Microbial community of tea rhizosphere and isolation of
imidacloprid degrading bacteria1
Guiping Hua #, Yan Zhao a #, Bo Liub, Fengqing Songa, Yujing Zhub, Minsheng Youa*
a
Institute of Applied Ecology, Fujian Agriculture and Forestry University, Fuzhou, Fujian
350002,China
b
Agricultural Bio-Resources Institute, Fujian Academy of Agricultural Sciences, Fuzhou
350003, China
Abstract: Microbial community of tea rhizosphere was analysised by DGGE and the
imidacloprid-degrading strain was isolated by enrichment culturing. The results showed that the
uncultured soil bacteria and bacillus sp were the dominant species in the tea rhizosphere by
PCR-amplified 16S rRNA gene fragments based on DGGE. The remaining belonged to the
species of Sinorhizobium sp, Ochrobactrum sp and Alcaligenes sp in the soils. A strain BCL-1
with the capacity of imidacloprid-degradation was isolated and identified as Ochrobactrum sp. The
degradation test revealed approximately 33.83% of imidacloprid (100 mg L-1) was degraded
within 48 h of incubaction. Single factor experiments displayed that the maximum degradation
rate was gained in the pH of 8 and at 35oC. The effective degradation rate was significant when
the imidacloprid concentration was below 50 mg L-1 and it exhibited that the strain BCL-1 could
potentially be used to eliminate the contamination of imidacloprid.
Key words: DGGE, imidacloprid-degrading, microorganism community, Ochrobactrum sp tea
rhizosphere
1 Introduction
Tea is a popular beverage consumed worldwide and valued for its specific aroma and flavour
as well as potential health-promoting properties. However, the events that exceeding pesticide
residues were detected in the tea due to improper and excessive pesticides usage, were frequently
reported. Tea safety problem gets more and more attentions, and how to deal with it is a big
concern. Imidacloprid is a neonicotinoid insecticide and common in the excessive list, althought
have banned to apply in tea production. Due to its long half-life, often greater than 100 days, the
accumulation of imidacloprid residues in the environments easily lead to high risk for ecological
and human health and safety[1 ][3][4]. Imidacloprid was found to induce DNA damage in a
dose-related manner in earthworms as well as to increase the frequency of adducts in
pesticide-treated calf thymus DNA, indicating agent-induced genotoxicity [24] [25].
Corresponding author: Min Sheng You, Phone: 086-591-8379-3035; Fax: 086)-591-8376-8251; E-mail:
msyou@iae.fjau.edu.cn
However, Imidacloprid can be biodegraded by the microorganism. Jennifer et al (2007)
isolated a bacteria of Leifsonia sp capable of degrading imidacloprid from agricultural soils [5].It
was reported that 50 μg/ml of imidacloprid can be degraded to 69% within 20 days by
Burkholderia cepacia came from agriculture field soil [6]. But the biodegradation effects
depended on not only the microbe degradation capacity but also the compatibility with the
environment [7]. So it is very common that the degrading-microbes showed the significant effects
in the laboratory but poor in the field [8]. The degrading-microbes might be restrained by the
aboriginal inhabitants before developing into the dominant microbe when inoculated in to the
environments [9], because of the differences environment between the origin and applying places.
Few have considered the environmental compatibility of the degrading-microbe, and few studies
about it.
The tea rhizosphere is colonized by a lot of functional microbes, such as arbuscular
mycorrhizal fungi (AMF) [10], plant growth promoting rhizobacteria (PGPR)[11], but few
degrading-microbe were reported except Pseudomonas sp. So in the present study, an attempt was
made to analysis the microbial community of tea rhizosphere by DGGE, at same time, isolate a
imidacloprid-degrading bacteria by enriched culture, that is helpfully for imidacloprid
bioremediation in the tea production.
2. Materials and methods
Chemicals
Imidacloprid ( N-[1-[(6-Chloro-3-pyridyl)methyl]-4,5-dihydroimidazol-2-yl]nitramide ) (99.9%
purity) was obtained from the Fujian Inspection and Testing Center for Agricultural Product
Quality and Safety (TCAPQS), Fuzhou, Fujian, China. All the other chemicals and solvents used
were analytical and HPLC grade.
Soils
Tea rhizosphere soils were sampled at oolongs plantation in Anxi County and Gande town,
Fujian province, China. Eight samples were collected randomly and transported to the laboratory
by plastic bag.
DGGE analysis of microbial community
Nucleic acid extraction
Nucleic acid of soils was extracted parallel to the degradation experiment. Whole-community
DNA was extracted from the 0.5 g soil of each treatment with the FastDNA® SPIN Kit for Soil
(Qbiogene, Inc. Carlsbad, CA), the protocol recommended by the manufacturer was followed [12].
DNA was finally eluted in 100ul DNase/RNase-free water (Qbiogene, Carlsbad, CA) and stored at
-80oC.
Primer test
DNA was amplified using eubacteria-primers for the 16S rRNA gene (F338GC: 5’-CGC
CCG CCG CGC GCG GCG GGC GGG GCG GGG GCA CGG GGG GAC TCC TAC GGG AGG
CAG ACG-3’;R518: 5’-ATT ACC GCG GCT GCT GG-3’) in an iCycler iQ(Bio-Rad, Hercules,
CA). All reactions were carried out in a final volume of 25ul containing 2.5 ul of buffer (160 mM
(NH4)2SO4, 670 mM Tris-HCl pH 8.8, 0.1% Tween-20, 25 mM MgCl2) (BIORON, Germany), 400
mM of each primer, 200 uM dNTPs, 0.5 U of DFS-Taq polymerase (BIORON, Germany), and 1
uL of template DNA. For the second PCR, 1 ul of the first PCR product was used as the template,
with the following amplification conditions: 94 oC for 3 min, 30 cycles of denaturation at 94 oC
for 1 min, annealing for 1 min at 55 oC for the first PCR and at 48 oC for the second PCR, primer
extension at 72 oC for 2 min, with a final extension at 72 oC for 5 min [13] .
DGGE analysis
The DGGE analysis was performed with a DGGE-2001system from CBS Scientific (CA,
USA)[14]. The PCR products (20-30ul) were used in analysis and loaded onto 8% (w/v)
polyacrylamide-bisacrylamide (37.5:1) (Amresco, USA) gels with denaturation gradients from 45%
to 70% where 100% is 7 mol l-1 urea and 40% (v/v) deionized formamide in 1×TAE
electrophoresis buffer. Gels (22 cm × 17 cm) were run at 20 V for 15 min, followed by 16 h at 70
V and maintained at a constant temperature of 60 oC. Gels were stained for 20 min in 1.0 ×
GelStar® and destained for 30 min in distilled water prior to visualization.
Enrichment ,isolation and screening of imidaclopid-degrading strain
5 g of mixed soils were transferred into 250 ml Erlenmeyer flask containing 50 ml sterilized
minimal salts medium (MSM) to create enrichment cultures for isolation of imidacloprid degrading microorganism. Imidacloprid dissolved in acetone solution was added to a final
concentration of 100 mg L-1. The enrichment culture was incubated at 30 oC on a rotary shaker at
170 rpm for 7 days. Five ml from the enrichment culture was transferred into 50 ml of fresh enrich
ment medium containing 100 mg L-1 of imidaclopid and incubated for 7 days, and three
additional successive transfers were made. The final cultures were serially diluted and plated on
MSM plates. The plates were incubated at 30 oC for 2 days, the colonies were picked and
purified[15]The ability of isolates to degrade imidaclopid was determined by high performance
liquid chromatography (HPLC) of extracts as described by Blasco et al (2002) [16]
Characterization and identification of isolated imidaclopid degraders
Isolate was characterized and identified by morphological methods, FAME analysis and 16S
rRNA
gene
analysis.
The
16S
rRNA
gene
was
amplified
by
PCR
with
intF(AGAGTTTGATCCTGGCTCAG) and intR (GGCTACCTTGTTACGACT) as universal
primers. PCR products were cloned into a pMD 18-T vector(TaKaRa), Then transformed the
plasmid to E.coli DH5a, screened positive clone and sent to Invitrogen Biotechnology Co.,Ltd.,
for sequencing. The resulting sequence was compared with gene sequences in the GenBank using
BLAST (http://www.ncbi.nlm.nih.gov/BLAST). The sequences with the highest 16S rDNA partial
sequence similarity were selected and compared by cluster analysis. Phylogenetic and molecular
evolutionary analyses were conducted by MEGA 4.0 software with the Kimura 2-paremeter model
and the neighbor joining algorithm [17] .
Degradation characterization of imidacloprid-degrading bacteria
The effects of temperature (20, 25, 30, 35 and 40oC), medium pH (5, 6, 7, 8 and 9) and the
initial imidacloprid concentration (50, 100, 150 and 200 mg L-1) on the imidacloprid degradation
were examined. To each 250 mL flask. 100 mL MSM medium was added and inoculated with 1.0%
(v/v) of strain BCL-1. All the flasks in triplicate were incubated at 30 oC and 170 r min-1 on a
rotary shaker .all the experiment was determined at 24, 48, and 96 h, with the medium without the
strain BCL-1 inoculation used as the control.
3. Results
3.1 The microorganism comunity of tea rhizosphere
The microorganism community structure of tea rhizosphere were investigated by using
PCR-DGGE, and the results are showed in Fig.1. Total seventeen dominant bands were observed
from the DGGE gels using Quantity one V4 4.0.0 software, then excised and PCR-amplified for
DNA sequencing. The closest relatives matched in the GenBank database are shown in Table 1.
Most of the sequences exhibited levels of similarity greater than 90%.
A phylogenetic tree was constructed to show the relationship of main the partial 16S rDNA
sequences representing the respective excised DGGE bands. The neighbor-joining analysis
showed that most of bacterial sequences belonged to uncultured bacterium (7 sequences, 41.2%),
three sequences were identified as Rhizobium sp, one was clarified to Ochrobactrum sp, the
remaining were the members of bacillus sp(6 sequences, 35.3%) (Fig.2.).
Table1 Sequence alignment with blast
Accession
Band
Similarity
organism
Phylogenetic affiliation
number
A
100%
B
100%
C
Uncultured bacterium clone G16 16S ribosomal RNA gene
uncultured bacterium
Uncultured soil bacterium clone em_emp208 16S ribosomal
uncultured soil
RNA gene
bacterium
Uncultured soil bacterium clone em_emp210 16S ribosomal
uncultured soil
RNA gene
bacterium
HQ121331.1
JN172788.1
100%
JN172809.1
uncultured
D
100%
Uncultured proteobacterium clone Hmd02B56 16S ribosomal
EF196941.1
proteobacterium
E
100%
Uncultured bacterium clone LG70 16S ribosomal RNA gene
uncultured bacterium
JX133525.1
F
100%
Rhizobium sp. PA22 16S ribosomal RNA gene
Rhizobium
JN819573.1
Sinorhizobium
G
100%
Sinorhizobium meliloti strain UT10 16S ribosomal RNA gene
JX133181.1
meliloti
Sinorhizobium
H
100%
Ensifer adhaerens strain MM1-6 16S ribosomal RNA gene
JX298811.1
morelense
I
100%
J
100%
Uncultured bacterium partial 16S rRNA gene, clone SBD94
uncultured bacterium
Uncultured alpha proteobacterium clone YZ52 16S ribosomal
uncultured alpha
RNA gene, partial sequence
proteobacterium
HE819608.1
JQ957842.1
Ochrobactrum sp. DZQ2a 16S ribosomal RNA gene, partial
K
100%
Ochrobactrum sp
KC252620.1
Bacillus megaterium
HQ202555.1
sequence
Bacillus megaterium strain RHQ17 16S ribosomal RNA gene,
L
99%
partial sequence
M
99%
Bacillus aryabhattai strain L13 16S ribosomal RNA gene
Bacillus aryabhattai
JN700141.1
N
99%
Alcaligenes faecalis strain M14 16S ribosomal RNA gene
Alcaligenes faecalis
JX849036.1
O
99%
Bacillus sp
GU566326.1
Bacillus sp. JU2(2010) 16S ribosomal RNA gene, partial
sequence
P
Geobacillus stearothermophilus strain HWB2 16S ribosomal
Geobacillus
RNA gene, partial sequence
stearothermophilus
100%
FJ581462.1
Bacillus flexus strain JMC-UBL 24 16S ribosomal RNA gene,
Q
99%
Bacillus flexus
partial sequence
HM451429.1
Fig .1 DGGE of tea rhizosphere soils
Fig.2. Phylogenetic analysis of the bacterial 16S rRNA gene sequences
3.2 Isolation and characterization of the imidacloprid-degrading bacteria
Strain BCL-1 could grow on the MSM in the presense of imidacloprid at the concentration of 200
mg L-1, and the degradation test displayed that it could degrade 33.83% of 100 mg l-1 of
imidacloprid within 48 h (Fig.5). The strain BCL-1 was a rod shaped with 2.48 um in length and
1.34 um in width (Fig.3.), aerobic. The colony of strain BCL-1 was yellow and creamy white
color on the MSM plate (Fig.4). It was positive in tests such as starch hydrolysis, nitrate reduction,
hydrogen sulfide production and utilized simmons citrate, lactose, glucose, maltose, amylum,
D-galactose, D-fructose, D-xylose. It was negative in gram staining, Voges-Proskauer (V-P),
indole reaction, gelatin liquefaction and mannose.
Fig.3. Colonial morphology of strain BCL-1 grown on the MSM
Fig.4. The scanning electron microscope of strain BCL-1
3.3 Identification of imidacloprid-degrading bacteria
Analysis of the partial 16S rRNA sequence of the strain BCL-1 showed that it was closely
related to Ochrobactrum anthropic with accession number of EU187487.1. PCR amplification of 16
S rRNA obtained a single fragment of 1337 bp. The strain’s genome has a G+C content of 59%. In
combination with the morphology, physio-biochemical characteristics and 16S rDNA gene
analysis, BCL-1 was tentatively identified as Ochrobactrum anthropic.
3.4 Degradation characteristics of imidacloprid-degrading bacteria
The imidacloprid degradation rate of Ochrobactrum sp. Strain BCL-1 increased to 29.3% at
pH 9.0 and reached the highest value at pH 8 (Fig.6). Under the pH of 80, the degradation
efficiency increased from 13.77% in 24 h to 33.7% in 72 h. imidacloprid hydrolyzed easily in
alkaline solution at pH 7.0-10.0.
Incubation temperature greatly influenced the degradation of imidacloprid by strain
BCL-1(Fig.7). Maximum degradation rate of 35.4% was observed at 35oC in 72 h, but it decreased
markedly as the temperature increased above or dropped below 35 oC in 72 h. At 20oC,
degradation rate was only 9.8%, 35 oC was chosen as the optimal temperature for degradation of
imidacloprid.
Fig.5. Degradation test of imidacloprid by strain BCL-1
Fig.6. Effect of pH on the imidacloprid degradation rate of strain
Fig.7. Effect of temperature on the imidacloprid degradation rate
BCL-1
of strain BCL-1
The effect of imidacloprid concentration on the degradation rate by BCL-1 was tested.
Effective degradation rates appeared hampered as the imidacloprid concentration increased. Fig.8.
showed that the degradation rate of imidacloprid reached to 63.23% at the concentration of 50 mg
L-1 within 96 h. The degradation rates of imidacloprid was observed no significant with 96 h if the
initial concentration was up 50 mg L-1
Fig.8. The degradation of imidacloprid by BCL-1 at different initial imidacloprid concentration.
4. Discussion
The tea rhizosphere consists of a diverse community of microbes with the genotypic and
functional diversity [26] . Bacteria isolated from various tea plantations were classified into 20
genera, such as Bacillus, Pseudomonas, Azomonas, Klebsiella, Agrobacterium, Erwinia, Micr
ococcus, Azotobacter, Stophylococcus Rosenback, Beijerinckia, Derxia, Arthrobacter [27].Pandey,
et al (2001) found that species of Penicillium and Trichoderma dominated the rhizosphere of
established tea bushes[28] . It also reported arbuscular mycorrhizal fungi (AMF) associated with
the rhizosphere during the periods of active growth and dormancy of tea[29] . Many tea plants
were raised by biological hardening of tissue culture through rhizosphere bacteria[30] . The
microorganism isolated from the tea rhizosphere mainly showed the Physiological and biological
function, such as Antifungal activity [31, 32], phosphate-solubilizing [33], Plant growth promotion
and induction of resistance[ 34, 35] and contaminate biodegradation[36,37].
However, the tea rhizosphere bacterias with the biodegradation capacity were mainly
belonged to Pseudomonas sp that could able to degrade dicofol and propargite. No another
microorganisms were found to degrade contaminants. In the present studies, strain BCL-1
identified as Ochrobactrum sp, isolated from tea rhizospherer, was showed that could degrade the
imidacloprid effectively. Degradation test it could degrade 33.83% of imidacloprid in 48h.
Ochrobactrum sp was testified to a potential bioaugmention. Zhang et al (2006) isolated strain
DDV-1 of Ochrobactrum sp from the active sluge with degrading-dichlorvos completely [38]. He
et al (2009) found a strain of Ochrobactrum sp from chromium landfill could reduce a chromium
[39]. Strain B2, Ochrobactrum sp, nitrophenol and methy parathion-degrading and strain DGVK1,
complete dimethylformamide mineralization were isolated from the coalmine leftovers [40,41].
Besides, species of Ochrobactrum sp was reported to degrade pyrene, phenol, 2, 4,
6-tribromophenol [42-44].Many relevance degradation genes from the Ochrobactrum sp were
cloned, such as mpd gene [45], methyl parathion hydrolase gene[46], Nitrite reductase genes[47],
N-acylhomoserine
lactonase
[48].
So
the
species
of
Ochrobacterum
sp
has
a
imidacloprid-degrading potential in the future.
Soil bioremediation is a complex process that relies upon the ability of microorganisms to
degrade pollutes, but it also depended on the microorganisms coming into contact with the native
microorganism community in the environment being conducive to the survival of the bacteria.
Microbes better adapted to a particular environment should be considered as a key strategy for
bioremediation. Sarkar et al (2010) also isolated a strain Pseudomonas putida, able to degrade
propargite, from tea rhizosphere. So the attentions that a strain with the native ecological niche
could easily and effectively play a role in the bioremediation, should be taken in the
bioaugmentation. It is a good strategy to deal with compatibility between the degrading-bacteria
with the environment.
References:
[1] R. Saikia, R.K. Sarma, A. Yadav, and T.C. Bora, Genetic and functional diversity among the
antagonistic potential fluorescent pseudomonads isolated from tea rhizosphere. Current microbiology
62 (2011) 434-444.
[2] U. Chakraborty, B. Chakraborty, and M. Basnet, Plant growth promotion and induction of
resistance in Camellia sinensis by Bacillus megaterium. Journal of basic microbiology 46 (2006)
186-195.
[3] R. Nauen, N. Stumpf, and A. Elbert, Toxicological and mechanistic studies on neonicotinoid cross
resistance in Q‐type Bemisia tabaci (Hemiptera: Aleyrodidae). Pest Management Science 58 (2002)
868-875.
[4] M.A. Beketov, and M. Liess, Acute and delayed effects of the neonicotinoid insecticide
thiacloprid on seven freshwater arthropods. Environmental Toxicology and Chemistry 27 (2008)
461-470.
[5] J.C. Anhalt, T.B. Moorman, and W.C. Koskinen, Biodegradation of imidacloprid by an isolated
soil microorganism. Journal of Environmental Science and Health Part B 42 (2007) 509-514.
[6] M. Gopal, D. Dutta, S.K. Jha, S. Kalra, S. Bandyopadhyay, and S.K. Das, Biodegradation of
Imidacloprid and Metribuzin by Burkholderia cepacia strain CH9. Pesticide Research Journal 23 (2011)
36-40.
[7] 许育新, 李晓慧, 滕齐辉, 陈义, 吴春艳, and 李顺鹏, 氯氰菊酯污染土壤的微生物修复及对
土著微生物的影响. 土壤学报 45 (2008) 693-698.
[8] N. Boon, E.M. Top, W. Verstraete, and S.D. Siciliano, Bioaugmentation as a tool to protect the
structure and function of an activated-sludge microbial community against a 3-chloroaniline shock load.
Applied and Environmental Microbiology 69 (2003) 1511-1520.
[9] 吴学玲, 代沁芸, 梁任星, and 王洋洋, 利用高效降解菌株强化修复土壤中 DBP 及其细菌
群落动态解析. 中南大学学报 (自然科学版) 42 (2011).
[10] S. Singh, A. Pandey, B. Chaurasia, and L.M.S. Palni, Diversity of arbuscular mycorrhizal fungi
associated with the rhizosphere of tea growing in ‘natural’and ‘cultivated’ecosites. Biology and
Fertility of Soils 44 (2008) 491-500.
[11] 张建云, 崔树军, 武秀琴, and 宋海军, 1 株氟氯氰菊酯降解菌 GZ-3 的分离和鉴定. 安徽农
业科学 (2010) 6635-6636.
[12] J. Bælum, T. Henriksen, H.C.B. Hansen, and C.S. Jacobsen, Degradation of
4-chloro-2-methylphenoxyacetic acid in top-and subsoil is quantitatively linked to the class III tfdA
gene. Applied and environmental microbiology 72 (2006) 1476-1486.
[13] P. Lorenzo, S. Rodríguez-Echeverría, L. González, and H. Freitas, Effect of invasive< i> Acacia
dealbata Link on soil microorganisms as determined by PCR-DGGE. Applied Soil Ecology 44 (2010)
245-251.
[14] J. Zhan, and Q. Sun, Diversity of free-living nitrogen-fixing microorganisms in the rhizosphere
and non-rhizosphere of pioneer plants growing on wastelands of copper mine tailings. Microbiological
research 167 (2012) 157-165.
[15] S. Chen, Q. Hu, M. Hu, J. Luo, Q. Weng, and K. Lai, Isolation and characterization of a fungus
able to degrade pyrethroids and 3-phenoxybenzaldehyde. Bioresource technology 102 (2011)
8110-8116.
[16] C. Blasco, M. Fernández, Y. Picó, G. Font, and J. Mañes, Simultaneous determination of
imidacloprid, carbendazim, methiocarb and hexythiazox in peaches and nectarines by liquid
chromatography–mass spectrometry. Analytica Chimica Acta 461 (2002) 109-116.
[17] C. Zhang, L. Jia, S. Wang, J. Qu, K. Li, L. Xu, Y. Shi, and Y. Yan, Biodegradation of
beta-cypermethrin by two< i> Serratia spp. with different cell surface hydrophobicity
[24] Y. Zang, Y. Zhong, Y. Luo, Z.M. Kong Genotoxicity of two novel pesticides for the earthworm,
Eisenia fetida Environ. Pollut., 108 (2000), pp. 271–278
[25] R.G. Shah, J. Lagueux, S. Kapur, P. Levallois, P. Ayotte, M. Tremblay, J. Zee, G.G. Poirier
Determination of genotoxicity of the metabolites of the pesticides guthion, sencor, lorox, eglone,
daconil and admire by 32P-postlabeling Mol. Cell. Biochem., 169 (1997), pp. 177–184
[26] R. Saikia, R.K. Sarma, A. Yadav, and T.C. Bora, Genetic and functional diversity among the
antagonistic potential fluorescent pseudomonads isolated from tea rhizosphere. Current microbiology
62 (2011) 434-444.
[27] H. Sun, and X. Liu, Microbes studies of tea rhizosphere. Acta Ecologica Sinica 24 (2004) 1353.
[28] A. Pandey, L.M.S. Palni, and D. Bisht, Dominant fungi in the rhizosphere of established tea
bushes and their interaction with the dominant bacteria under< i> in situ conditions. Microbiological
research 156 (2001) 377-382.
[29] S. Singh, A. Pandey, B. Chaurasia, and L.M.S. Palni, Diversity of arbuscular mycorrhizal fungi
associated with the rhizosphere of tea growing in ‘natural’and ‘cultivated’ecosites. Biology and
Fertility of Soils 44 (2008) 491-500.
[30] A. Pandey, L.M.S. Palni, and N. Bag, Biological hardening of tissue culture raised tea plants
through rhizosphere bacteria. Biotechnology letters 22 (2000) 1087-1091.
[31] A. Pandey, L. Palni, and N. Coulomb, Antifungal activity of bacteria isolated from the rhizosphere
of established tea bushes. Microbiological research 152 (1997) 105-112.
[32] A. Sood, S. Sharma, V. Kumar, and R.L. Thakur, Established and abandoned tea (Camillia sinensis
L.) rhizosphere: dominant bacteria and their antagonism. Polish Journal of Microbiology 57 (2008) 71.
[33] U. Chakraborty, B. Chakraborty, and M. Basnet, Plant growth promotion and induction of
resistance in Camellia sinensis by Bacillus megaterium. Journal of basic microbiology 46 (2006)
186-195.
[34] S. Singh, A. Pandey, and L.M.S. Palni, Screening of arbuscular mycorrhizal fungal consortia
developed from the rhizospheres of natural and cultivated tea plants for growth promotion in tea [< i>
Camellia sinensis(L.) O. Kuntze]
[35] S. Sarkar, S. Seenivasan, and R.P.S. Asir, Biodegradation of propargite by< i> Pseudomonas
putida, isolated from tea rhizosphere. Journal of hazardous materials 174 (2010) 295-298.
[36] S. Sarkar, A. Satheshkumar, and R. Premkumar, Biodegradation of Dicofol by Pseudomonas
strains isolated from tea rhizosphere microflora. International Journal of Integrative Biology 5 (2009)
164.
[37] P. Vyas, P. Rahi, A. Chauhan, and A. Gulati, Phosphate solubilization potential and stress tolerance
of< i> Eupenicillium parvum from tea soil
[38] X.H. Zhang, G.S. Zhang, Z.H. Zhang, J.H. Xu, and S.P. Li, Isolation and Characterization of a
Dichlorvos-Degrading Strain DDV-1 of< i> Ochrobactrum sp.
[39] Z. He, F. Gao, T. Sha, Y. Hu, and C. He, Isolation and characterization of a Cr (VI)-reduction< i>
Ochrobactrum sp. strain CSCr-3 from chromium landfill. Journal of hazardous materials 163 (2009)
869-873
[40] Y. Veeranagouda, P.V. Emmanuel Paul, P. Gorla, D. Siddavattam, and T.B. Karegoudar, Complete
mineralisation of dimethylformamide by Ochrobactrum sp. DGVK1 isolated from the soil samples
collected from the coalmine leftovers. Applied microbiology and biotechnology 71 (2006) 369-375.
[41] X. Qiu, Q. Zhong, M. Li, W. Bai, and B. Li, Biodegradation of< i> p-nitrophenol by methyl
parathion-degrading< i> Ochrobactrum sp. B2
[42] Y. Wu, T. He, M. Zhong, Y. Zhang, E. Li, T. Huang, and Z. Hu, Isolation of marine benzo [a]
pyrene-degrading< i> Ochrobactrum sp. BAP5 and proteins characterization. Journal of Environmental
Sciences 21 (2009) 1446-1451.
[43] W.S. El-Sayed, M.K. Ibrahim, M. Abu-Shady, F. El-Beih, N. Ohmura, H. Saiki, and A. Ando,
Isolation and identification of a novel strain of the genus< i> Ochrobactrum with phenol-degrading
activity
[44] T. Yamada, Y. Takahama, and Y. Yamada, Biodegradation of 2, 4, 6-tribromophenol by
Ochrobactrum sp. strain TB01. Bioscience, biotechnology, and biochemistry 72 (2008) 1264-1271
[45] C. Yang, N. Liu, X. Guo, and C. Qiao, Cloning of mpd gene from a chlorpyrifos‐degrading
bacterium and use of this strain in bioremediation of contaminated soil. FEMS microbiology letters 265
(2006) 118-125.
[46] W. Xiao, X. Chu, J. Tian, J. Guo, and N. Wu, Cloning of a methyl parathion hydrolase gene from
Ochrobactrum sp. J Agric Sci Technol 10 (2008) 99-102.
[47] B. Song, and B.B. Ward, Nitrite reductase genes in halobenzoate degrading denitrifying bacteria.
FEMS microbiology ecology 43 (2006) 349-357.
[48] G.Y. Mei, X.X. Yan, A. Turak, Z.Q. Luo, and L.Q. Zhang, AidH, an alpha/beta-hydrolase fold
family member from an Ochrobactrum sp. strain, is a novel N-acylhomoserine lactonase. Applied and
environmental microbiology 76 (2010) 4933-4942.