Gene Expression
Discovery of Genes
Classwork
1. Discuss the statement: “DNA is evolution”.
2. Following the scientific method: please re-read the notes regarding Griffith’s experiment. Come up with
a viable hypothesis for the experiments.
3. Describe the independent and dependent variables in Griffiths’ experiment.
4. Describe what Griffith concluded from this experiment.
5. Avery decides to use an ASSAY to perform his test. Describe the benefit of using this format over
Griffith’s experiment.
6. Describe the significance of X-ray diffraction being used in the search for the structure of DNA.
7. Compare and contrast characteristics of an RNA and a DNA molecule.
8. Describe the major chemical features of a DNA molecule.
Homework
Read the following article “Isolating Hereditary Material: Frederick Griffith, Oswald Avery, Alfred Hershey, and
Martha Chase” By: Clare O'Connor, Ph.D. (Biology Department, Boston College) © 2008 Nature Education
and answer the questions that follow.
http://www.nature.com/scitable/topicpage/isolating-hereditary-material-frederick-griffith-oswald-avery-336
9. Describe the relationship between polysaccharides found in the capsule and the virulence of the
pneumococci.
10. Take a close look at figure 3, this provides a detailed of Avery’s experiment. Provide a hypothesis for
Avery’s experiment.
11. Describe the independent and dependent variable for Avery’s experiment.
12. Describe the conclusion Avery was able to ascertain after completing his experiment.
13. Alfred Hershey and Martha Chase choose to use bacteriophage for their experiment. Explain why they
choose this for their experiment, and provide a brief description of a bacteriophage.
14. Describe the significance of X-ray diffraction being used in the search for the structure of DNA.
15. Compare and contrast characteristics of an RNA and a DNA molecule.
16. Describe the major chemical features of a DNA molecule.
17. Chromosome size and structure can vary widely depending on the type of organism. Briefly describe
the typical eukaryotic and prokaryotic chromosome.
18. Sketch and label a typical eukaryotic chromosome. Include the following in you drawing. Centromere,
histone, short arm and long arm.
DNA Replication
Classwork
19. Give the complimentary strand to the following DNA sequence: 5’ATTCGCATGCCAGTTA3’
20. Discuss why DNA replication is known as “semi-conservative” replication.
21. Describe the direction that new nucleotides are added to the template side of the molecule. Which
carbon does the new nucleotide phosphate bond to, and what is the name of this bond?
22. Enzymes are important proteins used in chemical processes. Describe the role of topoisomerase,
helicase, and DNA polymerase in DNA replication.
23. Originally it was thought that DNA was copied from 3’ to 5’ and 5’ to 3’ in the same way on both
strands, however DNA polymerase only works in the 3’ to 5” direction. Describe how Okazaki
fragments work.
24. Suppose there were a mutation and the enzyme primase could not be synthesized. What effect would
this have on DNA replication?
www.njctl.org
PSI AP Biology
Gene Expression
25. PCR is a technique used to amplify small amounts of DNA. Describe the procedure used in this
process.
Homework
26. What is the purpose of DNA replication in the cell?
27. Give the complementary strand for the following DNA sequence: 3’GCATACGATATTCCGG5’
28. Why does DNA base pairing occur?
29. DNA polymerase makes a mistake once in every 104 – 105 nucleotides. Discuss the enzyme
responsible for fixing these errors and what occurs when the mistakes are repaired.
30. The lagging strand of DNA requires additional enzymes to replicate than the leading strand. Explain
why this is so.
31. A single DNA molecule is placed in a PCR machine. How many DNA molecules will be present after
30 cycles?
32. PCR techniques require enzymes from thermophilic bacteria. Explain.
Transcription & Translation
Classwork
33. Gene expression is the molecular process of reading the order of nucleotides in a DNA molecule and
making the coded product. Describe the requirements needed for a gene to be expressed.
34. Describe what is meant by the phrase “Universal Genetic Code”, and explain the significance of having
64 codons that code for only 20 amino acids.
35. Transcribe the following gene (nontemplate strand):
TACCCGCCTAATCAGTGCTTCCTTTATCCGCATGCCCGGATCGGAATT
36. Add a poly A tail and an mG cap to your answer for #35.
37. Cut the RNA from #36 into exons and introns at the appropriate base sequences. Sections containing
bases in between GU and AG (including these bases) are introns. Outside of these cut regions are
exons. Show cuts on mRNA.
38. Splice the above exons together. Draw this beneath the cut RNA and label it.
39. Translate the processed RNA from #38 into the correct polypeptide using the codon chart. Draw the
polypeptide beneath the RNA and label it appropriately.
40. Describe how the lac operon works.
41. Describe the difference between the P-site and the A-site on the ribosome. Which does mRNA enter
first?
42. Describe the significance of methionine, please provide the mRNA codon.
43. Hypothesize why there is only one start codon yet there are 3 stop codons.
44. In 1958 Francis Crick stated what he called the “Central Dogma of Biology”. To what was he referring?
Homework
45. Describe the role and mechanism of transcription factors in gene regulation.
46. Explain why RNA polymerase does not bind to the “non-template strand”.
47. Translation is a crucial step in the assembly of a protein. Describe the three stages of translation
involved in protein synthesis.
48. RNA plays a critical role in the process of translation. Describe the structure and role of the three types
of RNA that are used during translation.
49. Walter Fleming stated that chromatin appeared like threadlike structures in the cell’s nucleus. Describe
how chromatin can affect gene expression.
50. Following transcription the mRNA has to under go what is known as mRNA processing. Provide a
description to mRNA processing, and an explanation as to why it is needed.
51. After transcription mRNA must be stripped of useless strands that were copied and intermingle the
target gene. Surprisingly, many biology students confuse the two because of the first two letters in
www.njctl.org
PSI AP Biology
Gene Expression
each of their names. Provide a proper explanation for the coding and non-coding parts involved in RNA
splicing.
52. The follow gene can code for more than one polypeptide. This will be dictated by which parts of the
gene are inhibited and which are expressed. Given the following DNA strand, show pre mRNA,
alternate splices, and translation to amino acids. The parts that are underlined and italics are part of the
same polypeptide.
DNA Template - AAG AAT GGC CGG TTA AGA CCC
mRNA alternate splices
amino acids
53. Describe the trp operon.
54. Provide a summary of Gene Regulation in Eukaryotic Cell. Along with you written summary provide a
15 base long of DNA, then use is as an example for each step. Be sure to point of the 3’ and 5’ end.
55. Given the following polypeptide, provide a possible DNA molecule, please label the 5’ and 3’ end.
Glu – Ser – Arg – Phe – Leu - Val
56. Describe the attachment site for RNA polymerase. Also describe what may inhibit it from attaching to
DNA.
Recombinant DNA
Classwork
57. In you own words describe “recombinant DNA”. What was the significance of development of Humulin?
58. Briefly outline the steps involved in making Recombinant DNA.
59. Splicing a red fluorescent gene from a jellyfish into the genome of a puppy has created transgenic
glowing puppies. These two species are not closely related. Explain how the puppy’s cells can utilize
this gene.
Homework
60. Restriction enzymes play an important role in Recombinant DNA technology. Describe their role and
explain how you decide which enzyme to use.
61. Some restriction enzymes makes cut that result in blunt ends while other create sticky ends. Describe
the difference between blunt ends and sticky ends.
62. Describe the role of gel electrophoresis in recombinant DNA technology.
www.njctl.org
PSI AP Biology
Gene Expression
Free Response
1. The above diagrams illustrate the
experiments carried out by Griffith and Hershey and Chase- respectively.
a. Describe the hypothesis or conclusion that each set of experiments proved or set out to test.
b. Why were the Griffith experiments inconclusive as to the source of the genetic material?
2. If dividing cells are treated with the
pyrimidine analog bromodeoxyuridine(BrdU), during DNA
replication, the cells are fooled into
incorporating it —instead of thymidine
(thymine) — into their DNA.
One of the properties of the resulting DNA
is that it fails to take up stain in a normal
way.
When cells are allowed to duplicate their
chromosomes once in BrdU, the
chromosome that appear at the next
metaphase stain normally.
However, when the cells duplicate their
chromosomes a second time in BrdU, one of
Thymine
the sister chromatids that appears at the
bromodeoxyuridin
next metaphase stains normally, while its
e
sister chromatid does not (Harlequin Chromosomes). Note that
each chromatid is normally completely stained or not (circled).
http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/B/Bodycote_L.jpg
a) Using your knowledge of DNA replication, describe a
possible hypothesis of why only one sister chromatid gets stained darker than the other chromatid after
the second round of cell division?
b) What will you expect to see in the chromosome staining pattern if cells are allow to divide for one more
round of DNA replication and cell division after the initial 2 rounds of cell division and DNA replication?
www.njctl.org
PSI AP Biology
Gene Expression
3. Lactose metabolism is controlled by the lac operon, which consists of the lacZ, lacY, and lacA genes
encoding β-galactosidase, lactose permease, and transacetylase, respectively. Expression of the operon is
negatively regulated by a transcription factor, the lac repressor (LacI), which dissociates from its specific
binding sequences of DNA, the lac operators, in the presence of an inducer to allow transcription (Fig. A). The
repressor LacI and permease LacY form a positive feedback loop. Expression of permease increases the
intracellular concentration of the inducer lactose which causes dissociation of LacI (lactose repressor) from the
promoter (Plac), leading to even more expression of permeases.
Cells with a sufficient number of permeases
will quickly reach a state of full induction
(Figure B), whereas cells with too few
permeases will stay uninduced. (B) After 24
hours of growth in media containing 30 μM
TMG, strain SX700 expressing a LacY-YFP
fusion exhibits all-or-none fluorescence in a
fluorescence-phase contrast overlay (bottom,
image dimensions 31 μm × 31 μm).
Fluorescence imaging with high sensitivity
reveals single molecules of permease in the
uninduced cells (top, image dimensions 8 μm ×
13 μm).
A Stochastic Single-Molecule Event Triggers Phenotype
Switching of a Bacterial Cell
Paul J. Choi, Long Cai, Kirsten Frieda, and X. Sunney Xie
Science 17 October 2008: 322 (5900), 442-446.
a) If there is no lactose present, why will
the E. coli cells not produce the proteins
involve in lactose metabolism?
b) The boxed cells in figure B shows cells
will single molecules of permease present
within the cells, why are these cells not fully
fluorescent?
www.njctl.org
PSI AP Biology
Gene Expression
4. The diagram shows 2 possible pathways
of polymerase exchanges that are
supported by the results of observing
changes in the fluorescence and bleaching
(removing fluorescence) of single molecular
fusions of polymerase III, the major DNA
polymerase in bacteria, within the replication
fork of live E. coli cells.
Polymerase Exchange During Okazaki Fragment Synthesis
Observed in Living Cells
Giuseppe Lia, Bénédicte Michel, and Jean-François
Allemand
Science 20 January 2012: 335 (6066), 328-331
a) Describe why so many proteins are
required to carry out the process of DNA
replication?
b) Why does DNA need to get copied?
c) Select the model that you think that
cells would favor and provide a rationale for
your choice.
5. For more than a decade,
circadian (daily rhythms)
researchers have examined the
RNA molecules produced
cyclically in many tissues.
Consistently, the rhythmically
expressed genes exhibited
expression peaks throughout
the entire day, with an
enrichment for transcripts
peaking at the dawn and dusk
transitions.
The core transcriptional
machinery of the mammalian
circadian clock includes
BMAL1, CLOCK, and NPAS2
proteins that positively regulate
gene targets that contain the
circadian cis-regulatory sequence known as an enhancer box (E box), or a slight sequence variant the E′box,
in their promoters or enhancers. The circadian regulators PER1, PER2, PER3, CRY1, and CRY2 have a
repressive role on these same targets. The transcriptional activity takes place in three phases (see the figure).
First, a transcriptionally poised state occurs as both the repressor, CRY1, and the activators, BMAL1 and
CLOCK, occupy regulatory sequences. As the amount of CRY1 binding slowly decreases, the transition to
www.njctl.org
PSI AP Biology
Gene Expression
activation (the second phase) occurs as the coactivator protein p300 and marks of active chromatin (DNA and
protein) [histone acetylation (H3K9ac) and methylation (H3K4me1)] are established. In the final repressive
state, BMAL1 and CLOCK occupancy decreases and accumulation of the repressive factors PER1, PER2, and
CRY2 is observed on target genes. It will be interesting to see how this transition occurs at each individual
promoter, whether the same DNA region can retain both repressors and activators in the poised state, or
whether this observation reflects an average of multiple cells in different states of transition.
Circadian Surprise—It's Not All About Transcription
Colleen J. Doherty and Steve A. Kay
Science 19 October 2012: 338 (6105), 338-340.
a) Select one activity either performed by a cell or an organism that may be regulated by the circadian
clock described in the above reading. Describe the rationale by your choice.
b) Using the above graph, provide evidence to support the idea that BMAL1 and CLOCK regulate daytime
activity.
c) Our day is 24 hours long; the length of day varies in other planets. How would a change in the length of
the day affect the circadian clock? How would the information be relayed to the transcription pathway
that is the circadian clock?
www.njctl.org
PSI AP Biology
Gene Expression
Gene Expression-Answer Key
1. DNA is the genetic material passed on to future individuals. Small changes in the DNA, such as
mutations can be passed onto future generations. These changes can add up over time and lead to
evolution of the organism.
2. Answer may vary, but should be written in proper format and have been measured in his findings.
3. Independent variable - type of Bacteria injected Dependent variable – survival of the mice (alive or
dead)
4. Griffith concluded that the R- strain had been “transformed into a deadly strain of bacteria.
5. An assay allows the scientist to analyze differences in test tubes after treating each differently with
more specific reactions.
6. X-Ray diffraction enabled scientists to see DNA’s double helix structure. X-Ray diffraction involves
shooting subatomic particles into a substance, and when they diffract off of a structure, a clear image is
observed.
7. RNA – Uracil is used as a nitrogenous base in place of Thymine on a DNA molecule. RNA is single
stranded and can therefore be folded into different shapes while DNA is double stranded and can only
be double helix in shape.
8. Composed of a sugar (deoxyribose) – phosphate backbone with 4 nitrogenous bases, Adenine,
Guanine, Cytosine and Thymine. Purines Adenine and Guanine bond with Pyrimidines Thymine and
Cytosine respectively via 2 hydrogen bonds (A –T) and 3 hydrogen bonds (G – C). This forms DNA’s
double helix structure.
9. Avery found that the pneumococci that were encapsulated where more virulent than the nonencapsulated form.
10. If assays of virulent bacteria are treated with enzymes to kill protein, DNA, and RNA are mixed with
non-virulent bacteria then transformation will occur in both assays that were treated with protein
enzyme and RNA enzyme.
11. Independent variable- enzymes used to destroy DNA, RNA, and protein. Dependent variable is the
presence of Encapsulated bacteria.
12. That DNA was the transforming agent.
13. A bacteriophage is a virus that infects a bacterium, it consists of a protein coat and DNA, it also
reproduces quickly and can easily be harvested. Hershey and Chase used radioactive P and S to track
the differences in the protein and DNA, since only DNA contains P and only proteins contain S. The
infected bacteria with the phage that had the radioactive S, and they infected another group of bacteria
with the radioactive P. The results showed that the bacteria contained radioactive P entered the
bactiurm.
14. X-ray diffraction provided a visual window showing that the structure of DNA was a double helix.
15. Both are nucleic acids necessary for living organisms. RNA contains Uracil and is single stranded and
can fold in to many shapes. DNA is double stranded, helical in shape and does not contain uracil.
16. DNA is double helix. The backbone or sides of the latter are alternating sugar- phosphate molecules.
The rungs of the latter are made up of the nitrogenous bases: Adenine, thymine, guanine and cytosine.
Adenine and guanine are purines (double ring structures). Thymine and cytosine are pyrimidines
(single ring structures). A-T always bonds together with 2 H bonds, likewise G-C are held together with
3 H bonds. The two strands run antiparellel.
17. Eukaryotic chromosomes are typically linear and larger than prokaryotic chromosomes. They can be
found in scaffold arrangements. The DNA is wound around protein structures called histones. These
beads on a string fold up making an arm called a chromatid. Prokaryotic cell have circular DNA that
contains a significantly smaller amount of nucleotides. All the genes are arranged in a circle.
18. Drawings should include all terms.
19. 3’ TAAGCGTACGGTCAAT 5’
20. Each new DNA molecule contains half of the original strand and half of the new strand.
www.njctl.org
PSI AP Biology
Gene Expression
21. Each new nucleotide bonds in the 5’ to 3’ direction. Nucleotides are added to the –OH end of carbon 3
by a phosphodiester bond.
22. Helicase unzips the double strand by breaking the H bonds between nucleotide bases, topoisomerase
controls over winding or underwinding of the DNA. DNA polymerase follows behind helicase and copies
the template as its being exposed.
23. Primase adds RNA nucleotides as a primer for DNA polymerase on the lagging strand. This happens a
couple of nucleotides at a time. Ligase binds the fragments together.
24. Primase adds primers to the lagging strand, without it you could not copy the lagging stand.
25. Heat the DNA to denature, separating the double helix. Cool the DNA and add primers and
polymerase to the mixture. Slightly increase the temperature to speed the rate of replication. Repeat
the cycle until you have the desired amount of DNA.
26. DNA contains genetic information necessary to the development and functioning of all living organisms.
Cell division occurs in order for an organism to live and grow. When this occurs, all of the cell’s genetic
information from the DNA must be replicated and passed on to each of the daughter cells.
27. 5’ CGTATGCTATAAGGCC 3’
28. Base pairing occurs between a pyrimidine and a purine because two purines would be too large and
two pyrimidines would be too small to reach each other. Adenine pairs with Thymine because there are
two spots on each molecule to hydrogen bond. Guanine and Cytosine each have three spots to
hydrogen bond. This base pairing forms the double helix structure which twists.
29. DNA polymerase repairs its own errors. When an incorrect nucleotide is recognized, polymerase
reverses its direction by one base pair of DNA, excises the incorrect nucleotide and replaces it.
30. DNA Polymerase can only read in the 3’ to 5’ direction (leading strand). The new strand off of the
lagging strand must be made in reverse, and this is why additional enzymes are used.
31. 1,073,741,824
32. These enzymes can withstand the high temperature it takes to denature the DNA strands.
33. Translating for the four-letter language of DNA to RNA, then the four-letter language of RNA to the 20
letter language of proteins (their amino acid sequence).
34. All life uses the same 4 bases A, T, C, G in 3 letter combinations to code for amino acids is the
universal genetic code. Having 64 codons and only 20 amino acids provides room for errors that may
occur at any point.
35. TACCCGCCTAATCAGTGCTTCCTTTTACCGCATGCCCGGATCGGAATT
AUGGGCGGAUUAGUCACGAAGCAAAUAGGCCUACGGGCCUAGCCUUAA
36. GTACCCGCCTAATCAGTGCTTCCTTTATCCGCATGCCCGGATCGGAATTAUGGGCGGAUUAGUCA
CGAAGGAAAUAGGCGUACGGGCCUAGCCUUAAAAAAAA
37. AUGGGCGGAUUAGUCACGAAGGAAAUAGGCGUACGGGCCUAGCCUUAA
38. mGAUGGGCGGAUUAGAAAUAGGCCCUUAAAAAAAA
39. Met - Gly – Gly – Leu – Glu – Ile – Gly – Pro
40. Allolactose will bind to the repressor causing a change in its shape, making it fall off. Now RNA
polymerase can bind to the promoter and transcribe the lac gene. When lactose is all broken down and
no longer present, the repressor goes back on the promoter.
41. The P-site is the new protein will emerge, and the A-site is where the amino acids are delivered. The
mRNA enters the A-site first.
42. Methionine is the first amino acid code for by mRNA, its codon is AUG.
43. There are a couple of hypotheses that can be accepted here. One case: there is a frameshift mutation,
3 codons provide more of an out. Another is that they could provide room for the evolution of future
amino acids.
44. DNA makes RNA, which code for a protein.
45. Transcription factors regulate when RNA polymerase can bond to the region of DNA that is to be
transcribed. The transcription factors can bind to either a promoter region or enhancer region on the
DNA. Depending on the type of TF, the gene will either be regulated up or down.
www.njctl.org
PSI AP Biology
Gene Expression
46. This is because the RNA makes a mirror image of the gene. Once RNA polymerase opens the
replication bubble, corresponding RNA nucleotides will attach to the DNA nucleotides until the gene is
transcribed.
47. The first step is initiation. The small ribosome subunit rRNA, mRNA and tRNA with Met aa. Next the
large subunit rRNA will join the small unit. Elongation – mRNA moves to the p-site in codon units (3
bases), At the p-site the tRNA corresponding anticodon and amino acid will bind to the matching
codon. Next the amino acids are linked together by a peptide bond. Finally, termination is where the
ribosome reaches the stop codon. The polypeptide is release and the ribosome breaks apart.
48. mRNA, tRNA an rRNA are all single stranded nucleic acids. mRNA carries the information as to which
polypeptide is to be make. It travels from the DNA to the ribosome. tRNA carries the amino acids that
correspond to the codons on the mRNA. rRNA makes up the ribosomal subunits.
49. Chromatin inhibits the action of RNA polymerase. When DNA is packed in chromatin it is not
accessible to RNA polymerase, therefore transcription cannot occur because the DNA is packed to
tightly.
50. The 5’ end receives a modified guanine cap and the 3’ end gets a poly-A-tail added. These
modifications help mRNA get out of the nucleus . They also provide protection from hydrolytic enzymes
in the cytoplasm. Finally, they help ribosomes attach to the mRNA.
51. The RNA transcript has regions that are noncoding called introns. The other regions are called exons
because they are expressed.
52. AAG AAT GGC CGG TTA AGA CCC
UUC UUA CCG GCC AAU UCU GGG
UUC UUA GCC UCU and CCG AAU GGG
Phe-Leu-Ala- Ser
and
Pro-Asn-Gly
53. This is a repressible operon that is usually on. It codes for genes that produce the enzyme tryptophan.
When tryptophan is present in the environment, it acts as a co-repressor and the trp operon is not used.
54. The gene must be unpacked from chromatin. The right transcription factor must be present.
Transcription occurs. Cap and Tail must be added to the mRNA. Pre-mRNA must be edited (spliced),
Nuclear pores allow passage to the cytoplasm. mRNA comes in contact with a ribosome. Translation
occurs. Protein is used within the cell or exported to the environment. Pictures of their DNA may very.
55. 3’ CTTAGAGCAAAAAATCAA 5’ (Other possible strands are acceptable)
56. The promoter region is the attachment site for RNA polymerase, once attached the RNA polymerase
can unwind the DNA to create an initiation bubble. This bubble provides more space for the RNA
polymerase to access the DNA molecule.
57. Recombinant DNA is when genes from one organism are spliced into the DNA of another organism.
Humulin was the first insulin produced by bacteria that contained human insulin genes. The bacteria
manufactured human insulin.
58. 1. Choose the gene of interest. 2. Cut the gene of interest form the genome. 3. Isolate the gene of
interest. 4. Make more of the gene of interest. 5. Paste the gene into the host’s DNA. 6. Collect the
protein
59. Both a puppy and a jellyfish rely on the universal genetic code, RNA polymerase, and ribosomes to
express genes.
60. A restriction enzyme is an enzyme that cuts the DNA at a specific nucleotide sequence. They
recognize a specific sequence of nucleotides and make a cut across both strands of DNA.
61. Sticky ends are when the restriction enzymes cut the DNA in a stair step pattern. Usually this occurs
when it cuts through an inverted palindrome. Blunt ends are straight cuts though both DNA strands.
These are done by small restriction enzymes and done at a mirror-like palindrome site.
62. Gel electrophoresis separates the DNA fragments being worked based on length.
1. Question 1
a. The Griffith experiments showed that the rough bacteria can take a substance from its
environment, which the Avery experiments later proved to be a nucleic acid and not a protein,
www.njctl.org
PSI AP Biology
Gene Expression
and acquired a trait or ability that it did not possess from an organism that was no longer living
(the smooth bacteria). The Hershey and Chase experiments showed that virus injected their
DNA into bacteria and not their protein coat, so DNA was sufficient to generate new viral
particles within the bacteria and pass traits, the whole characteristics of a virus, to the next
generation of virus.
b. The Griffith experiments did not isolate the different cellular products to pin point the causative
agent of the transformation and the source of the new trait in the bacterium; therefore, the
source of the new trait could be assumed to be the DNA and further experiments needed to
carried out to be sure that DNA or nucleic acids were responsible for the observed phenomena.
Learning Objectives:
LO 3.1 The student is able to construct scientific explanations that use the structures and mechanisms of DNA
and RNA to support the claim that DNA and, in some cases, that RNA are the primary sources of heritable
information. [See SP 6.5]
LO 3.2 The student is able to justify the selection of data from historical investigations that support the claim
that DNA is the source of heritable information. [See SP 4.1]
2. Question 2
a. The BrdU disrupts the chemical properties of the nitrogenous base stacking that occurs in the
inner core of the DNA molecule; if one strand contains BrdU, which is the case after one
replication round because of the semi-conservative nature of DNA replication, the chemical
properties are not disturb sufficiently enough to interfere with the staining of the chromosomes.
But after the second round of DNA replication, one chromosome will have both strands of DNA
with BrdU instead of thymine that will stain less dark than the other chromosome that will only
have one strand with BrdU instead of thymine and stain darker.
b. There will be 2 possibilities. If the chromosomes segregate with one dark and light chromosome
going to each new cell, then the staining pattern at the next metaphase will show sister
chromatids with dark and light chromosomes and another sister chromatids with only light
chromosomes. But if the chromosomes segregate with two dark chromatids going to one new
cell and two light chromatids going to the other new cell, then the cell with 2 dark chromatids will
have chromatids showing one dark and one light sister chromatids at metaphase- and the cell
with 2 light chromatids will have both sister chromatids showing light staining patterns.
LO 3.3 The student is able to describe representations and models that illustrate how genetic information is
copied for transmission between generations. [See SP 1.2]
LO 3.1 The student is able to construct scientific explanations that use the structures and mechanisms of DNA
and RNA to support the claim that DNA and, in some cases, that RNA are the primary sources of heritable
information. [See SP 6.5]
LO 2.37 The student is able to connect concepts that describe mechanisms that regulate the timing and
coordination of physiological events. [See SP 7.2]
3. Question 3
a. Without lactose to bind allosterically to the repressor protein on the lac operator, RNA
polymerase is blocked from attachment to the DNA sequence.
b. The concentration of lactose is not high enough to activate transcription of the LacY gene.
Learning Objectives:
LO 2.15 The student can justify a claim made about the effect(s) on a biological system at the molecular,
physiological or organismal level when given a scenario in which one or more components within a negative
regulatory system is altered. [See SP 6.1]
www.njctl.org
PSI AP Biology
Gene Expression
LO 2.16 The student is able to connect how organisms use negative feedback to maintain their internal
environments. [See SP 7.2]
LO 2.17 The student is able to evaluate data that show the effect(s) of changes in concentrations of key
molecules on negative feedback mechanisms. [See SP 5.3]
LO 2.18 The student can make predictions about how organisms use negative feedback mechanisms to
maintain their internal environments. [See SP 6.4]
LO 2.19 The student is able to make predictions about how positive feedback mechanisms amplify activities
and processes in organisms based on scientific theories and models. [See SP 6.4]
LO 2.20 The student is able to justify that positive feedback mechanisms amplify responses in organisms. [See
SP 6.1]
4. Question 4
a. The DNA molecule is a large biomolecule with the information to make proteins and to regulate
their activity; its integrity and ability to be replicated is of prime importance to the survival of
cells. Evolution selected for the complex set of proteins that is required to open the doublestranded molecule, protect the single stranded DNA molecules, polymerases to generate the
new strands, RNA primases to replicate the opposite strand, the ligases to join DNA fragments,
and helicases to twist the DNA and relieve torsion in the large molecule. The slew of proteins
are require to maintain the information in competent enough to produce functional proteins at
the right time.
b. DNA needs to get copied to have an extra set of genetic information for a new cell when a cell
divides. Sometimes DNA gets copied to amplify the protein production capacity of the cells or
tissues the DNA resides in.
c. Both pathways are plausible. Pathway A requires the least number of steps, making the cell
more efficient. Pathway B has more steps but the speed of the steps may be faster and may be
ultimately more efficient.
Learning Objectives:
LO 3.3 The student is able to describe representations and
models that illustrate how genetic information is copied for
transmission between generations. [See SP 1.2]
LO 2.39 The student is able to justify scientific claims, using
evidence, to describe how timing and coordination of behavioral
events in organisms are regulated by several mechanisms.
[See SP 6.1]
LO 2.40 The student is able to connect concepts in and across
domain(s) to predict how environmental factors affect responses to
information and change behavior. [See SP 7.2]
5. Question 5
a. Any activity or behavior that shows fluctuations or changes during the 24 hour cycle is a
candidate activity to be controlled or influenced by the circadian clock. Some examples of
circadian regulated systems are the foraging activity of animals (diurnal vs nocturnal),
mitochondrial respiration, and cell division.
b. BMAL1 and CLOCK are assisted by P300 to help RNA polymerase transcribe many mRNAs
that are involved in regulating the efficiency of the cell. By aligning the activity of these
transcription factors with the time of day, the cell can carry cellular activities that it can do or
coordinated more productively and/or with less energy during the day.
c. The cell must recognize that a change in the length of the day has occurred; this recognition
most likely involves photoreceptors or other light-sensing cells that can relay the information to
other cells via hormones. The circadian clock will try to adjust as much as evolutionarily possible
www.njctl.org
PSI AP Biology
Gene Expression
to make the cellular activity more efficient. If the cell cannot make the necessary adjustments,
the cell will become extinct.
Learning Objectives:
LO 2.35 The student is able to design a plan for collecting data to
support the scientific claim that the timing and coordination of
physiological events involve regulation. [See SP 4.2]
LO 2.36 The student is able to justify scientific claims with
evidence to show how timing and coordination of physiological
events involve regulation. [See SP 6.1]
LO 2.40 The student is able to connect concepts in and across
domain(s) to predict how environmental factors affect responses to
information and change behavior. [See SP 7.2]
www.njctl.org
PSI AP Biology
Gene Expression