Techniques of Molecular Biology
I. Introduction
A. Introduction: Developing Molecular Techniques To Study Cellular
Function
1. Production of proteins is necessary for the cell to function
properly
a. Enzymes to carry out important biological reactions
b. Structural proteins to give the cell shape
c. Membrane bound proteins to receive signals and to
anchor the cell
d. Signaling proteins which are secreted and carry signals
from one cell to another
e. Other proteins not covered in the other four categories
2. The information to produce these proteins is housed within
the DNA
3. The proteins are produced through a process known as gene
expression
a. DNA  RNA  Protein
b. Each step of this process is regulated
4. In order to study each step in the process, Molecular Biologists
needed to develop techniques to study each molecule in this
complicated process
B. Introduction: Practical Reasons For Developing Molecular
Techniques
1. Techniques in Molecular Biology have been developed for four
reasons
a. Study basic gene function
b. Determine mechanisms of disease
c. Disease diagnostics
d. Forensics
2. For those Molecular Biologists interested in disease, they
would need tools to determine the root cause of the disorders
they wanted to study
3. If following a chromosomal disorder in which an individual has
too many copies of a single chromosome (Downs Syndrome)-they
needed molecular tools to visualize chromosomes in situ or in
vitro
4. For single gene disorders, they would need a whole battery of
techniques to study the gene, and to determine how that
mutation may affect the expression of the gene of interest
5. Besides these tools being used for the basic study of gene
function and disease, many have been either used, or modified
such that they can be used to diagnose disease
a. Can be used to confirm or determine whether one has
disease causing alleles
b. Can be used for preventative purposes
c. These techniques are used “genotype” people
6. Many of the same techniques used in disease diagnosis are also
used in forensics due to the fact that one also wants to “genotype”
suspects and criminals to find out who committed the crime
II. Visualizing Molecules
A. Visualizing Molecules: Introduction
1. In order to first start studying genotypes or the process of gene
expression, one must first develop techniques to visualize all of
the important molecules involved
a. DNA
b. RNA
c. Protein
2. The methods by which to visualize DNA and RNA are quite
similar because they have similar chemistry
3. The methods by which to visualize proteins can be quite
different due to the fact that they have a different chemistry than
DNA and RNA
B. Visualizing Molecules: DNA and RNA
1. In order to visualize DNA, we use a technique known as
agarose gel electrophoresis
2. The agarose is an inert substance that is used to create a
porous gel matrix, which allows us to separate DNA molecules
according to size
a. DNA molecules are moderately flexible and occupy
effective volume
b. The gel matrix acts as a sieve through which DNA
molecules pass
c. Large DNA molecules have more volume and thus have
more difficulty passing though the gel than smaller DNA
molecules and so they run smaller
3. In order to run your DNA samples through the gel, they are
placed in wells at the top of the gel and electrical current is
applied
a. Negative electrode (black) is placed near the top of the
gel
b. Positive electrode (red) is placed near the bottom of the
gel
c. Since the DNA is negatively charged it will run toward
the positive electrode when current is applied
4. Again, as the gel runs, smaller DNA molecules will run faster
than large ones
5. In order to visualize the DNA, the gel is stained with ethidium
bromide
a. Interacalating agent
b. DNA fluoresces when UV light is shine on the gel
c. DNA will be visualized as bands
6. Oftentimes when running an agarose gel, a size standard is
also used for comparison to determine the size of the DNA bands
in your samples
7. RNA is also visualized in much the same way as DNA, other
than formaldehyde is used to denature the extensive secondary
structure of the RNA to ensure it runs on the gel true to size
C. Visualizing Molecules: Proteins
1. In order to visualize proteins, we also use gel electrophoresis
2. Instead of using agarose gel electrophoresis, we use SDSPolyacrylamide Gel Electrophoresis (SDS-PAGE)
a. Acrylamide will form the gel matrix
b. SDS acts as a denaturant to relieve structure within the
protein so that it runs true to size on the gel
c. SDS also coats the linearized proteins (which have a
relatively non-polar backbone) giving them a net negative
charge
3. The SDS-Polyacrylamide gel, actually consists of 2 gels which
consists of different amounts of acrylamide
a. Stacking gel (which stacks all the proteins so the enter
the separating gel together
b. Separating gel, which allows for separation of proteins
according to size
4. Since the protein now has a net negative charge, electrical
current can be used to run the proteins through the gel
a. Negative electrode is placed at the top of the gel
b. Positive electrode is placed at the bottom of the gel
5. Proteins run on the SDS-Polyacrylamide gel according to size
a. Proteins with greater molecular weight (larger
proteins) run slower
b. Proteins with lesser molecular weight (smaller
proteins) run faster
6. To visualize the proteins, coomassie blue dye is used, which
binds the proteins and causes them to appear purple
7. Proteins size is measured as a function of molecular weight
(Daltons)
8. A size standard (ladder) is run as a guide to determine the
molecular weights of proteins in your sample lanes
D. Visualizing Molecules: Proteins by Coomassie Blue Staining
1. If you run purified protein on an SDS-Polyacrylamide gel, then
you should see only one band upon coomassie blue staining
a. Band represents the only type of protein present in the
sample
b. Many copies of that single protein in the visible band
c. Band should run true to the protein’s size
2. If you run a cellular extract, then you will see all the different
proteins present in the cell type
a. Each type of protein is represented by a band on the gel
b. Each protein band should run true to size
E. Visualizing Molecules: Finding A Single Protein From A Cellular
Extract
1. Coomassie blue staining of an SDS-Polyacrylamide gel has its
advantages because one can see all the proteins present in the
cellular extract
2. If you want to study just one protein in a cellular extract,
coomassie blue staining of the gel is not the best way to visualize
a. Your protein will be one band amongst many
b. An extract may contain several proteins of similar
molecular weight
3. What is needed is a technique that allows visualization of just a
single protein from the extract, and this technique is the Western
Blot
4. The western blot can be used as a technique to study gene
expression
a. Whether the protein is present in an extract, and if so,
the gene is expressed
b. Western blot, if done right, can tell you protein levelswhich will give an idea to the level the gene is expressed
F. Visualizing Molecules: Creating Protein Specific Antibodies For
Western Blots
1. The western blot technique requires a set of proteins that are
meant to recognize foreign proteins in vivo
2. For the protein you are interested in studying, first obtain
purified protein
3. Inject the purified protein into a rabbit
4. Rabbit’s immune system will recognize that the protein is
foreign and will make antibodies against the protein
5. Take blood samples from the rabbit and then purify antibodies
from the blood samples
6. Antibodies produced are considered polyclonal antibodies
because each protein that is injected a mixture of antibodies will
made that recognize different epitopes within the protein
G. Visualizing Molecules: Actual Western Blotting Procedures
1. First, protein must be extracted from the cell line of choice to
make an extract
2. Next, a sample of extract is then mixed with SDS-sample buffer
and boiled
a. The sample buffer contains dye
b. The sample buffer contains SDS, which is a detergent
c. The SDS acts to denature the protein
d. The SDS also coats the protein, giving it a net negative
charge
e. The boiling step also aids in the denaturation of the
protein
3. Once the proteins are denatured, the sample above is run on
an SDS-polyacrylamide gel
4. Once the gel is run, the proteins are transfer horizontally to a
nitrocellulose membrane
a. In the transfer apparatus, the gel is placed vertically to
allow for a horizontal transfer
b. Proteins are transferred by using electrical current
c. The transfer is done horizontally towards the anode, as
the proteins are coated with the negatively charged SDS
5. Supplemental Figure 1: Visualizing Molecules: Actual Western
Blotting Procedures
6. In order to visualize your proteins on the blot, the blot must be
probed with your antibodies
7. In order to get an efficient probing of the blot, two antibodies
are used
a. The primary antibody binds the protein of interest
b. The secondary antibody binds the constant region of the
primary antibody
c. The constant region of an antibody is held in common
for all antibodies produced by organisms of the same
species
d. The secondary antibody has either Alkaline
phosphatase or Horseradish peroxidase conjugated to it
8. Once the antibodies are bound, the protein of interest can be
visualized by two methods
a. Using a chemiluminescent substrate or a colorimetric
substrate
b. The conjugated enzyme will oxidize the substrate and if
it is the chemiluminescent substrate, light will be emitted
c. The conjugated enzyme will oxidize the substrate and if
it is the colorimetric substrate, then a purple product is
left behind
9. In either case, the protein of interest will appear as a band on
the gel
10. Supplemental Figure 2: Visualizing Molecules: Actual Western
Blotting Procedures
11. Besides telling you whether a protein is present or absent in a
sample, a western blot can tell you whether the protein’s size or
levels has been altered
12. If the protein is somehow truncated, then one would find the
protein lower on the western blot (because it ran faster on the
gel)
13. If the protein’s levels have been altered, the intensity of the
band may be altered
a. If levels of protein are increased then the band appears
darker
b. If the levels of protein are decreased, then the band
appears lighter
G. Visualizing Molecules: Finding A Specific RNA From An Extract
1. If you want to study gene expression, protein is not the only
molecule that can be studied
2. In addition to proteins RNAs can also be followed
a. mRNA levels are oftentimes proportional to the level at
which the gene is expressed because the mRNA is
translated to make protein
b. For some genes, the terminal product is an RNA, and
therefore, you would not be able to follow expression of
those genes using a western blot
3. The technique that is used to study a single RNA amongst all
present in a cellular extract is the northern blot
4. Method is easy and produces results that are easily
reproducible-most common method used to study cellular mRNA
levels, and thus this technique can be used to determine whether
a specific gene is expressed, and to what levels it may be
expressed
5. Note: Again for protein coding genes, this technique is not the
most direct technique to study expression because the terminal
product of gene expression of a protein coding gene is a protein
H. Visualizing Molecules: Northern Blot Analysis-Procedural Overview
1. First RNA isolations must be performed from the cell
line/strain of choice
a. Allows us to have a sample of cellular RNA (all types)
b. The result is that we have purified RNA (only ~2% of
RNA is mRNA in yeast, ~10% in other species)
2. Once the total RNA is isolated, then we run the RNA sample on
the gel
a. If we stain the gel with ethidium bromide, we will see
the ribosomal RNA as bands on the gel
b. The mRNA, since the levels are so low, will not be seen
by staining
c. The gel contains formaldehyde, which is a denaturant
3. The RNA is transferred to a nylon membrane and then
crosslinked to the membrane
a. Transfer occurs in a similar manner to a Southern Blot
b. Transfer occurs by capillary action
4. Lastly, the blot is probed using a probe complementary to the
mRNA of interest
J. Visualizing Molecules: Transferring the RNA To The Nylon Membrane
(agarose gel)
1. In order to do a northern blot, the RNA must be transferred
from the gel to a nylon membrane
2. Instead of using current for the transfer of RNA like we did for
protein, we will use capillary action instead
3. In order perform a northern transfer, we must create a
transfer apparatus
4. Create a transfer apparatus by using a tray and making a paper
wick with Whatman Paper
5. In the tray, place 10X SSC-this is the solution that will be used
for the transfer
a. SSC stands for salt (NaCl), Sodium Citrate
b. This is just a salt buffer and does not need to function as
a denaturant since the formaldehyde in the gel performed
the process
6. Place gel on bed of wet whatman paper
7. Place nylon membrane on top of the gel
8. Place three whatman papers on top of the gel
9. Place a stack of paper towels on top of the membrane
10. Place a weight on top of the paper towels
11. 10X SSC will move out of the tray and up through wick, gel,
membrane and paper towels by capillary action-RNA will move
out of the gel and be transferred to membrane
12. The RNA is then usually crosslinked to the nylon membrane
by using UV light
K. Visualizing Molecules: Probing the Northern Blot
1. In order to probe the blots, two types of probes can be used
a. RNA probes (full length) with complementary sequence
to the mRNA of interest
b. Oligo probes with complementary sequence to the
mRNA of interest
2. RNA probes are made by in vitro transcription in the presence
of 32P radio-labeled nucleotide (s) – usually use the nucleotide
that is most frequently found in the mRNA to be probed –good for
studying less abundant transcripts
3. Oligo probes are short (~20-30 nt) and composed of DNA
a. To add a radiolabel to the oligo use 32P-labeled dATP
and T4 DNA Kinase
b. Easy to make and good for studying abundant
transcripts
4. Alternatively an HRP-conjugated nucleotide can be used which
will allow for detection by colorimetric assay
5. If RNA is present in the RNA sample(s) then it will appear as a
band
III. Manipulating DNA
A. Manipulating DNA: Introduction
1. Unlike proteins and RNAs, most naturally occurring DNA
molecules are much larger than can be analyzed in the lab
a. Eukaryotic chromosomes are long DNA molecules that
contain thousands of genes and
b. Eukaryotic chromosomes can contain more than 100 Mb
of DNA
2. To study individual genes or regions within a chromosome, the
DNA must be broken into more manageable pieces
3. There are two ways at which we can break the genome into
more manageable pieces
a. Use restriction endonucleases to cleave the DNA into
smaller fragments
b. We can copy specific sequences by use of Polymerase
chain reaction (PCR)
B. Manipulating DNA: Introduction Restriction Endonucleases
1. An important advance in the study of molecular genetics was
the discovery of restriction enzymes in the 1970s
a. The enzymes were discovered in bacteria
b. They function to cut DNA at SPECIFIC Sequences
2. Today, we know of more than 3500 restricition enzymes
3. There are three classes of restriction enzymes
a. Type I
b. Type II
c. Type III
4. Type I restriction enzymes cut DNA at sites that are far from
their recognition sequence
5. Type II restriction enzymes recognize specific DNA sequences
and cut within (or near) those sequences
6. Type III restriction enzymes recognize two non-palindromic
sequences in opposite orientations, and then cut outside the
sequences they recognize
C. Manipulating DNA: General Information About Restriction Enzymes
1. Of the 3500 restriction enzymes identified, only a small
percentage are commercially available for use in laboratory
experiments
a. There are 240 type II restriction enzymes, which
compose a great percentage of those available
b. A small percentage of those commercially available are
type I restriction enzymes
2. Each type II restriction endonuclease is composed of two
identical peptide subunits that join together to form a
homodimer
3. Each restriction endonuclease is named for the organism in
which they were discovered, using a system of letters and
numbers
4. HindIII was discovered from Haemophilus influenza (strain D)
a. The Hin comes from the first letter of the genus name
and the first two letters of the species name
b. The d comes from the strain type
c. The III comes from the fact that it is the third restriction
enzyme isolated from this organism
5. EcoRI was isolated from E. coli strain R and is the first enzyme
isolated from this organism
D. Manipulating DNA: Sequence Recognition By Restriction
Endonucleases
1. Most of the type II restriction enzymes recognize sequence of
either 4 or 6 base pairs, however some recognize sequences of 8
or 10 base pairs in length
2. The most commonly used restriction enzymes recognize
sequences 6 base pairs
3. The sequences the restriction enzymes recognize are
palindromes; which means the sequences in the recognition site
when read in the 5’  3’ direction are the same for both strands
of the double stranded DNA molecule
a. EcoRI is a restriction enzyme that recognizes the
sequence 5’ GAATTC 3’
b. The complementary strand also has the sequence 5’
GAATTC 3’
E. Manipulating DNA: Type II Restriction Endonucleases Cut DNA
Specifically
1. When digesting the DNA with restriction enzymes, one can
consistently predict the possible products no matter which
restriction enzyme is used
a. The restriction enzymes recognize specific sequences
b. The restriction enzyme cuts the DNA at the recognition
site in a consistent manner (the same way every time)
2. For instance, when a restriction enzyme cuts, it cuts at the
specific site by cleaving the phosphodiester backbone
3. Let’s take the example of the EcoRI restriction enzyme, which
cuts the DNA at the 5’ GAATTC 3’ site between the G and the A
a. After cutting, what is left is something called a 5’
overhang
b. The 5’ overhang is single stranded sequence that is left
on the products (the DNA molecules left after using the
restriction enzyme) after cutting the DNA with the EcoRI
c. Some restriction enzymes are blunt cutters, leaving no
overhangs (eg HpaI)
d. Some enzymes leave 3’ overhangs (eg PstI)
4. Each restriction site recognized by a type II restriction enzyme
has an axis of symmetry
a. Axis of symmetry lies right in the middle of the
restriction site
b. If you actually flip one side of the restriction site, you
will find that the site will look completely symmetrical
5. One can predict what type of overhangs will be produced if one
knows where a specific restriction enzyme cuts within its specific
restriction site
6. If the restriction enzyme cuts 5’ to the axis of symmetry, then
5’ overhangs are produced
a. EcoRI cuts between the G and the A
b. This site is 5’ to the axis of symmetry
7. If the restriction enzyme cuts 3’ to the axis of symmetry, then
3’ overhangs are produced
a. PstI cuts between the G and the A in its restriction
recognition site
b. This site is 3’ to the axis of symmetry and thus leaves 3’
overhangs
8. If the restriction enzyme cuts at the axis of symmetry, then it is
considered a blunt cutter, and no overhangs are produced
9. After the DNA is cut, what are left are termed fragments
10. There are two different geometries to the DNA molecules one
can cut
a. Linear DNA molecules
b. Circular DNA molecules
11. The number of fragments left after cutting a circular DNA
molecule is equal to the number of restriction sites present in the
DNA molecule
12. The number of fragments left after cutting a linear DNA
molecule is equal to the number of restriction sites present in the
DNA molecule plus 1
13. Let’s cut the following DNA molecule with BamHI (which
recognizes 5’ GGATCC 3’)
–5’
CACGACGGATCCCTAGATGCTGAAATTCTAGGATCCCCCGGGTTTAA
A 3’
a. Please note that these sequences are double stranded in
vivo
b. Note: BamHI cuts between the G and the G
F. Manipulating DNA: The Southern Blot
1. There are three reasons by which one may want to restriction
digest DNA
a. Molecular Cloning
b. Genotype an individual (for a specific gene)
2. Oftentimes, when one does a genotyping experiment, one takes
a sample of genomic DNA from an individual and digests it using
either a single restriction enzyme, or several restriction enzymes
3. In using genomic DNA, this leaves a problem, one needs to find
a specific DNA fragment corresponding to the gene you are
studying amongst all the other fragments in the genomic digest
4. Luckily, there is a technique that allows us to find the DNA
fragment corresponding to the gene you are studying, and this is
the southern blot
G. Manipulating DNA: The Southern Blot
1. Southern blotting was developed in the 1975 by Edward
Southern
2.The goal of the southern blot technique allows one to find an
examine specific DNA fragments amongst a large number of DNA
fragments
a. These fragments are usually derived from the genomic
DNA from the appropriate source
b. The DNA fragments are produced by restriction digests
3. From this, the recombinant plasmid containing your gene of
interest can be specifically found
4. Once one obtains the genomic DNA of choice, the first thing is
to digest it using restriction enzyme(s)
5. The next state is to then run the DNA sample on an agarose gel
6. To be analyzed, the DNA must be first denatured such that it
become single stranded, and so the transfer is run using 0.4N
NaOH
7. Just like the Northern, the DNA is transferred to a nylon
membrane by capillary action
a. The gel is placed on top of a wet bed of Watman Paper
b. To transfer the nylon membrane is placed directly on
top of the gel
c. On top of the membrane, a stack of paper towels and a
weight is placed
d. In this setup, the liquid in the Watman moves up from
the Watman to through the gel to the nylon membrane
carrying the single stranded DNA with it
8. Once the DNA is transferred to the membrane, it is then crosslinked to the membrane
9. In the Southern Blot, we want to indentify a specific DNA
fragment(s) from the million fragments produced by the
restriction digest
10. To identify the specific fragment(s) the blot must be probed
with a single stranded DNA probe that is complementary to the
gene you are interested in studying
a. This probe doesn’t have to cover the full length of the
gene
b. The probe is labeled with radioactivity (32P) such that
you can use X-ray film or a phosphorimager to visualize
your results
11. Binding of the probe to complementary sequence
(hybridization) will mark the location of the DNA fragment you
are interested in on the blot
12. Where your fragment is you will see a band on the developed
X-ray film, or on your phosphorimager scan
H. Manipulating DNA: Using The Southern Blot To Do RFLP
1. One can use restriction digestion and southern blotting to do
RFLP
2. RFLP stands for Restriction Fragment Length Polymorphism
3. RFLP is a difference in homologous DNA sequences that can be
detected by the presence of fragments of different lengths after
digestion of the DNA samples with specific restriction
endonucleases
4. The main use for using the RFLP is to determine the genotype
of an individual for a single gene or a set of genes
a. Genetic Mapping
b. Diagnose disease
c. Paternity
d. Forensics
5. In order to do RFLP, you need a target sequence
a. Consists of DNA sequence corresponding to the gene
(either a portion of the entire full length) you are
interested in studying
b. The target sequence will eventually be bound by a probe
with complementary sequence during the southern
blotting part of the protocol
6. Each allele for a given gene may have either more or less
restriction recognition sites for a given restriction enzyme
a. The number of DNA fragments produced for each allele
will be different
b. The size of the DNA fragments produced for each allele
will also be different
7. If you take an individual, he/she will have two copies of each
gene
a. Homozygotes will have 2 copies of the same allele
b. Heterozygotes will have 2 different alleles for the gene
8. In order to do RFLP, take a sample of genomic DNA from an
individual, and then restriction digest it with one or more
restriction endonucleases
9. Next, run the samples on an agarose gel, then transfer the
samples to a nylon and perform a southern blot with a probe to
detect your gene of interest
10. Upon probing, one should be able to determine the identity of
both alleles an individual has for a given gene by looking at the
number and size of bands produced (be aware that each
individual’s DNA will be represented in a single lane, and you will
see the results for both alleles for an individual in ONLY one
lane)
J. Manipulating DNA: Copying Your Gene of Interest by Polymerase
Chain Reaction (PCR)
1. To amplify (make copies) of your gene of interest, one can use
the polymerase chain reaction (PCR)
2. PCR was developed by Kary Mullis in the early 1980s
3. In a PCR reaction, we place several components
a. Genomic DNA
b. Nucleotides (the building blocks of DNA)
c. Taq DNA polymerase (enzyme that carries out the
reaction and is thermostable in that it can withstand high
temperatures
d. A buffer that is optimized for Taq activity
e. Primers
4. The primers small DNA molecules of about 20 nucleotides
5. They are specific for the gene of interest because they are
designed to be complementary to the ends of your gene of
interest
6. There are two primers in the reaction, the forward primer and
the reverse primer
7. The forward primer has complementary sequence to the DNA
strand that goes 5’  3’ in the right to left direction, and it binds
on the 3’ end to its complementary sequence
8. The reverse primer has complementary sequence to the DNA
strand that goes 5’  3’ in the left the right direction on the 3’
end
9. Once the reaction is set-up, we will then run the reaction in a
DNA thermocycler, and instrument that can precisely and quickly
change the temperature at which the reaction is being run at
10. To start the reaction, we bring the temperature up to 95 C
11. This acts to denature the DNA-i.e. the heat will break the
hydrogen bonds between the two strands of DNA to make them
single stranded
12. The single stranded DNA molecules will be the templates for
the reaction
13. Next, the temperature is cooled to about 55 C – 60 C to allow
the primers to bind to their complementary sequence (30S)
14. Once the primers have bound their complementary sequence,
we move the reaction up to 72 C
15. 72 C is the optimal temperature for Taq DNA polymerase to
work
16. The Taq DNA polymerase creates new DNA sequence by
binding onto the 3’ ends of the primers, and extending the DNA
sequence
17. The taq DNA polymerase extends the DNA sequence in the 5’
 3’ direction creating sequence complementary to the template
18. If you were to start with one molecule of DNA, after one round
of PCR, you would have 2
19. We often repeat these steps where we change temperature
about 30 times
20. In the end we have 230 copies of our gene of interest
21. At the end, you have enough copies to visualize on an agarose
gel