Genomes and Genetic Engineering !!!
Key concepts:
o Genome: all genes possessed by an individual organism by an individual
organism, or population of organisms. Whole sequence of bases in all DNA in
organism.
o Genomics: study of sequence of bases along a chromosome.
o Genome sequencing: technique used to give basing sequence of DNA of a
particular organism.
- Sequencing reaction can only identify up to around 1000 base pairs of
sequence in a fragment.
- To sequence whole genome, overlapping fragments are sequenced, then
reassembled by computer software to generate original sequence detail.
- Provides information about location of genes and enables genome-wide
comparisons between individuals and species.
o Polymerase chain reaction: artificial DNA sequencing. Technique used to
produce much DNA identical to trace samples can be created.
o Gene Technology: use of DNA to produce products wanted. It's developing
rapidly. Includes genome mapping, genetic engineering and gene therapy.
Genetic modification
o Organisms with artificially altered DNA are genetically modified organisms.
3 ways of producing GMOs.
1. Add a foreign gene
- Foreign gene inserted from another species. Enables GMO to
express trait coded by the new gene
- Organisms genetically altered this way are called transgenic
2. Alter existing gene
- Existing gene may be altered so it expresses it at a higher level
such as growth hormone.
- May cause expression of gene in another way not normal
- Used for gene therapy
3. Delete or ‘turn off’ a gene
- Existing gene may be deleted or deactivated to prevent trait
being expressed
- E.g. deactivating ripening gene in tomatoes
1
Electrophoresis


Requires DNA, gel, battery, cathode on one end and an anode on the other end.
Involves putting samples into wells cut into an agarose gel, which is in a tank filled
with a buffer solution of an appropriate pH. A direct electric current is applied to the
gel and the protein molecules or pieces of DNA move towards an electrode.
 Apparatus is called a running chamber with a buffer
 DNA = negatively charged. Therefore, moves towards the anode.
 This separates the different fragments of DNA according to size. Smaller fragments
of DNA travel further than larger fragments.
1. tank set up containing gel
2. buffer solution introduced and this allows diffusion (+dye)
3. direct current passed continuously through gel from cathode end as DNA is
negatively charged. Therefore pulled to anode end (+ve end) through gel.
Larger fragments go through slower. Bands formed.
4. DNA pulled along to the anode end as are -vely charged fragments.
5. smaller fragments travel further through the sticky gel (matrix) so DNA can be
separated based on length of DNA segment

DNA ladder = control. Can identify fragments, measured in base pairs.

Agarose is a good gel for separating large DNA fragments. Gel placed in running
chamber with a buffer

DNA is bigger but 50 base pairs usually at one gene sequencing session.

When the current is turned off, DNA fragments end up in different places. They can
then be transferred onto absorbent paper OR Southern Blotting

Southern Blotting: This is using a nylon membrane. A radioactive probe is added to
invisible DNA bands. Then, blacken x-ray film (white background)

Primers = short sequences of a polynucleotide that bind to single-stranded DNA that
is being copied. This is necessary for DNA polymerase to start the process of
replicating the existing polynucleotide.

Taq polymerase = enzyme extracted from an archaean that lives in hot springs.
Sequencing of a gene
o Used to determine the nucleotide (base) sequence of DNA
o Uses DNA nucleoside triphosphates (dNTPs) in the same way DNA polymerase is
used in DNA replication. 4 types of dideoxynucleotide triphosphate
o This has enabled researchers to locate genes and know their compositions.
o DNA 'microarray' or DNA 'biochips'
- usually uses fluorescent dye and DNA compared
2
- collection of DNA
- 1 section = test sample with DNA unknown
- 1 section = reference sample with DNA known

DNA probes
- is a short section (50 - 80 bases) of single strand of DNA which has
complementary sequence of gene being studied.
- if gene present,
1.
radioactive dye e.g. Carbon 4; P 32
- if present, radioactive eye visible on x ray film.
2.
fluorescent markers.
- emit colour if present in UV light

Annealing: sticking of probe to DNA

probe used to identify diseases, faulty allele, genes wanted to be engineered
Features of automated gene sequencing
o Interrupted PCR
o Electrophoresis
o Identification of base sequence
PCR
o Artificial DNA replication called Polymerase Chain Reaction. It takes many rounds of
DNA synthesis where a primer, DNA polymerase, and supply of nucleotides. Each
round of DNA replication is called a cycle and has 3 reaction steps: Denaturation,
Primer Annealing and Primer Extension.
o Reaction components:
- template DNA containing sequence of DNA wanted to be amplified
- DNA polymerase is enzyme that makes new strand of DNA through adding
nucleotides
- primers are small segments of single-stranded DNA that bind the specific region on
either side of target DNA sequence and initiates replication of target DNA. Primers
specify DNA sequence to be amplified
- buffer helps stabilise DNA and other components
o 2 primers usually used.
3
Stage 1:
- needs DNA sample/nucleotide and DNA polymerase
- heated to 94-6˚C. Hydrogen bonds between bases break and this separates
the DNA strands into single-stranded DNA
Stage 2:
- primer anneals to bases exposed

stops DNA rewinding again

encourages base pairing for the rest of the strand

is v short single-stranded DNA binds to either end of exposed DNA strands

temp dropped to 50 - 60˚C
Stage 3:
- heated once again 70 - 75˚C
- allows DNA polymerase to cause the DNA nucleotide/base to
complementary base pair, using the target DNA as a template.
Stages repeated continuously, by PCR machine, to gain many copies of desired
gene
Stage 4:
- final step = mixture heated to 75˚C --> this is optimum temp

Enzyme adds bases using dNTPs.
!Sequencing a genome overview!
1. Cut into DNA fragments approx 75 base pairs
- whole genome is too long to sequence
- 'shot gun' approach --> broken up by restriction enzymes
2. Repeated for greater accuracy and know it's the correct sequence
- 5/6 times using overlapping process to confirm accurate sequencing.
3. Analyse overlapping sequence of DNA fragment to be able to correctly re-order
DNA fragment
OR SIMPLY,
4
1) double-stranded DNA to be sequenced determined and extracted
2) denature to make single stranded
3) primer added
4) chain extension
5) fragment produced
6) fragment from all 4 reaction mixture loaded onto gel
7) position of base in sequence read to identify sequence (on computer) of length of
DNA
OR
Simply,
1. many labelled copies of each small length of DNA mixed with DNA polymerase,
primer, 'normal' deoxynucleotides (dNTPs), 'labelled' dideoxynucleotides (ddNTPs)
where dye used for each base.
- ddNTPs when incorp.d into nucleotide chain stops growth of DNA.
2. mixture separated using electrophoresis where the shorter the DNA fragment, the
faster it travels.
3. computer records colours as pass end of tube.
- if enough fragments, each base in complete chain repeated
- works out the sequence of the DNA length

largely automated though prep is still done through humans.

In vitro or in vivo = PCR (polymerase chain reaction) v BAC (bacterial artifical
chromosomes)

BAC largely used with E. Coli
- in vivo = plasmid out of bacteria
- in vitro = w/in bacteria
o can compare individuals w/in a species to assess variation at base-sequence level
o can also compare other species
5
o have found many genes e.g. homeobox sequence of transcription factors; e.g. gene
coding for ß-globin in dif animals similar in v different organisms
o differences in gene sequences across the genome between species show how long
ago they diverged
PCR Advantages

quicker - only takes a few hours

less equipment - only needs a test tube and a heat block

less space used - no nutrient broth needed

less labour intensive - largely automated

easier - largely automated

safer - using DNA polymerase
BAC Advantages

less prone to mutation - exact correct sequence needed for making therapeutic
proteins

less expensive - simple conditions needed for bacteria

less technologically complex - conditions not so critical
Marker analysis

used for genome mapping

genetic markers include micro-satellites

inheritant patterns w/in families traced

used when:
- gene location known but gene sequence itself undetermined
- much faster than direct gene sequencing
- much cheaper than direct gene sequencing
Micro-satellites

work as gene markers as occur in DNA region that's outside the gene sequence, so
they don't disrupt the sequencing process of gene itself
- found in introns, non-coding part of DNA so no consequence on gene function
6
- commonly used in gene mapping to help identify specific chromosomes or even
gene locus
e.g. CACACACACACACA - dinucleotide
e.g. CAGCAGCAGCAGCAGCAGCAG - trinucleotide

used as a marker to identify a specific chromosome or locus

Procedure:
1. DNA containing microsatellite amplified by PCR using primers or using BAC
2. size of DNA amplified is determined by the number of repeats present in the
microsatellite on that allele.
3. amplified DNA run out on gel (electrophoresis) to separate DNA fragments
based on size
Sometimes, only one allele visible.
DNA Sequencing

involves determining nucleotide order of DNA segment. Most methods to DNA
sequence based on the Sanger method.

Synthesised DNA is complementary to the template DNA so that the once the
nucleotide sequence of the synthesised DNA is found, the template DNA sequence
can be deduced.

Reaction components:
- Template DNA :- single-stranded DNA want to sequence. Can be PCR product
- Primer :- short fragment of DNA that binds to one end of the template DNA. Serves
as a support for the nucleotides to be added
- Deoxynucleotides (dNTPs) :- extend the primer, forming DNA chain. A, T, C, and G
are added.
- Dideoxynucleotides (ddNTPs) :- inhibits extension of the primer and once incorp.d,
no further nucleotides can be added
- DNA polymerase :- incorp.s nucleotides and ddNTPs into growing DNA chain
- Buffer :- solution stabilises the reagents and products in the sequencing reaction

Procedure:
7
1. components combined and allowed to settle
2. many copies of the template DNA made via PCR where copies with same
nucleotides but vary in length depending on where ddNTPs are incorp.d and have
stopped primer extension
3. products then run on gel, separating the DNA fragments by size

Products of DNA sequencing visualised as tagged with radioactive label. When on Xray film, shown up as dark band and sequence can be read.
Automated v manual sequencing

fluorescent dye used rather than a radioactive label and each dye with different
colour: ddATP = green; ddTTP = red; ddCTP = blue; ddGTP = yellow

sequence determined by computer therefore more faster and efficient than manual
sequencing

human genome sequenced using automated sequencing
Comparing Genome

many applications
- identifying genes for proteins gives clues to relative importance of these genes for
life
- modelling effects of DNA changes can be done
- compare pathogenic and non-pathogenic organisms; can identify targets for drug
treatments and vaccines
- analysis of individuals DNA --> presence of alleles associated with disease
- determine evolutionary relationship where there are more similarities and are closer
together
- Classification of organisms
8
Genetic Engineering
Genetic engineering

Recombinant DNA technology = genetic engineering. Involves the extraction
from 1 organism/manufacture of genes, in order to place them in another
organism (often dif species) so organism expresses gene products
o genes can be extracted via restriction endonuclease enzymes
o Definition – transferring genes from one organism to another (same or
different species). Receiving organism expresses the gene.
o Genetic engineering: branch of biotechnology that is characterised by trying to
gain a particular gene, by either removing from a donor organism's genome
using restrictive enzyme or by manufacture using reverse transcriptase. Once
obtained, the gene is inserted into the genome of a recipient organism, often a
dif species from the donor organism. The inserted gene is then transcribed
into protein so giving the recipient organism a characteristic/capacity that it
didn't have previously. Such organisms are referred to as transgenic or
genetically modified.
o Genetic engineering: use of technology to change genetic material of
organism. Involves taking genes from organism to another. May require a
vector
o Recombinant/transgenic/transformed DNA: DNA containing DNA from
another organism or another species
o Recombinant/transgenic/transformed DNA: organism with new DNA added to
it.
Enzymes
1. Restriction endonuclease
- used to isolate particular parts of DNA\gene
- point where enzyme cuts DNA = restriction site
- hydrolysis of DNA sugar-phosphate backbone and at 2 places to cut section
out (addition of water)
2. DNA ligase
- 'sticking'
- condensation reaction where water formed when break bond
3. reverse transcriptase
- mRNA back to DNA
4. DNA polymerase
9
- complementary base pairing when making DNA strand of DNA nucleotides
5. terminal transferase
- if cut at blunt ends, (cut at same lengths), will artificially add bases to make
'sticky' ends.
How is DNA obtained from another organism? 2 WAYS OF HOW THIS IS DONE
ARE SET BELOW!
1.
identify the gene wanted through either restriction endonuclease or reverse
transcriptase
e.g. beta-cells produce insulin therefore mRNA is being synthesised. This is
isolated and a restriction enzyme is added and the DNA strand of insulin is
formed
- DNA polymerase is used to make the mRNA strand double-stranded.
2.
3.
4.
5.
cut out chromosome using reverse transcriptase
gene inserted into vector, usually a plasmid from a bacteria cell
vector inserts gene into cells
transgenic cells identified and replicated
- gene cut out using restriction endonuclease and if not sticky ends, terminal
transferase used to artificially produce them
- operator gene absent therefore can't switch off or control gene copied
Stage 1
Gene for cloning obtained by one of three methods
1) restriction endonuclease cut DNA to give staggered cut to leave 'sticky
ends'. Different restriction enzymes show specificity by cutting at different
restriction sites.
- Gene probe can be used to check that it's correct DNA sequence.
Gene probe: small length of single-stranded DNA that can base pair w/ base
sequence on longer section of DNA to locate specific base sequence
2) RNA extracted from cell. Reverse transcriptase used to make singlestranded copy of DNA using RNA as a template. DNA polymerase makes
complementary polynucleotide (cDNA). This is how human insulin is made.
3) If protein sequence is known, gene can be manufactured using 'gene
machine' that assembles nucleotides in desired sequence using info from
genetic code.
10
Stage 2
Gene inserted into vector
4) multiple copies of gene made by PCR
5) plasmid cut open using restriction endonuclease
6) 'open' plasmids and required gene are mixed. H boning occurs between
'sticky ends' --> annealing
7) DNA ligase added to form covalent bonds to join up sugar-phosphate
backbone of DNA --> ligation
Annealing: formation of H bonds between complementary base pairs
Ligation: joining of DNA fragments by forming phosphodiester bonds
Recombinant DNA: DNA produced from combining DNA from 2 dif sources
Stage 3
Plasmids taken up by bacteria
8) bacteria treated with Ca ions to increase chance of plasmids passing
through their cell walls.
9) plasmids enter bacteria which are now transformed as they contain foreign
DNA
10) DNA polymerase used in bacteria so copies plasmids; bacteria divide via
binary fission so each daughter cell with several copies of plasmid
11) bacteria transcribes and translates foreign gene. Bacteria described as
transgenic now

Transformed bacteria must be identified as some plasmids don't take up the
gene and some bacteria don't take up the modified plasmid.
- can be done by inserting genes for antibiotic resistance into plasmid.
BUT, a safer method is to use a gene probe or gene that
codes for a protein that is fluorescent in UV light
Genetic marker: antibiotic resistance genes held on plasmid used as genetic marker
to identify bacteria that took up desired gene. The gene is inserted into plasmid that
carries resistance to a particular antibiotic. If bacterium can grow on that particular
antibiotic, then plasmid and thus required gene, is present in the bacterium.
Transfer of plasmids
11
1. Electroporation: high voltage electricity used to disrupt plasma membrane of
bacteria to allow plasmid to be uptaken
2. Microinjected: micropipette used to inject plasmid back in
3. Viral Transfer: put plasmid into virus and infect someone to transfer plasmid
into cel
4. Ti Plasmid (bacteriophage): soil bacteria used. This usually forms a gaul on
plants. Used to attach the desired DNA and carried into cells and plant
genome affected
5. Liposomes: wraps DNA in lipid-soluble substance so enters plasma
membrane more easily
Rate of uptake increases if you add CaCl2, lower temperature to freezing level, and
quickly raise to 40˚C. Called heat shock
Bacteria Conjugation

Antibiotic resistance also used so plasmids w/ desired gene are left. The
bacteria without the gene for resistance die and therefore are eliminated,
leaving the bacteria colonies with the desired gene on their plasmids.
Application of Bacteria Transformation

Pneumonia in mice. Experiment proved bacteria can transfer genetic material
by transformation

bacteria pneumococus has two strains. R Strain and S Strain where r= rough
and s = smooth. Smooth is with a protective capsule that can't be broken
down


Any organism with S strain can't destroy this bacteria therefore die via
pneumonia
Any organism with R strain can destroy the bacteria therefore won't die
1. heat killed S strain used --> mice didn't die therefore didn't kill the host
2. heat killed S strain + normal R strain mixed together killed the mice as the
plasmid containing gene for protective capsule from the S strain transferred to
the R strain. R strain was transformed
12
Extracting a gene

length of DNA is know to contain HGH (human growth hormone) gene is
treated with restriction enzymes to cut DNA at specific base sequences.
Strands cut at different sections to create sticky ends
- sticky ends could also be made via terminal transferase
Genetic engineering of bacteria to produce human insulin
o used for people with Type 1 Diabetes.
o modern methods of ide9ntifying using plasmid vectors
o insulin = pp made of 51 AAs (approx. 200 base pairs)
1. found mRNA for insulin in pancreatic tissue by centrifuging mRNA out of the ß
cells
2. Reverse transcriptase used to synthesis DNA from mRNA so gene for insulin
made
3. DNA polymerase added --> sticks DNA strands together via H bonds between
complementary bases (cDNA) c = copy or complementary
4. add terminal transferase; artificially creates sticky ends via adding extra
nucleotides
5. DNA ligase used to anneal gene to plasmid --> recombinant DNA formed
6. put recombinant plasmid into bacteria
7. grow bacteria, usually E. Coli, onto an agar plate (full of nutrients = agar)
thus, colony of bacteria with desired gene for human insulin created
o Advantage:
- reliability of supply as is not dependent on livestock

Disadvantage:
- people without a warning of a hypoglycaemic attack when blood glucose
conc falls thus increasing the likelihood of diabetic coma
Genetic engineering of rice embryos to produce golden rice
o white rice lacks ß-carotene needed for Vitamin A. Vitamin A deficiency can
lead to blindness, increased susceptibility to diarrhoea, respiratory infections,
childhood diseases like measles
o key enzymes not expressed in pathways
13
o one way to genetically engineer plants is using A. tumefaciens, using Ti
plasmid
o bacterium stimulates host to make compounds promote growth of bacteria
o foreign genes can be inserted into the Ti plasmid that act like a vector
o gene moves from plasmid to the chromosomes of the host's cells.
Gene Therapy
o the transfer of gene into an organism to repair a genetic fault and thereby
treat or cure a genetic disorder
o Somatic gene therapy: gene inserted into certain cells and can't be passed
onto the next generation
o Germ-line: gene inserted into gamete/zygote so is in every cell of the body.
So, gene will be in all cell including reproductive cells so gene can be
inherited.
o regarding recessive genetic disorder,
Advantages and disadvantages of gene therapy
Xenotransplantation
o Definition and use of genetic engineering to reduce tissue/organ rejection
14