The American University in Cairo
Biotechnology Program
Modulators of MRP1 promoter in Neuroblastoma cell lines
A Thesis Submitted to
The Biotechnology Program
In partial fulfillment of the requirements for
the degree of Master of Science
by Myret Said Ghabriel
Bachelor of Pharmacy
Under the supervision of Dr. Hamza El Dorry
And Dr.Shahenda El-Naggar
1
Table of Contents
LIST OF ABBREVIATIONS ................................................................................................................... 4
LIST OF FIGURES ............................................................................................................................... 5
LIST OF TABLES ................................................................................................................................. 6
ABSTRACT ......................................................................................................................................... 7
1.Introduction................................................................................................................................ 13
1.1 Cancer .................................................................................................................................. 13
1.2 Neuroblastoma .................................................................................................................... 16
1.2.1 Background ................................................................................................................... 16
1.2.2 Clinical Presentation and Diagnosis.............................................................................. 18
1.2.3 Pathology, Staging and prognosis ................................................................................ 18
1.2.4 Treatment ..................................................................................................................... 21
1.3 Drug resistance .................................................................................................................... 21
1.4 MRP ..................................................................................................................................... 23
1.5 MRP1 regulation .................................................................................................................. 23
1.5.1 Epigenetic factors ......................................................................................................... 24
1.5.2 Transcription factors .................................................................................................... 26
1.5.3 MYCN ............................................................................................................................ 28
1.5.4 Mecp2 ........................................................................................................................... 30
2.Materials and methods .............................................................................................................. 36
2.1 Culture of Neuroblastoma Cell Lines ................................................................................... 36
2.2 Extraction of Genomic DNA ................................................................................................. 37
2.2.1 Bisulfite Treatment of DNA .......................................................................................... 38
2.2.2 Cleanup of bisulfite converted DNA ............................................................................. 39
2.2.3 Amplification of Methylated and Unmethylated MRP1promoter ............................... 39
2.2.4 Methylation specific Pcr ............................................................................................... 40
2.2.5 Bisulfite sequencing...................................................................................................... 42
2.2.6 PCR................................................................................................................................ 42
2.2.7 Size selection using 1% agarose gel .............................................................................. 42
2.2.8 Tailing reaction ............................................................................................................. 43
2
2.2.9 Purification ................................................................................................................... 44
2.2.10 Cloning of PCR products generated by primer A ........................................................ 44
2.2.11 Plasmid extraction ...................................................................................................... 45
2.2.12 Colony PCR identification ........................................................................................... 45
2.2.13 DNA Sequencing ......................................................................................................... 46
2.3 Extraction of Total RNA ....................................................................................................... 46
2.3.1 Expression of MRP1 and MDR1 mRNA by RT-PCR ....................................................... 47
2.3.2 Demethylation Treatment of Cell Lines ........................................................................ 48
2.3.3 Real-Time Quantitative PCR ......................................................................................... 48
2.4 Chromatin Immunoprecipitation ........................................................................................ 51
2.4.1 pcr ................................................................................................................................. 52
3. Results ....................................................................................................................................... 54
3.1 Methylation Analyses of the MRP1 promoter in neuroblastoma cell Lines. ...................... 54
3.2 Bisulfite Sequencing ........................................................................................................... 56
3.2.1Sequencing primer A ..................................................................................................... 60
3.2 MRP1 expression ................................................................................................................. 67
3.2.1 Reverse transcription-polymerase chain reaction ....................................................... 67
3.2.2 Real Time-PCR............................................................................................................... 69
3.3 Chromatin Immunoprecipitation ........................................................................................ 78
Discussion ...................................................................................................................................... 80
Future consideration ..................................................................................................................... 84
References ..................................................................................................................................... 85
3
List of abbreviations
Abbreviation
ABC
BHLH-LZ
Meaning
ATP Binding Cassette
Basic helix–loop–helix/leucine zipper
CCHE
Children’s cancer hospital Egypt
CHIP
Chromatin Immunoprecipitation
DNA
Deoxyribonucleic acid
DNMT
DNA methyltransferases
HAT
Histone acetyltransferases
HDAC
Histone deacetylases
INRG
International Neuroblastoma Risk Group
IP
Immunoprecipitation
WHO
World health organization
MBD
Methyl binding protein
MDR1
Multidrug resistance protein 1
MKI
MRP1
NB
NSCLC
Mitosis-karyorrhexis index
Multidrug resistance-associated protein 1
Neuroblastoma
Non-small cell lung carcinoma
PGP
P-glycoprotein
PCR
Polymerase chain reaction
RNA
Ribonucleic acid
4
RT-PCR
SAM
Real-Time Polymerase chain reaction
S-adenosyl-L-methionine
5
List of figures
Figure 1 Percentage of tumor types in the CCHE. Number of the patients received
between 2007-2010 showing Neuroblastoma as the fourth most common tumor type
received by the hospital. ................................................................................................... 14
Figure 2 Yearly Number of neuroblastoma cases (100 annually) received by CCHE
between 2007-2012. .......................................................................................................... 15
Figure 3 Neural crest lineage and possible sites of tumor development. Neural crest cells’
derivetives include cartilage and bone cells, cardiac and neurons leading different
possible sites for the development of tumor cells. ............................................................ 17
Figure 6 methylation mechanism. (A,B) 5-Methylcytosine is produced by the action of
the DNMT , which catalyses the transfer of a methyl group (CH3) from SAM to the
carbon-5 position of cytosine.(C) methylation silences a gene and prevent its expression.
........................................................................................................................................... 25
Figure 7 schematic of p53 pathway. In a normal cell p53 is inactivated by its negative
regulator, mdm2. Upon DNA damage the p53 will dissociate from mdm2 complex. Once
activated, p53 will induce a cell cycle arrest through p21 to allow cell repair inaddition
activating BAX and deactivating BCL2 leading to cell apoptosis to discard the damaged
cell. .................................................................................................................................... 27
Figure 8 MYCN indirectly regulating P53.MYCN upregulates MDM2 which forms a
complex with p53 and inhibits its action. ......................................................................... 28
Figure 9 Schematic of the MRP1 promoter.The positions of the three putative E-box
elements in the MRP1 promoter. ...................................................................................... 29
Figure 10 MRP1 mode of action.the complex of MYCN and Max bind to MRP1
promoter increasing its expression ,thereby increasing the MRP1 protein and
subsequently leading to increased drug efflux. ................................................................. 30
6
Figure 11 different modes of Mecp2 regulation of genes.Mecp2 can act as a repressor if
in complex with HDAC and Sin3A on the other hand if in complex with CREB1 it can
act as an activator. ............................................................................................................. 31
Figure 12 MYCN alone (A), MeCP2 alone (C) and both MYCN and MeCP2 (B); and
methylated sites bound by MYCN alone (D), MeCP2 alone (F) and both MYCN and
MeCP2(E). ........................................................................................................................ 32
Figure 13 schematic of the MRP1 promoter.this indicates the three E-boxes and sp1
binding sites and their positions on the MRP1 promoter. ................................................. 33
Figure 14 schematic of primers designed for MSP ........................................................... 40
Figure 15 schematic of Bisulfite sequencing primers ....................................................... 42
Figure 16 Schematic of ChIP PCR primers ...................................................................... 53
Figure 17 MSP analysis performed on the 6 cell lines. (A,B) show the cell lines SK-NAS, LAN1, SK-N-BE(2)-C, UKF-NB-4, UKF-NB-3 and UKF-NB-3-DOX amplified
with primer (F and G) showing this region to be unmethylated. ...................................... 55
Figure 18 PCR products of primer A in the 6 cell lines. all pcr products shown with a
length of 301bp. ................................................................................................................ 57
Figure 19 bacterial clones. Agar plate showing positive (white) and negative (blue)
colonies ............................................................................................................................. 57
Figure 20 schematic of PUC cloning vector. the regions where the PCR primers anneal
adding a 100bp to the insert length. .................................................................................. 58
Figure 21 Colony PCR. Secondary screening of the clones showing positive bands
approximately 410bp ........................................................................................................ 59
7
Figure 22 lollipop diagram for UKFNB3 cell line.showing the methylation pattern of the
CGs and their methylation in the sequenced region. ........................................................ 61
Figure 23 methylation percentage for UKFNB3 cell line.showing the methylation pattern
of the CGs and their percentage in the sequenced region. ................................................ 61
Figure 24 lollipop diagram for UKFNB3-DOX cell line. showing the methylation pattern
of the CGs and their methylation in the sequenced region. .............................................. 62
Figure 25 methylation percentage for UKFNB3-Dox cell line.showing the methylation
pattern of the CGs and their percentage in the sequenced region. .................................... 62
Figure 26 lollipop diagram for UKFNB4 cell line.showing the methylation pattern of the
CGs and their methylation in the sequenced region. ........................................................ 63
Figure 27 methylation percentage for UKFNB4 cell line.showing the methylation pattern
of the CGs and their percentage in the sequenced region. ................................................ 63
Figure 28 lollipop diagram for SKNAS cell line.showing the methylation pattern of the
CGs and their methylation in the sequenced region. ........................................................ 64
Figure 29 methylation percentage for SKNAS cell line.showing the methylation pattern
of the CGs and their percentage in the sequenced region. ................................................ 64
Figure 30 lollipop diagram for SKNBe2c cell line.showing the methylation pattern of the
CGs and their methylation in the sequenced region. ........................................................ 65
Figure 31 methylation percentage for SKNBe2c cell line.showing the methylation pattern
of the CGs and their percentage in the sequenced region. ................................................ 65
Figure 32 lollipop diagram for LAN1 cell line.showing the methylation pattern of the
CGs and their methylation in the sequenced region. ........................................................ 66
8
Figure 33 methylation percentage for LAN1 cell line.showing the methylation pattern of
the CGs and their percentage in the sequenced region. .................................................... 66
Figure 34 Expression of MRP1. (A) shows SK-N-Be2c,LAN1 and SK-N-AS,(B) shows
UKF-NB4 UKF-NB3 and UKF-NB3-DOX ..................................................................... 68
Figure 35 MRP1 expression in neuroblastoma cell lines. Real time data showing
SKnBe2c with the highest MRP1 expression in reference to UKFnb3. ........................... 71
Figure 36 graph showing the RT-PCR results of both 5-aza-2'-deoxycytidin treated and
untreated neuroblastoma cell lines and shows the MRP1 expression in both conditions . 77
Figure 37 ChIP. Gel image showing only UKFNB3 dox and UKFNB4 giving a pcr
product indicating MecP2 binding to the promoter region. .............................................. 79
9
List of tables
Table 1 The International Neuroblastoma Risk Group (INRG) classification system.
MYCN is a very important prognostic factor ................................................................... 20
Table 2 Cell lines .............................................................................................................. 36
Table 3 Bisulfite reaction components ............................................................................. 38
Table 4 MSP primers ........................................................................................................ 40
Table 5 MSP reaction components ................................................................................... 41
Table 6 Bisulfite sequencing primers ............................................................................... 42
Table 7 Tailing reaction components ................................................................................ 43
Table 8 Colony PCR reaction components ....................................................................... 45
Table 9 RT- PCR reaction components ............................................................................ 47
Table 10 MRP1 expression primers .................................................................................. 48
Table 11 Realtime PCR reaction components .................................................................. 48
Table 12 Realtime PCR reaction components 2 ............................................................... 49
Table 13 Realtime PCR reaction conditions ..................................................................... 50
Table 14 ChIP reaction components ................................................................................. 51
Table 15 ChIP primers ...................................................................................................... 52
Table 16 ChIP PCR reaction components ........................................................................ 53
10
Table 17 Real-Time PCR results. Table showing results, average standard deviation and t
test of the three experiments ............................................................................................. 70
Table 18 Results of RT-PCR after treating with demethylating agen 5-AZA-DC. .......... 76
11
Abstract
The long term goal of this research proposal is to further understand the
transcriptional regulation of the MRP1 promoter in neuroblastoma cells. We are
primarily focused on two possible mechanisms that might lead to the regulation
of MRP1 expression: epigenetic modifications, in particular, gene promoter
methylation and transcription factors namely the regulation by the methyl binding
protein (MeCP2). Within the 5’ untranslated region of the MRP1 promoter is a
CpG island that has the potential to be methylated, thus contributing to down
regulation of MRP1 expression in drug sensitive neuroblastoma cells. Our goal is
to determine if methylation status of the promoter region and subsequently the
recruitment of MeCP2 that may play a role in the regulation of MRP1 expression.
The methylation status of the promoter will be investigated using Methylation
specific PCR and Bisulfite sequencing; while MeCP2 binding will be examined
using Chromatin Immunoprecipitation.This project addresses a very important
question, which is why neuroblastoma patients develop drug resistance.
Identifying regulatory mechanisms for MRP1 expression can potentially help us
to determine prognostic factors for drug resistance and further down the road
lead to the development of better treatment strategies.
12
1.Introduction
1.1 Cancer
The yearly death toll of children under the age of 15 worldwide according to World
Health Organization (WHO) statistics is estimated to be approximately 100,000 deaths as
a result of childhood cancer. Developing countries, alone hold 94 percent of these
childhood cancer-related deaths (http://www.who.int/en).
According to the National Cancer Institute Egypt among the 18,496 new cancer cases
with confirmed malignancy received between January 2002 and December 2003, 1,937
(10.5%) were children under the age of 20 years. The most common cancer type was
leukemia with 643 (33.2%) new cases. Lymphoma was the second most common with
(18.1%), followed by brain and nervous system tumors accounting for 7.1%, of all
childhood cancer making it one of the most common early childhood malignancies.
(Elattar, 2003).
At the children’s cancer hospital 57357 Egypt, Neuroblastoma is the fourth most
common type of cancer accounting for 15% of the patients admitted between 2007 and
2010 (fig 1). In other words the hospital receives around a 100 patients annually (fig 2).
This of course is only a hospital-based-cancer-registry and in no way represent a true
picture of the incidence of Neuroblastoma in Egypt. This simply is a small snapshot of a
segment of the community. Unfortunately Egypt doesn’t have a National Cancer Registry
of its own, so one can only imagine that the incidence of the disease could be much
higher than the numbers presented here. Eventually this problem will become a crisis,
since the global cancer burden is increasing rapidly in developing countries where
populations continue to expand.
13
Figure 1 Percentage of tumor types in the CCHE. Number of the
patients received between 2007-2010 showing Neuroblastoma as the
fourth most common tumor type received by the hospital.
14
Neuroblastoma casses at CCHE between 2007-2012
140
Number of patients
120
100
80
60
40
20
0
2007
2008
2009
2010
2011
2012
Year
Figure 2 Yearly Number of neuroblastoma cases (100 annually) received by CCHE between
2007-2012.
15
1.2 Neuroblastoma
1.2.1 Background
Neural development starts roughly around the beginning of the third week of embryonic
development. As the neural folds develop, they enfold and form the neural tube which is
lined by neuro-ectodermal cells, from which neurons develop. These neuro-ectodermal
cells migrate laterally and become neural crest cells. The neural crest cells are pluripotent
highly migratory cell population that differentiate into a variety of cell types derivatives
which include the peripheral nervous system, chromaffin cells of the adrenal medulla,
paraganglia, pericytes, pigment cells and the facial skeleton (Mora & Gerald, 2004).
Determination of cell fate is governed by a set of genes and correct regulation of these
genes is essential for normal differentiation into sympathetic neurons, any disregulation
could trigger the development of a tumor. Neuroblastoma is a disease that arises from a
malfunction in the neural crest cells and its derivates which encompasses sympathetic
neurons, sympathetic ganglia and adrenal medulla, and chromaffin cells of adrenal
medulla and extra-adrenal paraganglia. since it arises from such primitive neuroblasts
therefore it can occur anywhere within the sympathetic nervous system site of
presentation (Park, Eggert, & Caron, 2010).
16
Cartilage and
Bone
Pigments cells
Neural Crest Cell
Connective
tissue
Chromaffin cells
Adrenal Gland
cells
Sensory
Autonomic
neurons
Figure 3 Neural crest lineage and possible sites of tumor development. Neural crest cells’
derivetives include cartilage and bone cells, cardiac and neurons leading different possible
sites for the development of tumor cells.
17
1.2.2 Clinical Presentation and Diagnosis
Neuroblastoma can arise anywhere along the sympathetic nervous system in nerve tissues
in the neck, abdomen, chest or pelvis along the migratory pathways of the neural crest
cells. However 65 % of primary tumors arise in the abdomen with the medulla of the
adrenal gland being predominant (Maris, Hogarty, Bagatell, & Cohn, 2007). Presenting
symptoms and signs wildly vary and are dependent on site of primary tumour in addition
to the presence or absence of metastatic disease or paraneoplastic syndromes. The first
symptoms of neuroblastoma are often vague and common such as Fatigue, loss of
appetite, fever, and joint paint.
Since the clinical presentations of neuroblastoma as described previously are relatively
non-specific for neuroblastoma alone therefore most of the cases diagnosed are diagnosed
by chance. The diagnosis is usually confirmed based on the presence of characteristic
histolopathological features of tumour tissue or the presence of tumour cells in a bone
marrow aspirate or biopsy, accompanied by raised concentrations of urinary
catecholamines (Maris et al., 2007).
1.2.3 Pathology, Staging and prognosis
Neuroblastoma has the appearance of dense nests of undifferentiated cells separated by
fibrillar bundles. Necrosis, haemorrage and calcification are usually present. Tumor cells
often form rosettes around a pink fibrillar center. The pathology was reviewed by
Shimada and his classification is used as a prognostic indicator.
Age is
taken into account.
Several
o
criteria are used :Tumor is defined as being either "stroma rich" or "stroma poor".
Stroma rich have more fibrillar material and therefore tend to be
more mature.
o
Tumor cell differentiation
18
o
A mitosis-karyorrhexis index (MKI) is used to evaluate the nuclear
morphology . The total number of mitosis and karyorrhectic cells is
determined among 5000 tumor cells in randomly selected fields
(less than 100 / 5000 = low and do well, more than 200 / 5000 =
high).
With neuroblastoma as with most malignancies, the stage of disease is a very significant
prognostic factor; children at the first stages of the disease have a better chance than
children at later stages. Moreover for almost all stages of disease, infants have
significantly better disease-free survival than older children with equivalent stages of
disease. Some genetic variables such as MYCN amplification which occurs in
approximately 20% of primary NB tumors are strongly and consistently associated with
the presence of metastatic disease and poor prognosis(Shimada et al., 1984). Although
there has been some improvement in outcome of certain well-defined low risk subsets of
patients has during the past few decades with a five-year survival rate for children with
low-risk neuroblastoma being higher than 95%, unfortunately the outcome for children
with a high-risk clinical phenotype has only improved modestly, with long-term survival
still less than 40%, Moreover of these high-risk cases a large percentage do not respond
adequately to chemotherapy and are progressive or refractory. Relapse after completion
of frontline therapy is not uncommon (Maris et al., 2007) The International
Neuroblastoma Risk Group (INRG) classification system was developed to establish a
consensus approach for pretreatment risk stratification (table 1) (Cohn et al., 2009).
19
Table 1 The International Neuroblastoma Risk Group (INRG) classification system. MYCN is a
very important prognostic factor
20
1.2.4 Treatment
Deciding the course of treatment to be given to a child with neuroblastoma is based on
many of the above mentioned factors. For example:

Low-risk disease: The patient may only need a simple surgical procedure or
careful follow-up.

Intermediate-risk disease: The patient will probably undergo surgery and four to
eight months of chemotherapy. Patients with intermediate-risk disease often do
not need radiation treatments.

High-risk disease: almost half of the neuroblastoma patients have high-risk
disease, either because the tumor has already spread to the bone and bone marrow
by the time they are found or because test results show high-risk features. With
high risk patients treatment includes five months of chemotherapy, surgery,
radiation therapy, high dose chemotherapy followed by stem cell rescue, and
immunotherapy combined with biological therapy. Although these very intense
treatments have improved the cure rate of this complex disease, unfortunately,
high-risk neuroblastoma still has a very high rate of non-responsiveness, or
relapsing during or after treatment.
1.3 Drug resistance
Two main causes can result in a patient’s cancer failing to respond to a specific therapy:
individual host factors and specific genetic or epigenetic alterations in the cancer cells.
Host
factors
include
drug
Pharmacokinetics
that
can
range
from
poor
absorption/distribution or rapid metabolism or excretion of a drug, resulting in low serum
levels (Gottesman, 2002). On the other hand cancer cells exhibit specific genetic or
epigenetic alterations that lead to their resistance. Generally tumors are usually composed
of mixed populations of cancer cells, some of which are drug-resistant while others are
drug-sensitive. The administration of chemotherapeutic agents kills off drug-sensitive
21
cells, allowing drug resistant cells to stay behind in a higher proportion (fig.4). As the
tumor continues in its growth again, chemotherapy may fail because the remaining tumor
cells are now resistant. This resistance to therapy has been associated with the
overexpression of two molecular "pumps" in tumor-cells. These pumps which are Pglycoprotein and the multidrug resistance–associated protein (MRP) belong to the same
ATP-binding cassette (ABC) superfamily of proteins, which function as energydependent efflux pump. The overexpression of these pumps will thereby lead to active
expulsion of chemotherapeutic drugs from inside the cells. Giving the chance for tumor
cells to elude the toxic effects of the drug ("Cancer multidrug resistance," 2000).
22
1.4 MRP
The MDR phenotype can be conferred solely by overexpression of the MRP gene since it
was initially cloned from a non-Pgp MDR cell line, H69/AR (Wang & Beck, 1998).One
of the first members of the MRP family to be characterized was MRP1/ABCC1. MRP1
has the ability to interact with structurally diverse substrates which are generally bulky,
nonpolar, weakly amphipathic compounds. However its overexpression in cancer cells
allows the elimination of a wide range of therapeutic agents as well (fig 5) (Munoz,
Henderson, Haber, & Norris, 2007). Up regulation of MRP1 was observed in a variety of
solid tumors including those of the lung, breast and prostate where it has been clearly
implicated as having a role in their clinical drug resistance (Sullivan et al., 2000).
Furthermore, MRP1 was found to be frequently overexpressed in a large proportion of
Non-small cell lung carcinoma (NSCLC) tumors prior to treatment exposure (Wang &
Beck, 1998). Moreover, several studies have shown that MRP1 expression acts as a
negative prognostic marker for early-stage breast cancer. Importantly, MRP1 also
mediates the transport of certain chemotherapeutic drugs, such as methotrexate and
cyclophosphamide, doxorubicin and many more that are used in regimens for the
treatment different types of cancers (Munoz, Henderson, Haber, & Norris, 2007). A
recent study by Hiroaki Goto et al,revealed that neuroblastoma cell lines established after
exposure to chemotherapy expressed higher MRP1 levels compared to control cell lines
established before treatment. This study also showed the detectable expression of MRP1
in primary untreated tumors significantly correlated with a lower probability of survival
and with other prognostic factors. Thus, the positive expression of MRP1 is likely to be
one characteristic of high-risk neuroblastoma (Hiroaki Goto, 2000).
1.5 MRP1 regulation
There are two main factors that play a critical role in the regulation of the expression of
the MRP1 gene: epigenetic and transcription factors.
23
1.5.1 Epigenetic factors
Epigenetic modifications are divided into two main categories: DNA methylation and
histone modifications. DNA methylation occurs where a methyl group is added to
cytosine to form 5-methylcytosine. This process is catalyzed by enzymes known as DNA
methyltransferases (DNMT), DNMT accepts a methyl group from the donor molecule Sadenosyl-L-methionine (SAM), and transfers it to the C-5 of cytosine, forming 5-mC. In
genomic DNA this process only occurs in cytosines that are followed by a guanine (5' CG
3') in what is called CpG islands. CpG islands are short interspersed DNA sequences that
are characteristic for having an elevated C+G base composition. A CpG island is
therefore defined as a CG-rich region and they are often present in gene promoters. In
promoters of rapidly transcribed genes is a highly conserved sequence called the TATA
box which is responsible for transcription initiation. However generally the genes that are
transcribed at low rates do not contain a TATA box but have a CG-rich stretch instead
(Juven-Gershon & Kadonaga, 2010). Various cell types have different methylation
patterns, which contributes to the differences in gene expression in different cell types.for
instance DNA methylation of a gene's CpG island represses gene expression while
unmethylation leaves the gene to be freely expressed. As such, abnormal DNA
methylation in cancer cells leads to aberrant expression patterns (Decock et al., 2012).
The MRP1 promoter has a highly GC-rich region which does not contain a TATA box
for directing site-specific transcriptional initiation suggesting alternate recognition
sequences for transcriptional initiation (Zhu & Center, 1994).
24
Figure 4 methylation mechanism. (A,B) 5-Methylcytosine is produced by the action of the
DNMT , which catalyses the transfer of a methyl group (CH 3) from SAM to the carbon-5
position of cytosine.(C) methylation silences a gene and prevent its expression.
25
1.5.2 Transcription factors
Wild type p53 is a transcription regulatory protein that plays a critical role in both the
activation and repression of its target genes and is involved in the control of cell growth
and apoptosis. It is an infamous tumor suppressor and its role is well documented. It is
usually present at low levels in the cell due to a short half-life of 30 minutes, nevertheless
it accumulates in response to cellular stress. It binds DNA in a paryicular sequencespecific manner to activate the transcription of a number of genes, including p21WAF1,
MDM2 and BAX. WAF1 inhibits G1 cyclin-dependent kinases, blocking cell cycle
progression from G1 into S phase. MDM2 binds to p53 and blocks its ability to function
as a transcription factor creating an autoregulatory feedback loop to tightly regulate p53
levels(fig 7). Tumors with mutant p53 cannot bind to DNA and up-regulate MDM2 and
consequently, there is a lack of MDM2 to bind to p53 and target it for ubiquitin-mediated
degradation, resulting in p53 accumulation inconjunction with this fact P53 inactivation
is strongly correlated with many cancers such as neuroblastoma (Tweddle et al., 2003).
Additionaly it has been suggested that its transcriptional repression effects result from its
direct interaction with transcription factors such as Spl. Meanwhile the MRP promoter
contains three Spl-binding sites (Muredda et al., 2003). It was demonstrated that the
expression of Spl strongly activates the MRP promoter. Furthermore, it was shown that
wt p53 can inhibit MRP gene expression by antagonizing the transactivating effect of Spl
on MRP promoter, suggesting a possible interaction between p53 and Spl. In fact, Spl
was also shown to be associated with p53 as a heterocomplex (Wang & Beck, 1998).
26
Figure 5 schematic of p53 pathway. In a normal cell p53 is inactivated by its negative
regulator, mdm2. Upon DNA damage the p53 will dissociate from mdm2 complex. Once
activated, p53 will induce a cell cycle arrest through p21 to allow cell repair inaddition
activating BAX and deactivating BCL2 leading to cell apoptosis to discard the damaged
cell.
27
1.5.3 MYCN
As discussed before MYCN amplification is one of the most powerful unfavorable
prognostic factors of neuroblastoma (Brodeur, Seeger, Schwab, Varmus, & Bishop,
1984) (Maris et al., 2007). Numerous laboratory studies support the hypothesis of mycn
contributing to the clinically aggressive behavior of high risk NB tumors. MYCN is a
transcriptional regulator that plays a role in differentiation, cellular proliferation,
transformation and apoptosis. The MYCN gene encodes a nuclear phosphoprotein that is
a member of transcription factors having a basic helix–loop–helix/leucine zipper (bHLHLZ) motif. For transcriptional activation MYCN dimerizes to MAX, another bHLH-LZ
protein, at DNA target sequences known as E-boxes found in the promoter region of
target genes recruiting histone acetyltransferases (HAT) and thereby activating gene
expression. It has been reported that MYCN can directly bind to the MDM2 promoter upregulating it above baseline levels and consequently inhibiting p53-triggered apoptosis
(fig 8) . This suggests an important pathogenic role for MDM2 in MYCN-driven
neuroblastoma development (Slack et al., 2005).
Figure 6 MYCN indirectly regulating P53.MYCN upregulates MDM2 which forms a
complex with p53 and inhibits its action.
28
Some studies have reported that high levels of MRP1 expression in NB tumors strongly
correlate with amplification and overexpression of the MYCN oncogene(Bordow et al.,
1994; M Haber, 1999; P Bader, 1999). At the mrp1 promoter region upstream of the start
site lies three putative E-box elements (Manohar et al., 2004)
Figure 7 Schematic of the MRP1 promoter.The positions of the three putative E-box
elements in the MRP1 promoter.
Increases in the levels of DNA–protein complexes at these sites were clearly evident
upon overexpression of MYCN. Suggesting that MYCN contributes to the regulation of
the MRP1 gene by interacting with a putative Ebox element in addition to other cis-acting
factors in the MRP1 promoter, consequently enhancing levels of MRP1 expression result
in increased drug resistance (Manohar et al., 2004).
29
Figure 8 MRP1 mode of action.the complex of MYCN and Max bind to MRP1 promoter
increasing its expression ,thereby increasing the MRP1 protein and subsequently leading to
increased drug efflux.
1.5.4 Mecp2
Another possible mechanism in which MYCN can regulate MRP1 expression involves
the methylation status of the MRP1 promoter. MYCN is known to bind to regions of
DNA that are hypermethylated through the help of an intermediate methyl binding
protein (MBD). MeCP2 is one of the MBD proteins which is essential in human brain
development and has been linked to several cancer types and neurodevelopmental
30
disorders. Previous studies showed that MeCP2 can selectively bind to methylated CpG
residues, over and above it has been shown to interact with the transcriptional repressor
SIN3A to recruit histone deacetylases (HDAC) consequently repressing transcription of
methylated promoters(fig. 11) (Bienvenu & Chelly, 2006).
However, this classic model of regarding MeCP2 solely as a transcriptional repressor has
been called into question, a recent study by Charhour et al revealed that a large
percentage of MeCP2-bound gene promoters were unmethylated and actively transcribed
also showing interaction of MeCP2 with the transcriptional activator CREB1 at active
promoters (fig.11) (Chen, Shin, Thamotharan, & Devaskar, 2013)
It was also reported by Yasui et al that neuroblastoma cell line SH-SY5Y’s majority of
MeCP2 binding sites were unmethylated, occurred outside of CpG islands, and that
downstream genes were actively expressed.
Figure 9 different modes of Mecp2 regulation of genes.Mecp2 can act as a repressor if in
complex with HDAC and Sin3A on the other hand if in complex with CREB1 it can act as
an activator.
31
In neuroblastoma Kelly cell line a novel pattern of high frequency co-localization of
MYCN and MeCP2 was observed. This pattern showed that the majority of
hypermethylated MYCN sites are also bound by MeCP2 furhtermore that a greater
number of MYCN/MeCP2 positive sites occur outside of hypermethylated sites (Murphy
et al., 2011).
Figure 10 MYCN alone (A), MeCP2 alone (C) and both MYCN and MeCP2 (B); and
methylated sites bound by MYCN alone (D), MeCP2 alone (F) and both MYCN and
MeCP2(E).
32
Figure 11 schematic of the MRP1 promoter.this indicates the three E-boxes and sp1 binding
sites and their positions on the MRP1 promoter.
33
Experimental design
1. To define the methylation status of the CpG Island within the MRP1
promoter
Methylation status of
the MRP1 promoter and
MRP1 expression
Real-Time qRTPCR
Demethylation
treatment
Real-Time qRTPCR
34
Bisulfite
sequencing
2. To determine if MeCP2 binds to the MRP1 promoter.
MRP1 promoter
binding of MeCP2
Chromatin
Immunoprecipitati
on (ChIP)
35
2.Materials and methods
2.1 Culture of Neuroblastoma Cell Lines
SK-N-AS, LAN1 and SK-N-Be2c were cultured in RPMI (LONZA,) supplemented with
10% (v/v) Fetal Bovine Serum (LONZA) and 1% (v/v) Penicillin-StreptomycinAmphotericin B (LONZA). UKFNB3, UKFNB3 DOX and UKFNB4 were cultured in
IMDM (LONZA,) supplemented with 10% (v/v) Fetal Bovine Serum (LONZA) and 1%
(v/v) Penicillin-Streptomycin-Amphotericin B (LONZA). All human tumor-derived cell
lines were grown in 37°C with 5% CO2. Cell lines were a generous donation from Dr.
Jaume Mora.
Table 2 cell lines
Cell Line
SK-N-AS
SK-N-BE(2)-C
P53
Status
Wild Type
Mutant
C135F
N-Myc
Drug
Sensitivity
Non Amplified
Sensitive
Overexpressed
Resistant
LAN-1
Mutant
Overexpressed
Resistant
UKF-NB-3
Wild Type
Overexpressed
Sensitive
UKF-NB-3 Dox
Wild Type
NA
Resistant
Overexpressed
Sensitive
UKF-NB-4
Mutant
C175F
36
2.2 Extraction of Genomic DNA
DNA was extracted using GeneJET Genomic DNA Purification Kit #K0721(Thermo
Scientific,) according to the manufacturer's protocol. Cells at 80% confluence were taken
and the adherent cells were detached using Trypsin (Lonza). Cells were transferred to a
microcentrifuge tube and pelleted by centrifugation for 5 minutes at 1300 rpm x g . Cells
were then resuspended in in 200 μl of PBS (Lonza) and 200 μl of Lysis Solution and 20
μl of Proteinase K solution were added to the cell pellet followed by vortexing to obtain a
uniform suspension. The samples were incubated at 56°C while vortexing occasionally
for 10 min until the cells were completely lysed and 400 μl of 50% ethanol was added to
the lysed cells. Afterwards the lysates were transferred to GeneJET Genomic DNA
Purification Columns inserted in collection tubes and centrifuged for 1 min at 6000 x g
then the GeneJET Genomic DNA Purification Columns were placed into a new 2 ml
collection tube followed by the addition of 500 μl of Wash Buffer I and Centrifuged for 1
min at 8000 x g. this step was repeated again using wash buffer II and Centrifuged for 3
min at maximum speed (≥12000 x g).finally 50μl of Elution Buffer was added to the
center of the GeneJET Genomic DNA Purification Column membranes to elute genomic
DNA, Incubated for 2 min at room temperature and centrifuged for 1 min at 8000 x g.
The DNA was then stored at -80°c.DNA concentration was assessed using UV
spectrophotometer (Beckman Coulter DU ® 700 Series). By diluting 2 μl DNA in 98 μl
of distilled water and measuring at λ260 and λ280 and using the following formula to
assess the concentration:
DNA concentration (µg/µl) = [OD260 x (dilution factor) x 50]/1000
37
2.2.1 Bisulfite Treatment of DNA
Bisulfite DNA modification was carried out using EpiTect Bisulfite DNA conversion kit
(Qiagen) according to the manufacturer's protocol. The required number of aliquots of
Bisulfite Mix wwew dissolved by adding 800 μl RNase-free water to each aliquot and
vortexed until the Bisulfite Mix was completely dissolved. The bisulfite reactions were
prepared in PCR tubes as follows:
Table 3 Bisulfite reaction components
DNA solution
RNase-free water
Bisulfite Mix
DNA Protect Buffer
Total volume
2ng
Variable
85 μl
35 μl
140 μl
The bisulfite DNA conversion was performed using a thermal cycler with the following
conditions:
Denaturation 5 min 95°C,
Incubation 25 min 60°C,
Denaturation 5 min 95°C,
Incubation 85 min 60°C
Denaturation 5 min 95°C,
Incubation 175 min 60°C
38
Finally Hold Indefinite at 20°C.
2.2.2 Cleanup of bisulfite converted DNA
Once the bisulfite conversion was complete, the PCR tubes containing the bisulfite
reactions were briefly centrifuge, and then transferred to clean 1.5 ml microcentrifuge
tubes. 560 μl freshly prepared Buffer BL containing 10 μg/ml carrier RNA was added to
each sample. The solutions were mixed by vortexing and then centrifuged briefly. The
entire mixture was transferred from the tubes into corresponding EpiTect spin columns.
Then the spin columns were centrifuged at maximum speed for 1 min and the flowthrough discarded. 500 μl Buffer BW (wash buffer) was added to each spin column and
centrifuged at maximum speed for 1 min and the flow-through was discarded. 500 μl
Buffer BD (desulfonation buffer) is then added to each spin column and incubated for 15
min at room temperature (15–25°C) followed by centrifugation of the spin columns at
maximum speed for 1 min and the flow-through discarded. To each spin column 500 μl
Buffer BW was added and centrifuged at maximum speed for 1 min. The flow-through
was then discarded. This step was repeated twice followed by centrifugation at maximum
speed for 1 min to remove any residual liquid. Finally 20 μl Buffer EB was added onto
the center of each membrane to elute the DNA and the columns centrifuged for 1 min at
approximately 15,000 x g (12,000 rpm.).
2.2.3 Amplification of Methylated and Unmethylated MRP1promoter
Bisulfite-treated DNA was amplìfied using primers specific for the methylated and
unmethylated MRP1 promoter sequence.
39
Primers were designed using Methyl primer express® software v1.0 (Applied
Biosystems)
Figure 12 schematic of primers designed for MSP
Table 4 MSP primers
Primer
MRP1 F FWD
MRP1 F REV
MRP1 G FWD
MRP1 G REV
Sequence
5' TTCGGAAGGCGAGTTAAC 3'
5' CGTAAACAACCGAACCAAC 3'
5' GTTTTTGGAAGGTGAGTTAAT 3'
5' AACATAAACAACCAAACCAACC 3'
2.2.4 Methylation specific Pcr
The PCR reaction was carried out using Qiagen Hot Start DNA Polymerase (Qiagen) in a
total reaction volume of 100 µl as follows:
40
Table 5 MSP reaction components
PCR Buffer (10x)
10 μl
Qsolution (5x)
20μl
dNTP mix (10 mM of each)
2 μl
1 μl
Forward primer
Reverse primer
1 μl
HotStarTaq enzyme
0.5 μl
Template DNA
5 μl
RNase-free water
61 μl
Total volume
100 μl
The PCR reaction was carried out following conditions:
41
2.2.5 Bisulfite sequencing
Bisulfite-treated DNA was amplìfied using primers specific for sequencing.
Figure 13 schematic of Bisulfite sequencing primers
Primers were designed using Methyl primer express® software v1.0 (Applied
Biosystems)
Table 6 bisulfite sequencing primers
Sequence
Primer
MRP1 A FWD
5' GTTAGGTGATTTTGGGTAGAGG 3'
MRP1 A REV
5' CCCAAATCCTCCAAAACTTA 3'
2.2.6 PCR
PCR was carried out as illustrated earlier.
2.2.7 Size selection using 1% agarose gel
100 μl of PCR products were loaded onto 1% agarose gels stained with ethidium
bromide. The gel was visualized using Gel Documentation Systems.DNA was extracted
using GeneJET Gel Extraction
Kit #K0691(Thermo Scientific) according to
manufacturer's protocol.Gel slice containing the DNA fragment was excised using a
clean scalpeland placed into a pre-weighed 15 ml tube. Binding Buffer was added 1:1
42
volume to the gel slices (volume: weight). The gel mixtures were incubated at 50-60°C
for 10 min until the gel slices were completely dissolved. The solubilized gel solutions
were then transferred to the GeneJET purification columns and centrifuged for 1 min.
The flow-through was discarded and the columns were placed back into the same
collection tubes. 700 µl of Wash Buffer was added to the GeneJET purification columns
and centrifuged for 1 min and an additional 1 min to completely remove residual wash
buffer. Finally the GeneJET purification columns were placed into clean 1.5 ml
microcentrifuge tubes and 50 µl of Elution Buffer was added to the center of the
purification column membranes. After centrifugation for 1 min the purified DNA was
stored at-80°c.
2.2.8 Tailing reaction
Tailing reaction was carried out with a non-proof reading enzyme Taq DNA Polymerase
Recombinant (Thermo Scientific) as follows:
Table 7 tailing reaction components
PCR product
20 μl
Taq Buffer with KCl (10X)
5 μl
25 mM MgCl2
3 μl
Taq polymerase
1.25 μl
dATP (10mmol)
1 μl
Water
19.75 μl
Total volume
50 μl
43
The reaction mixture was incubated at 70 ºC for 20 min.
2.2.9 Purification
Purification was carried out using PCR Purification Kit (Thermo Scientific) according to
manufacturer's protocol. To the tailing reaction 1:1 volume of Binding Buffer was added
and the mixture transferred to the GeneJET™ purification columns. The columns were
then centrifuged for 1 min and the flow-through discarded.100 μl of Binding Buffer was
added to the GeneJET™ purification columns and centrifuged for 1 min. Again the flowthrough was discarded. The GeneJET purification columns were transferred into a clean
1.5 ml microcentrifuge tube. And 25 μl of Elution Buffer added to the center of the
purification column membranes centrifuged for 1 min.
2.2.10 Cloning of PCR products generated by primer A
PCR products were cloned using InsTAclone PCR Cloning Kit (thermo Scientific). The
ligation reactions were set up as follows Vector pTZ57R/T (0.17 pmol ends) 3 μl, 5X
Ligation Buffer 6 μl, purified pcr 20 μl,T4 DNA Ligase 1 μl giving a total volume of 30
μl. Then vortexed and centrifuged briefly. The ligation mixtures were then incubated at
room temperature (22°C) for 1 hour. TaKaRa E.coli JM109 Competent Cells (TaKaRa)
were thawed in an ice bath just before use. Cells were gently mixed and 50 μl was added
to 2.5 μl of each ligation mixture directly for bacterial transformation and kept in the ice
bath for 30 min. After the ice bath cells were incubated for 45 sec. at 42｡C and quickly
returned to the ice bath for 1-2 min. 500 μl SOC medium (pre-incubated at 37｡C) was
added to the competent cells and incubated by shaking (160-225 rpm) for 1 hour at 37｡C
then plated on selective media containing Ampicillin (50 mg/ml) ,X-Gal (20 mg/ml) and
IPTG 100 mM.
44
2.2.11 Plasmid extraction
Miniprep was carried out using GeneJET Plasmid Miniprep Kit (Thermo Scientific)
according to manufacturer's recommendation. Positive colonies were picked from a
freshly streaked selective plate to inoculate each one in 5 ml of LB medium
supplemented with the ampicillin antibiotic (50 mg/ml). The cultures were incubated over
night at 37°C while shaking at 200-250 rpm. The bacterial cultures were harvested by
centrifugation at 8000 rpm (6800 x g) in a microcentrifuge for 2 min at room
temperature. The pelleted cells were then resuspended in 250 µl of the Resuspension
Solution and transferred to microcentrifuge tubes. To the cell suspensions 250 µl of the
Lysis Solution was added and mixed thoroughly by inverting the tubes 4-6 times until the
solution became viscous and slightly clear. The tubes were centrifuged for 5 min to pellet
cell debris and chromosomal DNA. The supernatants were transferred to the GeneJET
spin columns by pipetting. the spin columns were then centrifuged for 1 min and the
flow-through discarded. 500 µl of the Wash Solution was added to the GeneJET spin
columns and centrifuged for 30-60 seconds. This step was repeated twice. And 25 μl of
Elution Buffer added to the center of the purification column membranes centrifuged for
1 min to elute the plasmid DNA.
2.2.12 Colony PCR identification
DNA was amplified using M13/pUC Sequencing Primers (Thermo Scientific) using
Dream Taq (Thermo Scientific) in a total reaction volume of 50 µl as follows:
Table 8 colony PCR reaction components
DreamTaq DNA Polymerase Master Mix
25 μL
Forward primer
1 μL
Reverse primer
1 μL
45
Template DNA
5 μL
Water nuclease-free
18 μL
Total volume
50 µl
2.2.13 DNA Sequencing
Sequencing was done in our lab using the ABI 3730xl DNA Analyzer following the
BigDye® Terminator v1.1 Cycle Sequencing protocol. Each of the plasmids was
sequenced using the M13/pUC Sequencing Primers.
2.3 Extraction of Total RNA
Total RNA isolation was performed using TRizol Reagent (Invitrogen,) according to
manufacturer's protocol. Cells were cultured in 6 well plates. 1ml of TRIzol reagent
(invitrogen) was added to each well after the removal of the culture media and leaving
behind the attached cells. Followed by incubation for 2 min at room temperature. Cells
were lysed in well by pipetting up and down several times. Lysed cells were collected
and transferred to a microcentrifuge tube on ice. 0.2 mL of chloroform was added per 1
mL of TRIzol Reagent and tubes were shaked vigorously by hand for 15 seconds
followed by an incubation period of 2–3 minutes on ice. Tubes were centrifuged at
12,000 × g for 15 minutes at 4°C. The aqueous phase of the sample was removed by
angling the tube at 45° and pipetting the solution out avoiding drawing any of the
interphase or organic layer into the pipette and placed in new tube. 0.5 mL of 100%
isopropanol was added to the aqueous phase, per 1 mL of TRIzol Reagent and incubated
on ice for 10 minutes and centrifuged at 12,000 × g for 10 minutes at 4°C. finally the
supernatant was removed from the tube, leaving only the RNA pellet and washed with 1
mL of 75% ethanol per 1 mL of TRIzol® Reagent.to discard the wash tubes were
centrifuged at 7500 × g for 5 minutes at 4°C. The RNA pellet was air dried for 5–10
46
minutes and the RNA pellet was resuspended in15 µl RNase-free water. RNA
concentration was assessed using UV spectrophotometer (Beckman Coulter DU ® 700
Series). By diluting 2 μl RNA in 98 μl of distilled water and measuring at λ260 and λ280
and using the following formula to assess the concentration:
DNA concentration (µg/µl) = [OD260 x (dilution factor) x 40]/1000
The integrity of RNA was checked by agarose gel electrophoresis.
2.3.1 Expression of MRP1 and MDR1 mRNA by RT-PCR
cDNA was synthesized using RevertAid First Strand cDNA Synthesis Kit #K1621. 1µg
of RNA , 1µl of oligo (dT)18 primer and nuclease-free water was added into a sterile,
nuclease-free tube on ice to reach a final volume of 12 µl. the tube was centrifuged
briefly and incubated at 65°C for 5 min. After centrifugation the tube was placed back on
ice and the following reagents were added in this order 4µl 5X Reaction Buffer, 1 µl
RiboLock RNase Inhibitor (20 u/µl), 2 µl 10 mM dNTP Mix and finally 1 µl RevertAid
M-MuLV Reverse Transcriptase (200 u/µl) giving a total volume of 20 µl and incubated
for 60 min at 42°C followed by heating at 70°C for 5 min to terminate the reaction. 10 µl
of PCR products were loaded onto 2 % agarose gels stained with ethidium bromide. The
gel was visualized using Gel Documentation Systems. RT-PCR was then carried out
using Dream Taq (Thermo Scientific) in a total reaction volume of 50 µl as follows:
Table 9 RT- PCR reaction components
DreamTaq DNA Polymerase Master Mix
25 μL
Forward primer
1 μL
1 μL
Reverse primer
47
Template DNA
3 μL
Water nuclease-free
18 μL
Total volume
50 µl
cDNA was amplified using the following primers
Table 10 MRP1 expression primers
MRP 1 FWD
CTGGGCTTATTTCGGATCAA
MRP 1 REV
TGAATGGGTCCAGGTTCATT
2.3.2 Demethylation Treatment of Cell Lines
The protocol was adapted from (El-Osta, Kantharidis, Zalcberg, & Wolffe, 2002)Cells
were split to low density 24 h before drug treatment. Cells were treated with 5-Aza-2′deoxycytidine (5-AZA-dc) for approximately 3 days. 5-AZA-DC was added at 1 µM for
32 h followed by two additional doses for 16 h, respectively.
2.3.3 Real-Time Quantitative PCR
Real-Time Quantitative PCR was performed using Applied Biosystems 7500 real-time
PCR machine. TaqMan probes for (MRP1) (Applied Biosystems) were used in a 20 µl
reaction as follows:
Table 11 Realtime PCR reaction components
20X TaqMan gene expression assay
1µl
48
(MRP1)
10µl
2X TaqMan gene expression Master Mix
50 ng
cDNA template
5µl
RNase-free water
20µl
Total volume
TaqMan probes for 18S ribosomal RNA (Applied Biosystem) were used as control in a
50 µl reaction as follows:
Table 12 Realtime PCR reaction components 2
25µl
TaqMan® Universal PCR Master Mix
10 μM Ribosomal RNA Forward
0.25 µl
Primer
10 μM Ribosomal RNA Reverse
0.25 µl
Primer
0.25 µl
40 μM Ribosomal RNA Probe (VIC.)
50 ng
cDNA template
Variable
RNase-free water
50 µl
Total volume
49
Table 13 Realtime PCR reaction conditions
The experiments were repeated 3 times and the SD was calculated.
For each sample, the MRP1 CT value was normalized using the following formula:
∆CT = CTMRP1- CT18S
To determine relative expression levels the following formulas were used:
∆∆CT = ∆CT (reference) - ∆CT (sample)
∆∆CT = ∆CT (treated) - ∆CT (un-treated)
Fold difference = 2^–ΔΔCt
50
2.4 Chromatin Immunoprecipitation
Chromatin Immunoprecipitation was carried out using EpiXplore kit (clontech). Cells
were fixed by adding 10 ml of 1% formaldehyde in culture medium; the plate was
incubated for 10 min at room temperature. Then 2.1 ml quenching solution was added to
final concentration of 347 mM and incubated for 5 min at room temperature. The solution
was removed and plate was washed with 1X PBS. Cells were collected. Afterwards cells
were centrifuged at 400 x g for 3 min at 4°C. Supernatant was discarded and cells were
resuspended in 1 ml of cytoplasmic lysis buffer with 1 μl of ProteoGuard™ Protease
Inhibitor Cocktail. Then the tubes were left to sit on ice for 10 min and gently vortexed
every 5 minutes. After incubation on ice cells were centrifuged at 2,400 × g for 10 min at
4°C to pellet nuclei which were resuspended in 300 μl of wash buffer. By using a
Branson digital sonifier model 150, output power was set up to number 3 and DNA was
carefully sheared to 5 cycles with 10 seconds on and 10 seconds off. After that the
samples were centrifuged at 15,000 × g for 10 min at 4°C and supernatant was collected.
For magnetic beads preparation 200 μl of magnetic beads were washed 2 times with 200
μl of wash buffer and resuspend in 20 μl of wash buffer. Immunoprecipitation reaction
was set up as follows:
Table 14
ChIP reaction components
Magnetic Beads in RB1
20 μl
Sheared Chromatin
25 μl
ProteoGuard Protease Inhibitor Cocktail
2 μl
10X Easy Dilution Buffer
20 μl
Antibody (Mecp2)
8 μl
RB1
125 μl
51
200 μl
Total Volume
Using a magnetic stand unbound chromatin was removed followed by the washing of
beads with 800 μl of wash buffer, 800 μl of wash buffer 2 and 800 μl of wash buffer 3
respectively. Then 100 μl of 10 % DNA Purifying Slurry was added to the beads and
incubated at 95°C for 15 min to reverse crosslink. Followed by the addition of 1 μl of 20
mg/ml Proteinase K and incubated at 60°C for an additional 15 min. Using a magnetic
stand supernatant was collected into new tube.
2.4.1 PCR
Primers were designed using
Table 15 ChIP primers
Primer
Sequence
Forward primer
5' CTGGTGACGGATACTGTCCTTA 3'
Reverse primer
5' TGATCGGGCCCGGTTGCTAG 3'
52
Figure 14 Schematic of ChIP PCR primers
Pcr reaction was carried out using Phire Hot Start DNA Polymerase (Fermentas)
Table 16 ChIP PCR reaction components
5x PhireReaction Buffer
10 μl
2 mM dNTPs
5 μl
Forward primer
1 μl
Reverse primer
1 μl
Phire Hot Start DNA Polymerase
1 μl
Chromatin
25 μl
H2O
7 μl
Total volume
50 μl
53
3. Results
3.1 Methylation Analyses of the MRP1 promoter in neuroblastoma cell
Lines.
Methylation specific PCR was utilized to study the methylation pattern of the CGs
present in the CpG island within the MRP1 promoter and its relation to the gene’s
expression in neuroblastoma cell lines. Methylation Specific PCR (MSP) is a bisulfite
conversion based PCR technique for the study of DNA CpG methylation. For the MSP
experiment, two pairs of primers were designed with one pair specific for methylated
DNA (M) and the other for unmethylated DNA (U). To achieve discrimination for
methylated and unmethylated DNA, CpG sites were included in each primer sequence.
Then, two PCR reactions were performed using M primer pair and U primer pair.
Successful amplification from M pair and U pair indicated methylation and
unmethylation respectively. MSP was performed on 6 neuroblastoma cell lines 3 drug
sensitive: (SK-N-AS, UKF-NB-3, UKF-NB-4) and 3 drug resistant: (SK-N-BE(2)-C ,
LAN1, UKF-NB-3-DOX). As shown in (figure16.A,B) all 6 cell lines did not show any
methylation. However we observed that the bands generated by the unmethylated primers
showed varying intensities on the gel. This might indicate that the percentage of
unmethylated CGs differ between cell lines leading to lower annealing of the primers
giving a weak PCR Product. Subsequently there might be a low percentage of undetected
methylated CGs. Therefore bisulfite sequencing was necessary to further define and
expand the analysis of the CpG Island.
54
Figure 15 MSP analysis performed on the 6 cell lines. (A,B) show the cell lines SK-N-AS,
LAN1, SK-N-BE(2)-C, UKF-NB-4, UKF-NB-3 and UKF-NB-3-DOX amplified with primer
(F and G) showing this region to be unmethylated.
55
3.2 Bisulfite Sequencing
A more in-depth look at the promoter region was necessary. Bisulfite genomic
sequencing is regarded as a gold-standard technology for detection of DNA methylation.
It provides a qualitative, quantitative and efficient approach to identify methylation at
single base-pair resolution. We designed primers outside of the CpG region of interest
thereby amplifyimg the target regardless of the methylation state of the internal sequence.
Bisulfite sequencing provides an inherently more accurate assessment of the methylation
state of a sample compared to PCR primers that select for presupposed fully methylated
or fully unmethylated complementary sequences as seen in the previous figure with MSP.
Following PCR the amplified product was then sequenced. A 301bp region of the
promoter, 614bp upstream of the ATG start site was sequenced in the six cell lines.
The promoter region was amplified using primer A (Fig 18) and cloned for subsequent
sequencing. Primary screening was carried out as shown (Fig 19) using the blue/white
method. Subsequently positive white colonies were picked and grown on LB broth and
the plasmids extracted.
Secondary screening was performed on the potential positive clones. Colony PCR was
conducted using M13/pUC Reverse sequencing Primer (-26), 17-mer and M13/pUC
sequencing primer (-20), 17-mer as shown in (figure 20). Thereby giving a PCR product
of 401bp as shown in (figure 21) accounting for both the length of the insert and the
vector.
56
Figure 16 PCR products of primer A in the 6 cell lines. all pcr products shown with a length
of 301bp.
Figure 17 bacterial clones. Agar plate showing positive
(white) and negative (blue) colonies
57
Figure 18 schematic of PUC cloning vector. the regions where the PCR primers anneal
adding a 100bp to the insert length.
58
401bp
Figure 19 Colony PCR. Secondary screening of the clones showing positive bands
approximately 410bp
59
3.2.1Sequencing primer A
Extracted plasmids from single positive clones were sequenced using M13/pUC Reverse
sequencing Primer (-26), 17-mer and the sequences were analyzed using BiQ Analyzer
(max planck institute informatik).
60
Figure 20 lollipop diagram for UKFNB3 cell line.showing the methylation pattern of the
CGs and their methylation in the sequenced region.
Figure 21 methylation percentage for UKFNB3 cell line.showing the methylation pattern of
the CGs and their percentage in the sequenced region.
61
Figure 22 lollipop diagram for UKFNB3-DOX cell line. showing the methylation pattern of
the CGs and their methylation in the sequenced region.
Figure 23 methylation percentage for UKFNB3-Dox cell line.showing the methylation
pattern of the CGs and their percentage in the sequenced region.
62
Figure 24 lollipop diagram for UKFNB4 cell line.showing the methylation pattern of the
CGs and their methylation in the sequenced region.
Figure 25 methylation percentage for UKFNB4 cell line.showing the methylation pattern of
the CGs and their percentage in the sequenced region.
63
Figure 26 lollipop diagram for SKNAS cell line.showing the methylation pattern of the CGs
and their methylation in the sequenced region.
Figure 27 methylation percentage for SKNAS cell line.showing the methylation pattern of
the CGs and their percentage in the sequenced region.
64
Figure 28 lollipop diagram for SKNBe2c cell line.showing the methylation pattern of the
CGs and their methylation in the sequenced region.
Figure 29 methylation percentage for SKNBe2c cell line.showing the methylation pattern of
the CGs and their percentage in the sequenced region.
65
Figure 30 lollipop diagram for LAN1 cell line.showing the methylation pattern of the CGs
and their methylation in the sequenced region.
Figure 31 methylation percentage for LAN1 cell line.showing the methylation pattern of the
CGs and their percentage in the sequenced region.
66
3.2 MRP1 expression
3.2.1 Reverse transcription-polymerase chain reaction
To correlate the methylation status with MRP1 transcription, an RT-PCR analysis which
is a sensitive method for the detection of mRNA expression levels was performed using
primer MRP1 1 to determine the expression of MRP1 gene in the neuroblastoma cell
lines. MRP1 was expressed in all of the 6 cell lines (Fig 22.A,B).
67
Figure 32 Expression of MRP1. (A) shows SK-N-Be2c,LAN1 and SK-N-AS,(B) shows UKFNB4 UKF-NB3 and UKF-NB3-DOX
68
3.2.2 Real Time-PCR
To further assess the level of MRP1 gene expression in the 6 cell lines, Real Time-PCR
was performed on each. Real Time PCR is quantitative PCR method for the
determination of copy number of PCR templates we used a probe-based real-time PCR
(TaqMan probes). This method allows the sensitive, specific and reproducible
quantitation of nucleic acids. The results were compared to the UKF-NB3 cell line, which
had the lowest MRP1 expression. The experiment was performed three times. The mean,
standard deviation, and t-test were then calculated for each cell line (Table 12). The
results show three cell lines showing high MRP1 expression, SKN-Be2c, LAN1, SKNAS
with 8, 5, 4 fold change respectively (fig 23), the highest being SKN-Be2c which is a
drug resistant cell line.
.
69
Table 17 Real-Time PCR results. Table showing results, average standard deviation and t
test of the three experiments
Cell Name
EXP 1
EXP 2
EXP 3
MRP1 2^(ddct)
MRP1 2^(ddct)
MRP1 2^(ddct)
average
st dev
t test
Ukfnb4
1.2397
0.694
0.95
0.961233
0.273023
0.82867
Ukfnb3
dox
1.897
0.658
2.006
1.520333
0.748789
0.351876
Ukfnb3
1
1
1
1
0
Sknbe2c
10.913
7.621
9.063
9.199
1.650208
0.013236
Lan1
4.799
2.026
8.322
5.049
3.155436
0.156316
Sknas
2.901
2.685
5.608
3.731333
1.628825
0.100917
70
MRP1 expression in neuroblastoma cell lines
12
10
Fold change
8
6
4
2
0
Ukfnb4
Ukfnb3 dox
Ukfnb3
Sknbe2c
Lan1
Sknas
Cell line
Figure 33 MRP1 expression in neuroblastoma cell lines. Real time data showing SKnBe2c
with the highest MRP1 expression in reference to UKFnb3.
71
The cell lines were then subjected to demethylation treatment by 5-aza-2'-deoxycytidin a
demethylating agent to determine if demethylation will have an effect on MRP1 gene
expression.
Treatment with the demethyalting agent had no significant increase on MRP1 expression
(Fig.24). On the other hand it caused significant decrease in MRP1 expression in 3 cell
lines (UKFNB-4, UKFNB3-DOX, and UKFNB-3) suggesting that promoter methylation
is not a contributing factor governing its expression. These results are consistent with
MSP and bisulfite sequencing that showed unmethylated promoter in all 6 cell lines.
72
Table 18 Results of RT-PCR after treating with demethylating agen 5-AZA-DC.
cell
name
unt1
dct
mrp1
unt2
dct
mrp1
unt3
dct
mrp1
avg
8.521 7.822 8.7
8.40
7
9.247 7.416 9.269
8.64
4
sknbe2
c
10.43 9.327 9.392
9.71
7
ukfnb3 6.984 6.397 6.212
6.53
1
sknas
lan1
ukfnb3
dox
7.908 5.795 7.217
6.97
3
ukfnb4 7.294 5.872 6.138
6.43
4
stdev
0.463
95509
8
1.063
53608
3
0.620
06048
1
0.403
06699
2
1.077
36824
4
0.755
99559
1
t1(5AZADC)
dct
mrp1
8.406
8.613
9.205
9.25
8.161
9.596
t2(5AZADC)
t3(5AZADC)
dct
dct mrp1 mrp1 avg
8.967
9.364
9.577
9.454
9.196
9.497
9.922
10.95
7
8.071
9.16
76
8.817
9.426
untre
ated
5-AZA-DC
∆∆ct
∆∆ct
stdev
8.983
0.5856
71
9.143
0.4617
69
9.299
0.1712
43
10.043
0.8599
09
8.349
0.4072
17
9.394
0.2197
54
0 0.463955098
40215
0 1.063536083
07382
0 0.620060480
921022
0 0.403066991
950473
0 1.077368244
07133
0 0.755995590
816055
untre
ated
5AZADC
2^2^∆∆ct ∆∆ct
1 0.1285
1 0.3853
1 0.0877
1 1.3361
1 0.7076
1 0.6708
MRP1 expression in neuroblastoma cell lines
5
Fold change
4
3
2
1
0
Ukfnb4
Ukfnb3 dox
Ukfnb3
Sknbe2c
Lan1
Sknas
Cell line
Untreated
5-AZA-DC
Figure 34 graph showing the RT-PCR results of both 5-aza-2'-deoxycytidin treated and
untreated neuroblastoma cell lines and shows the MRP1 expression in both conditions
77
3.3 Chromatin Immunoprecipitation
To further confirm the binding of MecP2 to the MRP1 gene promoter or the lack there of,
Chip assay was performed using MecP2 antibody. The chromatin immunoprecipitation
(ChIP) assay is a powerful and versatile technique used for probing protein-DNA
interactions within the chromatin context. This assay can be used to identify multiple
proteins associated with a specific region of the genome, or the opposite, to identify the
many regions of the genome associated with a particular protein. We used the 6 cell lines
of which SK-N-AS, UKF-NB-3 and UKF-NB-3 Dox had P53 Wild Type while SK-NBE(2)-C had p53 C135F mutation, UKF-NB-4 had p53 C175F mutation and LAN-1 had
mutant p53. Moreover N-Myc was overexpressed in SK-N-BE(2)-C, LAN-1, UKF-NB-3
and UKF-NB-4 .Pcr analysis showed that two of the six cell lines namely UKFNB-4 and
UKFNB3-DOX had MecP2 binding to the promoter region (fig.25).
78
420bp
Figure 35 ChIP. Gel image showing only UKFNB3 dox and UKFNB4 giving a pcr
product indicating MecP2 binding to the promoter region.
79
Discussion
Cancer development involves multiple and diverse steps that are attributed to
environmental and genetic factors. Unfortunately with the latter we know very little.
While the development of new technologies and the increasing attention to cancer over
recent years has led to many important findings, such as, the discovery of specific genetic
aberrations of important oncogenes and tumor suppressor genes. Alas the genetic factors
related to neuroblastoma remain to be discovered. The less we know about the disease the
more our present day treatment will be less specific and dynamic towards the disease.
The success of current treatment strategies for neuroblastoma is limited by the
development of drug resistant cancer cells which potentially renders the cytotoxic drug
useless (Matthay et al., 1999) Many mechanisms contribute to the development of this
drug resistant phenotype. Among these mechanisms are those that alter accumulation of
drugs within cells. There are membrane proteins that have the ability to transport a wide
range of anticancer drugs out of cancer cells and their presence in many tumors make
them prime suspects in unexplained cases of drug resistance (Borst, Evers, Kool, &
Wijnholds, 2000). These membrane proteins belong to the ATP-binding cassette (ABC)
transporters family. There are 49 ABC genes in the human genome , arranged in seven
subfamilies, designated A to G (Vasiliou, Vasiliou, & Nebert, 2009). In this study we
focused on the human multidrug resistance-associated protein1 (Mrp1) a member of the
ABCC sub family (Deeley & Cole, 1997). Multidrug resistance-associated protein 1
(MRP1) transports a wide range of therapeutic agents as well as diverse physiological
substrates and may play a role in the development of drug resistance in several cancers
including the lung, breast and prostate cancers, as well as childhood neuroblastoma (M.
R. Chorawala, 2012) (Munoz et al., 2007). The majority of patients with neuroblastoma
present with widely disseminated disease at diagnosis and despite intensive treatment, the
prognosis for such patients is dismal. There is increasing evidence that MRP1 might be
involved in the development of multidrug resistance in neuroblastoma. Given the
importance of MRP1 overexpression in neuroblastoma, MRP1 inhibition may be a
clinically relevant approach to improving patient outcome in this disease.
80
In this study we focused on the factors that govern the expression of this drug resistance
gene MRP1 in neuroblastoma cells. The two factors that we investigated were the
methylation status of the promoter region and the transcription factors that may associate
with the gene’s promoter and direct its expression.
To test if MRP1 promoter methylation plays a role in controlling the gene’s expression
we investigated the methylation status of the promoter using two methods: methylation
specific pcr and bisulfite sequencing. We employed 6 neuroblastoma cell lines that vary
in their degree of sensitivity to drugs namely 3 drug sensitive: SK-N-AS, UKF-NB-3 ,
UKF-NB-4 and 3 drug resistant : SK-N-BE(2)-C , LAN1, UKF-NB-3-DOX.Both assays
showed a consistent unmethylated pattern of the CGs in the CpG island present in the
promoter region of the 6 neuroblastoma cell lines. To correlate degree of methylation at
the promoter with the expression of MRP1 we first evaluated its mRNA levels using RTPCR. Our results were in agreement with the unmethylated pattern exhibited by the
promoter. MRP1 was expressed in the 6 cell lines with 3 cell lines SKN-Be2c, LAN1,
SKNAS showing statistically significant high expression, SKN-Be2c drug resistant cell
line being the highest. These finding fit with previous study that report a statistically
significant inverse correlation between membrane pumps expression and the methylation
of 5'CpG sites at the promoter in cancer patients with the degree of methylation at several
CpG sites, rather than other sites, involved in this regulation (Tada et al., 2000).In order
to further confirm that this unmethylated pattern was exhibited along the entire length of
the promoter and whether it played a role in the gene’s regulation cells were treated with
5-Aza-29-Deoxycytidine a demethylating agent for 3 days and again the mRNA levels
were analyzed using RT-PCR. As expected three of the six cell lines SK-N-AS,SK-NBE(2)-C and LAN1 didn’t show a significant increase in expression on the other hand
interestingly UKF-NB-3 , UKF-NB-4 and UKF-NB-3-DOX showed a significant
decrease in expression. One potential explanation for this observation is that 5-Aza-2deoxycytidine treatment may lead to the activation of genes that negatively regulate other
genes. These negative regulators may include protein-coding genes that could negatively
regulate MRP1 expression. Another intriguing possibility is that 5-Aza-2-deoxycytidine
treatment might lead to the expression of other noncoding antisense RNAs that could in
turn negatively regulate MRP1 gene expression. This phenomenon was observed before
81
in a study conducted to investigate the effects of Global Demethylation of Rat
Chondrosarcoma Cells after Treatment with 5-Aza-2-Deoxycytidine. A number of genes
were
also downregulated following 5-Aza-2-deoxycytidine treatment (Hamm et al.,
2009).
In the second part of this project we turned our focus to the transcription factors that may
play a role in directing MRP1 expression. In particular methyl-CpG binding protein 2
(MeCP2). MeCP2 is a member of the methyl-CpG binding proteins (MBPs) family it has
the ability to selectively recognize methylated DNA (Parry & Clarke, 2011). However, it
is now known that MeCP2 can both bind to unmethylated DNA and chromatin in
addition to methylated DNA. Moreover it can likewise both activate and repress specific
genes depending on the proteins it is in complex with (Hansen, Ghosh, & Woodcock,
2010).Previous reports have established the fact that MeCP2 repressor complex is
associated with the methylated promoter of MDR1 (El-Osta et al., 2002). In
neuroblastoma cell lines, genome-wide MeCP2 DNA binding is significantly associated
with the binding of MYCN. At gene promoters, transcription is relatively high when
MYCN is bound alone, intermediate when both MYCN and MeCP2 are present, and low
when only MeCP2 is present (Lawlor & Thiele, 2012). To accurately examine whether
the
MRP1
promoter
was
occupied
by
MeCP2,
we
performed
chromatin
immunoprecipitation (ChIP) with MeCP2-specific antibody. We chose to study
neuroblastoma cell lines where N-Myc was overexpressed in SK-N-BE(2)-C, LAN-1,
UKF-NB-3 and UKF-NB-4 and was non-amplified in SKNAS. ChIP results showed a
band at corresponding to 420bp in 2 out of the six cell lines UKF-NB-3-DOX and UKFNB-4 which shows binding of MecP2 at the promoter region. These results show that
Mecp2 actually occupies and binds to the promoter of MRP1 in UKF-NB-3-DOX and
UKF-NB-4 and might have a hand in directing the gene’s expression. Furthermore they
show that MeCP2 can associate with unmethylated fragments of genomic DNA since our
sequencing showed that the promoter region of these 2 cell lines is unmethylated. These
findings give us a unique insight into the regulatory mechanisms for MRP1 expression
and can potentially help us to determine prognostic factors for drug resistance and further
down the road lead to the development of better treatment strategies. Since increased
understanding of the molecular basis that governs MRP1 can lead to the identification of
82
potential targets for future therapies and ultimately provoke aims directed towards novel
targeted treatments.
83
Future consideration
In our study we have only confirmed the binding of MeCP2 to the MRP1 promoter but
not its role. Future work might encompass the interaction of the MeCP2 with other
proteins as well and whether it would be part of a repressor or activator complex.
Likewise they should focus on developing a retrospective analysis for patients to
determine if there is a correlation between treatment protocol outcome and the
expression of MRP1, promoter methylation and the expression of transcription
factors such as MeCP2 that might modulate MRP1 expression; thus determining
if genotyping neuroblastoma patients for MRP1 gene promoter methylation can
be used to modify treatment strategy.
84
References
1. http://www.who.int/en
2. http://biq-analyzer.bioinf.mpi-inf.mpg.de/
3. Bienvenu, T., & Chelly, J. (2006). Molecular genetics of Rett syndrome: when DNA
methylation goes unrecognized. Nat Rev Genet, 7(6), 415-426.
4. Bordow, S. B., Haber, M., Madafiglio, J., Cheung, B., Marshall, G. M., & Norris, M. D.
(1994). Expression of the Multidrug Resistance-associated Protein (MRP) Gene
Correlates with Amplification and Overexpression of the N-myc Oncogene in Childhood
Neuroblastoma. Cancer Research, 54(19), 5036-5040.
5. Borst, P., Evers, R., Kool, M., & Wijnholds, J. (2000). A Family of Drug Transporters:
the Multidrug Resistance-Associated Proteins. Journal of the National Cancer Institute,
92(16), 1295-1302. doi: 10.1093/jnci/92.16.1295
6. Brodeur, G., Seeger, R., Schwab, M., Varmus, H., & Bishop, J. (1984). Amplification of
N-myc in untreated human neuroblastomas correlates with advanced disease stage.
Science, 224(4653), 1121-1124. doi: 10.1126/science.6719137
7. Cancer multidrug resistance. (2000). NATURE BIOTECHNOLOGY, 18.
8. Chen, Y., Shin, B.-C., Thamotharan, S., & Devaskar, S. U. (2013). Creb1-Mecp2-mCpG
Complex Transactivates Postnatal Murine Neuronal Glucose Transporter Isoform 3
Expression. Endocrinology, 154(4), 1598-1611. doi: 10.1210/en.2012-2076
9. Cohn, S. L., Pearson, A. D. J., London, W. B., Monclair, T., Ambros, P. F., Brodeur, G.
M., . . . Matthay, K. K. (2009). The International Neuroblastoma Risk Group (INRG)
Classification System: An INRG Task Force Report. Journal of Clinical Oncology, 27(2),
289-297. doi: 10.1200/jco.2008.16.6785
10. Decock, A., Ongenaert, M., Hoebeeck, J., De Preter, K., Van Peer, G., Van Criekinge,
W., . . . Vandesompele, J. (2012). Genome-wide promoter methylation analysis in
neuroblastoma identifies prognostic methylation biomarkers. Genome Biology, 13(10),
R95.
11. Deeley, R. G., & Cole, S. P. C. (1997). Function, evolution and structure of multidrug
resistance protein (MRP). Seminars in Cancer Biology, 8(3), 193-204. doi:
http://dx.doi.org/10.1006/scbi.1997.0070
12. El-Osta, A., Kantharidis, P., Zalcberg, J. R., & Wolffe, A. P. (2002). Precipitous Release
of Methyl-CpG Binding Protein 2 and Histone Deacetylase 1 from the Methylated
Human Multidrug Resistance Gene (MDR1) on Activation. Molecular and Cellular
Biology, 22(6), 1844-1857. doi: 10.1128/mcb.22.6.1844-1857.2002
13. Elattar, I. (2003). CANCER STATISTICS AT NATIONAL CANCER INSTITUTE,
CAIRO.
85
14. Gottesman, M. M. (2002). MECHANISMS OF CANCER DRUG RESISTANCE. Annu.
Rev. Med(53), 615–627.
15. Hamm, C. A., Xie, H., Costa, F. F., Vanin, E. F., Seftor, E. A., Sredni, S. T., . . . Soares,
M. B. (2009). Global Demethylation of Rat Chondrosarcoma Cells after Treatment with
5-Aza-2′-Deoxycytidine Results in Increased Tumorigenicity. PLoS One, 4(12), e8340.
doi: 10.1371/journal.pone.0008340
16. Hansen, J. C., Ghosh, R. P., & Woodcock, C. L. (2010). Binding of the Rett syndrome
protein, MeCP2, to methylated and unmethylated DNA and chromatin. IUBMB Life,
62(10), 732-738. doi: 10.1002/iub.386
17. Hiroaki Goto, N. K., Katherine K. Matthay, John N. Lukens, Robert B. Gerbing, Daniel
O. Stram,Robert C. Seeger, Patrick Reynolds,. (2000). Multidrug Resistance-Associated
Protein 1 (MRP1) Expression in Neuroblastoma Cell Lines and Primary Tumors. Medical
and Pediatric Oncology, 35, 619–622.
18. Juven-Gershon, T., & Kadonaga, J. T. (2010). Regulation of gene expression via the core
promoter and the basal transcriptional machinery. Developmental Biology, 339(2), 225229. doi: http://dx.doi.org/10.1016/j.ydbio.2009.08.009
19. Lawlor, E. R., & Thiele, C. J. (2012). Epigenetic Changes in Pediatric Solid Tumors:
Promising New Targets. Clinical Cancer Research, 18(10), 2768-2779. doi:
10.1158/1078-0432.ccr-11-1921
20. M Haber, S. B. B., J Gilbert, J Madafiglio, M Kavallaris, G M Marshall, E B Mechetner,
J P Fruehauf, L Tee, S L Cohn, H Salwen, M L Schmidt and M D Norris. (1999). Altered
expression of the MYCN oncogene modulates MRP gene expression and response to
cytotoxic drugs in neuroblastoma cells. Oncogene, 18, 2777-2782.
21. M. R. Chorawala, P. M. O., G. B. Shah. (2012). Mechanisms of Anticancer Drugs
Resistance: An Overview. International Journal of Pharmaceutical Sciences and Drug
Research, 4(1), 01-09.
22. Manohar, C., Bray, J., Salwen, H., Madafiglio, J., Cheng, A., Flemming, C., . . . Cohn, S.
(2004). MYCN-mediated regulation of teh MRP1 promoter in human neuroblastoma.
Oncogene, 23(3).
23. Maris, J. M., Hogarty, M. D., Bagatell, R., & Cohn, S. L. (2007). Neuroblastoma. The
Lancet, 369(9579), 2106-2120.
24. Matthay, K. K., Villablanca, J. G., Seeger, R. C., Stram, D. O., Harris, R. E., Ramsay, N.
K., . . . Reynolds, C. P. (1999). Treatment of High-Risk Neuroblastoma with Intensive
Chemotherapy, Radiotherapy, Autologous Bone Marrow Transplantation, and 13-cisRetinoic Acid. New England Journal of Medicine, 341(16), 1165-1173. doi:
doi:10.1056/NEJM199910143411601
86
25. Mora, J., & Gerald, W. L. (2004). Origin of neuroblastic tumors: clues for future
therapeutics. Expert Review of Molecular Diagnostics, 4(3), 293-302. doi:
10.1586/14737159.4.3.293
26. Munoz, M., Henderson, M., Haber, M., & Norris, M. (2007). Role of the MRP1/ABCC1
multidrug transporter protein in cancer. IUBMB Life, 59(12), 752-757. doi:
10.1080/15216540701736285
27. Muredda, M., Nunoya, K.-I., Burtch-Wright, R. A., Kurz, E. U., Cole, S. P. C., & Deeley,
R. G. (2003). Cloning and Characterization of the Murine and Rat mrp1 Promoter
Regions. Molecular Pharmacology, 64(5), 1259-1269. doi: 10.1124/mol.64.5.1259
28. Murphy, D. M., Buckley, P. G., Das, S., Watters, K. M., Bryan, K., & Stallings, R. L.
(2011). Co-localization of the oncogenic transcription factor MYCN and the DNA methyl
binding protein MeCP2 at genomic sites in neuroblastoma. PLoS One, 6(6), e21436. doi:
10.1371/journal.pone.0021436
29. P Bader, F. S., M Schlaud, R Girgert, R Handgretinger, T Klingebiel, J Treuner, C Liu, D
Niethammer, J F Beck. (1999). Expression analysis of multidrug resistance associated
genes in neuroblastomas. . Oncology Reports
30. Park, J. R., Eggert, A., & Caron, H. (2010). Neuroblastoma: biology, prognosis, and
treatment. Hematol Oncol Clin North Am, 24(1), 65-86. doi: 10.1016/j.hoc.2009.11.011
31. Parry, L., & Clarke, A. R. (2011). The Roles of the Methyl-CpG Binding Proteins in
Cancer. Genes & Cancer, 2(6), 618-630. doi: 10.1177/1947601911418499
32. Shimada, H., Chatten, J., Newton, W. A., Sachs, N., Hamoudi, A. B., Chiba, T., . . .
Misugi, K. (1984). Histopathologic Prognostic Factors in Neuroblastic Tumors:
Definition of Subtypes of Ganglioneuroblastoma and an Age-Linked Classification of
Neuroblastomas. Journal of the National Cancer Institute, 73(2), 405-416. doi:
10.1093/jnci/73.2.405
33. Slack, A., Chen, Z., Tonelli, R., Pule, M., Hunt, L., Pession, A., & Shohet, J. M. (2005).
The p53 regulatory gene MDM2 is a direct transcriptional target of MYCN in
neuroblastoma. Proceedings of the National Academy of Sciences of the United States of
America, 102(3), 731-736. doi: 10.1073/pnas.0405495102
34. Sullivan, G. F., Yang, J.-M., Vassil, A., Yang, J., Bash-Babula, J., & Hait, W. N. (2000).
Regulation of expression of the multidrug resistance protein MRP1 by p53 in human
prostate cancer cells. The Journal of Clinical Investigation, 105(9), 1261-1267. doi:
10.1172/JCI9290
35. Tada, Y., Wada, M., Kuroiwa, K., Kinugawa, N., Harada, T., Nagayama, J., . . . Kuwano,
M. (2000). MDR1 Gene Overexpression and Altered Degree of Methylation at the
Promoter Region in Bladder Cancer during Chemotherapeutic Treatment. Clinical
Cancer Research, 6(12), 4618-4627.
87
36. Tweddle, D. A., Pearson, A. D. J., Haber, M., Norris, M. D., Xue, C., Flemming, C., &
Lunec, J. (2003). The p53 pathway and its inactivation in neuroblastoma. Cancer letters,
197(1), 93-98.
37. Vasiliou, V., Vasiliou, K., & Nebert, D. W. (2009). Human ATP-binding cassette (ABC)
transporter family. Hum Genomics, 3(3), 281-290.
38. Wang, Q., & Beck, W. T. (1998). Transcriptional Suppression of Multidrug Resistanceassociated Protein (MRP) Gene Expression by Wild-Type p53. Cancer Research, 58(24),
5762-5769.
39. Zhu, Q., & Center, M. S. (1994). Cloning and Sequence Analysis of the Promoter Region
of the MRP Gene of HL60 Cells Isolated for Resistance to Adriamycin. Cancer
Research, 54(16), 4488-4492.
88