/2-ND4 administration
could be envisaged as a treatment for LHON patients harboring the G11778A substitution in their
2
mitochondrial genome. As enlightened in the results section "Long-lasting expression of the human
ND4 gene in retinas from rats mimicking LHON" we tried in this work to design an animal model
which could share similarities with human mitochondrial diseases. Nevertheless, we are aware of
two important aspects: (1) a perfect experimental model mimicking LHON is not available; (2) in
vivo use of AAV2/2 vector has limitations. Therefore, a criticism that can be raised in this context is
why AAV2/2 vectors that allow the synthesis of either mutant or wild-type human ND4 were not
used simultaneously instead of using AAV2/2-GFP vector as a negative control as was published in
2012 by Yu and colleagues [4], [5]. In our perspective, the AAV vector properties could
compromise the transduction yield when performing successive AAV2 administrations. For
instance, if a first injection with AAV2/2-mutant ND4 aimed at triggering RGC degeneration is
performed and subsequently the prevention of this deleterious effect is sought by a second
administration of the AAV2/2-wild-type ND4. It was reported that the rapid humoral immune
response against AAV capsid or transgene product blocked vector expression upon readministration
via the same route into either the same or the partner eye, leading to attenuated transgene
expression and loss of transduction efficacy [6]. An independent team published a thorough study
using subretinal administration of an AAV2 vector; they confirmed data published by Li and
colleagues [6] since they demonstrated that when high doses of vector were injected into the right
and then the left eye 3 weeks apart, neutralizing antibody titers were boosted thus inhibiting the
transgene expression in 62.5% of the eyes that received the second injection [7]. Despite of this
limitation, we did confirm that the LHON model described in the current work: G11778A-ND4
plasmid DNA intravitreal injection and transduction of RGCs by in vivo ELP followed 10 days later
with an intravitreal administration of AAV2/2-GFP (Figures 6 to 8) gave the same kind of results
regarding RGC number, CI activity in ONs and visual function than animals which received a
single intravitreal injection of the AAV2/2-mutant ND4 gene (Figures 8 and S3). Consequently, the
comparison of AAV2/2-GFP and AAV2/2-ND4 data is applicable and allows concluding that the
human ND4 is able to preserve RGC integrity and visual function in the LHON model studied.
3
Retinal ganglion cell number estimation
The estimation of the overall RGC number was assessed on flat mounts retinas immunolabeled for
BRN3A as follow: 12 to 14 non-adjacent frames from the central region of the retina (estimated
area of each frame was 0.15 mm2) were captured at the objective x 20 and used for manual counts
of visually identified RGCs as BRN3A-positive cells.
The amount of RGC transduced cells after AAV2/2 administration was estimated from each retina
on 2-3 entire consecutive cryostat sections with depth at ~400 mm from the ON, using BRN3A and
GFP immunolabelling as previously described [2]. BRN3A is a transcription factor expressed in
90% in adult rat retinas [1]. A recent report, described that estimates of RGC numbers were similar
in Brn3a stained retinal wholemounts and Brn3a-stained radial sections.[8]. Manual counting of
immunopositive cells was performed after capturing each whole retinal section in 20–24 images;
the identity of each rat was unknown for the counting. Transduced RGCs were estimated in 9 eyes
in which AAV2/2-ND4 was intravitreally administrated (1 x 109 VG or 5 x 109 VG) and 5 eyes in
which AAV2/2-ND4 administration (1 x 109 VG) was performed ten days after in vivo ELP with
mutant ND4 plasmid DNA (20 μg).
Legends to Supplementary Figures
Figure S1: Transduction efficiency of AAV2/2-ND4
(A) Immunofluorescence analyses with antibodies against BRN3A (red) and GFP (green) of
cryostat retinal sections from animals subjected to intravitreal injection of AAV2/2-ND4 (1 x 109 or
5 x 109 VG) in their left eyes. Nine animals were sacrificed between 2 to 10 months after the
intervention. Two treated eyes and one untreated eye are shown: in the middle panel the white
arrowhead illustrates a GFP-positive cell which was not stained with the BRN3A antibody; in the
bottom panel a red arrowhead shows a BRN3A-positive cell which was not labeled with the GFP
antibody. Nuclei were stained with DAPI (blue); scale bars represent 25 µm. Abbreviations: GCL,
ganglion cell layer; INL, inner nuclear layer; ONL, outer nuclear layer.
4
(B) Numerical evaluation of data presented in (A). 2-3 independent sections per animal were
counted to estimate the overall number of: (i) RGCs (BRN3A-positive cells), (ii) transduced cells in
the GCL (GFP-positive cells), (iii) transduced RGCs (BRN3A and GFP positive-cells) and (iv)
transduced cells in the GCL which were not labelled with the anti-BRN3A antibody: GFP (BRN3A). Histogram shows the mean ± SEM for the nine animals assessed.
(C) To determine whether AAV2/2 transduction efficiency could change when performed after ELP
compared to a single AAV2/2 injection, RGC numbers were estimated in five independent retinal
sections obtained from animals transduced with mutant ND4-DNA via ELP and ten days later
subjected to a single intravitreal injection of AAV2/2-ND4 (1 x 109 VG in the same eyes); animals
were euthanized 3 to 6 months after AAV2/2-ND4 injection. First, retinal sections from treated and
untreated eyes were immunostanied for BRN3A (red) and GFP (green); one image is illustrated as
eye # 3. To determine the overall number of RGC which were transduced with the vector 2-3
independent sections per animal were counted for BRN3A-positive cells, GFP-positive cells,
BRN3A + GFP positive-cells) and cells in the GCL which were BRN3A negative but GFP-positive
(GFP - BRN3A). Histogram shows the mean of cells counted per animal ± SEM for the five
animals evaluated.
Table S1: Ocular administration of AAV2/2 vectors
Type of ocular
intervention
Single
intravitreal
injection of
AAV2/2-ND4
Number of eyes
142
AAV2/2 doses
(VG / mL)
1 x 108, 5 x
108, 1 x 109, 5
x 109 and 1 x
1010
3
Cataracts
development
G11778A-ND4
vector injection +
ELP and 10 days
later intravitreal
injection of
AAV2/2-ND4
60
G11778A-ND4
vector injection +
ELP and 10 days
later intravitreal
injection of
AAV2/2-GFP
23
5 x 108, 1 x 109, 5 x
109 and 1 x 1010
3 x 109
6
2
5
Eye fundus
visualizations /
number of eyes in
which nerve fiber loss
was evidenced
Optomotor response
assessments /
abnormal response in
the treated eye
60 / none
54 / 2
1 with ~ 30% of loss
and 1 with a
moderate loss
18 / 6
3 presented ~half of
loss and the 3 others
more moderate loss
30 / none
30 / 2 with a reduced
response in the
treated eye (~70% of
the control value)
15 / 15 with reduced
responses (Fig. 10A)
Eye fundus was visualized using cSLO: The convenient en face (xy) imaging is well adapted to
visualize the retinal nerve fiber layer (RNFL). These evaluations allow obtaining images of the
nerve fiber layer in which the disposition of the nerve bundles in a single plane is well resolved
because of their cylindrical shape over the pigmented background, thus the distinction of individual
bundles of RGC axons becomes possible [9], [10]. We evaluated Long evans rats and their degree
of pigmentation influenced fundus imaging; in these animals because the absence of reflected light
from the choroid and sclera the contrast between the fiber bundles and the dark background was
increased. Therefore, fiber bundles appeared as visible white striations radiating from the optic disc
[9]. In the LHON model animals (mutant ND4-DNA injection + ELP and 10 days later intravitreal
injection of AAV2/2-GFP) fiber bundles disappearance was evidenced as two different patterns: (1)
the presence of a large dark region (absence of white nerve fiber bundles) covering between 2550% of either the superior or inferior region close to the injection site (Fig. 7); (2) a more discreet
and scattered fiber loss with many fiber bundles being thinner relative to eye fundus before vector
administration; in these cases other assessments became more informative such as optomotor tests,
RGC counts, optic nerve immunolabeling or CI activity measurements in ONs.
6
Table S 2: Antibody description
Antibody or reagent
Type
Concentration
Supplier, reference
BRN3A
monoclonal
IIF: 8 µg / mL
Millipore, mab1585
BRN3A
polyclonal
IIF: 2 µg / mL
Sigma, B9684
HA1
monoclonal
IIF: 30 µg/ mL
Western and BNPAGE: 6 µg / mL
Invivogen, ab-hatag
HA1
Rat monoclonal coupled to Western and BNPeroxidase
PAGE: 0.2 µg / mL
IIF:1.5 μg / mL
Roche, 12 013 819 001
GFP
polyclonal
Torrey Pines Biolabs, TP401
ATP synthase-subunit 
monoclonal
ATP synthase-subunit 
monoclonal
IIF: 2 µg / mL
LifeTechnologies, A-21351
β-Actin
monoclonal
Western: 0.2 µg / mL
Sigma Aldrich, A5316
ND6
polyclonal
IIF: 5 µg / mL
Abcam, ab81212
NDUFB6
monoclonal
IIF: 10 µg / mL
Abcam, ab110244
NDUFS1
polyclonal
IIF: 10 µg / mL
BN-PAGE: 1 µg / mL
Abcam, ab102552
VDAC
monoclonal
IIF: 1.5 µg / mL
Abcam, ab15895
Western: 0.2 µg / mL LifeTechnologies, 7H10BD4F9
7
OPA1
polyclonal
IIF: 5 µg / mL
Abcam, ab42364
TOMM20
monoclonal
IIF: 5 µg / mL
Abcam, ab56783
NDUFB8
monoclonal
Western and BNPAGE: 1 µg / mL
LifeTechnologies, 459210
NDUFA9
monoclonal
Western and BNPAGE : 1 µg /mL
LifeTechnologies, 459100
SDHA1
monoclonal
IIF: 2.5 µg /mL
BN-PAGE: 0.5 µg /
mL
Abcam, 2E3GC12FB2AE2
UQCRC1
monoclonal
BN-PAGE: 1 µg / mL
LifeTechnologies, 459140
DAPI (4',6-Diamidino-2Phenylindole,
Dihydrochloride)
Nucleic Acid Stain
IIF: 2 μg / mL
LifeTechnologies, D1306
Alexa 488
Anti-IgG
rabbit
4 µg / mL
LifeTechnologies, A11008
Alexa 594
Anti-IgG
mouse
4 µg / mL
LifeTechnologies, A11005
GMPO
Goat anti-mouse IgG,
horseradish peroxidase
conjugate
1 µg / mL
or
0.05 µg / mL
LifeTechnologies, G21040
or Jackson ImmunoResearch,
115-035-003
Goat Anti-mouset IgG
Goat Anti-mouse IgG
horseradish peroxidase
conjugate
0.05 µg / mL
Jackson ImmunoResearch
Laboratories, 115-035-003
All the monoclonal antibodies used were from mouse origin and the polyclonal antibodies were
generated in rabbit.
Abbreviations: IIF, indirect immunoflourescence encompassing either retinal or optic nerve section
labeling or the In situ Proximity Ligation Assay; BN-PAGE, Blue Native-PolyAcrylamide Gel
Electrophoresis.
8
Table S3: Primers for RT-qPCR assays
Gene
Primer Forward 5’- 3’
Primer reverse 5’- 3’
Human WT-ND4 CCTGGCCATCATCACTAGGT
GCAGGAGGATGTTCAGGCTA
ATP6
CAACCAACCTTCTAGGGCTT
C
GCGGTAAGAAGTGGGCTAAA
SNCG
GTAACCTCGGTGGCTGAGAA
TTCCAAGTCCTCCTTGCGTA
BRN3A
AGGCCTATTTTGCCGTACAA
CGTCTCACACCCTCCTCAGT
REFERENCES
1.
Nadal-Nicolas, FM, Jimenez-Lopez, M, Sobrado-Calvo, P, Nieto-Lopez, L, Canovas-Martinez, I,
Salinas-Navarro, M, et al. (2009). Brn3a as a marker of retinal ganglion cells: qualitative and
quantitative time course studies in naive and optic nerve-injured retinas. Invest Ophthalmol Vis Sci
50: 3860-3868.
2.
Ellouze, S, Augustin, S, Bouaita, A, Bonnet, C, Simonutti, M, Forster, V, et al. (2008). Optimized
allotopic expression of the human mitochondrial ND4 prevents blindness in a rat model of
mitochondrial dysfunction. Am J Hum Genet 83: 373-387.
3.
Schindehutte, J, Fukumitsu, H, Collombat, P, Griesel, G, Brink, C, Baier, PC, et al. (2005). In vivo
and in vitro tissue-specific expression of green fluorescent protein using the cre-lox system in mouse
embryonic stem cells. Stem Cells 23: 10-15.
4.
Yu, H, Koilkonda, RD, Chou, TH, Porciatti, V, Ozdemir, SS, Chiodo, V, et al. (2012). Gene delivery
to mitochondria by targeting modified adenoassociated virus suppresses Leber's hereditary optic
neuropathy in a mouse model. Proc Natl Acad Sci U S A 109: E1238-1247.
5.
Yu, H, Ozdemir, SS, Koilkonda, RD, Chou, TH, Porciatti, V, Chiodo, V, et al. (2012). Mutant
NADH dehydrogenase subunit 4 gene delivery to mitochondria by targeting sequence-modified
adeno-associated virus induces visual loss and optic atrophy in mice. Mol Vis 18: 1668-1683.
6.
Li, Q, Miller, R, Han, PY, Pang, J, Dinculescu, A, Chiodo, V, et al. (2008). Intraocular route of
AAV2 vector administration defines humoral immune response and therapeutic potential. Mol Vis
14: 1760-1769.
7.
Barker, SE, Broderick, CA, Robbie, SJ, Duran, Y, Natkunarajah, M, Buch, P, et al. (2009).
Subretinal delivery of adeno-associated virus serotype 2 results in minimal immune responses that
allow repeat vector administration in immunocompetent mice. J Gene Med 11: 486-497.
8.
Mead, B, Thompson, A, Scheven, BA, Logan, A, Berry, M, and Leadbeater, W (2014). Comparative
evaluation of methods for estimating retinal ganglion cell loss in retinal sections and wholemounts.
PLoS One 9: e110612.
9
9.
Paques, M, Simonutti, M, Roux, MJ, Picaud, S, Levavasseur, E, Bellman, C, et al. (2006). High
resolution fundus imaging by confocal scanning laser ophthalmoscopy in the mouse. Vision Res 46:
1336-1345.
10.
Kanamori, A, Catrinescu, MM, Traistaru, M, Beaubien, R, and Levin, LA (2010). In vivo imaging of
retinal ganglion cell axons within the nerve fiber layer. Invest Ophthalmol Vis Sci 51: 2011-2018.
10