1 Electronic supplementary material 2 3 Table S1 Primers used in this study Target gene Primer Sequence (5' to 3') NOS promoter for NPTII CCCCTCGGTATCCAATTAGAG NOS terminator for NPTII CGGGGGGTGGGCGAAGAACTCCAG Upstream primer of CMV CP TGAACTCGAG CCATGGCAGCTTTCGCGACTTAAC Downstream primer of CMV CP AATTGGATCCCACGAGGACGGCGTACTT Upstream primer of CGMMV CP ACGTGGATCCGTATGGCTTACAATCCGATC Downstream primer of CGMMV CP TGTTCTCGAG CTGCAGGAAAACGCGGCTTCAAAT Upstream primer of WMV CP TCCACTGCAGGGTGTATCGATAACGGTA Downstream primer of WMV CP GTCACTCGAG TGTACACTGGTTGGACCCATACCCAACAAA NPTII CMV CP CGMMV CP WMV CP 4 CTCGAG: restriction enzyme site of XhoI, CCATGG: restriction enzyme site of NcoI, GGATCC: restriction enzyme site of BamHI, CTGCAG: restriction 5 enzyme site of PstI, TGTACA: restriction enzyme site of BsrGI. 1 2 3 Fig. S1 Schematic representation of pGA482G-WoCGW containing the fusion of CP gene fragments 4 of CMV, CGMMV, and WMV linked to the silencer DNA (m/2 N of WSMoV). The expression 5 cassette containing three viral CP gene fragments (CGW) was digested with HpaI and SacI and 6 ligated into the plant transformation vector pGA482G and the resulting vector was named pGA482G- 7 WoCGW. 35S-enh, enhancer of CaMV 35S promoter; 35S-Pro, CaMV 35S promoter; AlMV, the 5' 8 untranslated region of Alfalfa mosaic virus coat protein gene; 35S-ter, CaMV 35S terminator; RB, 9 right border; LB, left border. 10 1 2 Fig. S2 Transformation and regeneration of transgenic watermelon plants. (a) Seeds were sterilized 3 with bleach, rinsed with sterile distilled water and then germinated on MS medium, (b) Seedlings 4 three days after germination (c) Explants co-cultured with Agrobacterium, (d) Explants grown on 5 selection medium containing 100 mg/l kanamycin, (e) Transgenic shoots regenerated on selection 6 medium containing 100 mg/l kanamycin for 2-3 weeks after transformation, (f) Shoots selected on 7 elongation medium containing 200 mg/l kanamycin. (g) A shoot growing on elongation medium 8 containing 50 mg/l kanamycin, (h) Rooting of shoots on rooting medium containing 1 mg/l IBA two 9 weeks after transfer, (i) A transgenic plant in soil in a greenhouse. 10 1 2 Fig. S3 Southern blot analysis of pGA482G-WoCGW transgenic watermelon R1 plants. (a) Fifteen μg 3 genomic DNA of progeny plants from line 6 were digested with HpaI and hybridized with the probe 4 corresponding to the transgene sequence (CGW fragment). (b) The same DNA samples (15 ug) were 5 digested with BamHI/PstI and hybridized with the probe corresponding to the partial CP gene of 6 CGMMV. N, non-transformed susceptible watermelon plant; P, plasmid DNA of pGA482G- 7 WoCGW. 8 9