Supplemental Experimental procedures
Lake description and sampling methods
Water samples were collected from the northeast basin of Lake Grosse Fuchskuhle in April
and November 2011, and in April and September 2012. In brief, the naturally acidic bog Lake
Grosse Fuchskuhle has been artificially divided into four compartments by large plastic
curtains since 1990 (Allgaier and Grossart, 2006). The lake is located (53°10’N, 13°02’E, 59 m
above sea level) in the Mecklenburg-Brandenburg Lake District (Northeast Germany), which
was formed after the last ice age (Weichselian stage).
Dilution cultures
A lake water sample from November 2011 taken with a Van Dorn bottle at 4 m depth was
analyzed using the qPCR assays targeting all bacteria and acI. After transporting it was
calculated that 1 ml of lake water contained a total of 9.2 × 106 16S rRNA copies and of 3.4 ×
106 acI 16S rRNA copies. Dilution of the sample was done using triple filtered lake water
collected in April 2011. The dilution was done to theoretically yield 9.2 16S rRNA copies per
ml. A 96 well cell culture plate (Greiner bio-one) was filled with this diluted lake sample (200
µl per well). Microtiter plates were incubated at 11°C under a 12 h/12h light/dark cycle.
Examination for presence and quantity of the acI population was done 8 weeks after the
inoculation by the acI-specific qPCR assay.
All samples were collected using a van Dorn bottle. Samples were quickly transported under
ice cooled conditions to the laboratory where they were placed at 4°C until further
processing.
Media used for isolation and growth of bacteria
For the isolation and growth of the mixed cultures, water from Lake Grosse Fuchskuhle was
filtered twice next to a Bunsen burner, using sterile syringes and Sterivex filter cartridges
0.22 µm (Millipore). The double filtered water was stored in sterile falcon tubes at -20°C
until further usage. At the same day when inoculations were done, the sterile lake water was
thawed at room temperature and then filtered once again using the previously described
procedure. This water will be referred to as triple filtered lake water.
Usage of concentrated freshwater as a medium (6x)
In an attempt to test the effect of dissolved components (minerals, nutrients, organic
matter) concentrations on the co-culture, 600 ml water from Lake Grosse Fuchskuhle
collected in September 2012 was frozen at -20°C and subsequently concentrated on a Lyovac
GT2 (Finn-Aqua). After lyophilisation, the water was thawed and the volume was 100 ml.
This water was further filtered twice, using the previously described procedure. After the
second filtration step different dilutions were prepared with double distilled water. The
differently concentrated and double-filtered lake water was filtered once again before
inoculation.
Other defined media tested
In an attempt to replace the triple filtered lake water with an artificial media, the following
recipe was used: MgSO4 7H2O (75 mg l-1 ), CaCl2 2H2O (36.7 mg l-1), (NH4)2SO4 (16.5 mg l-1),
NaHCO3 (16 mg l-1), K2HPO4 (8.7 mg l-1), KCl (5 mg l-1),H3BO3 (1 mg l-1), Na2EDTA (4.4 mg l-1),
FeCl3 6H2O (3.2 mg l-1), MnCl2 4H2O (0.2 mg l-1), ZnSO4 7H2O (0.1 mg l-1), NiCl2 6H2O (0.1 mg l1),
NaMoO4 2H2O (0.02 mg l-1), CuSO4 5H2O (0.01 mg l-1), CoCl2 6H2O (0.01 mg l-1), Na2SeO4
(1.6 µg l-1). This mineral medium was designed based on previously described media (Kilham
et al., 1998; Hahn et al., 2004).
Quantitative analysis
Initially, qPCR was used for high-throughput detection of acI Actinobacteria. Once the cocultures with acI were identified, qPCR was used to rapidly estimate the abundance of 16S
rRNA genes of total bacteria, as well as acI. Gene abundance in 1 µl of sample was measured
on a CFX96 thermocycler (Bio-Rad). The qPCR conditions consisted of an initial step at 50°C
for 2 minutes followed by an initial denaturation at 95°C for 10 minutes. Thereafter, 40
cycles of denaturation at 95°C for 15 s, annealing for 30 s, extension at 72°C for 30 s, and
imaging were performed. Annealing temperature was 54°C for total bacteria and 65°C for acI
Actinobacteria. At the end, melting curves were recorded starting at 65°C and finishing at
95°C. The primers used for total bacterial estimations were 530F-N (5’-TGCCAGCMGCNGCGG
-3’) modified after (Garcia et al., 2011) and 926R (5’-CCGTCAATTCCTTTRAGTTT -3’) (Baker et
al., 2003). The acI primers used were 356F (targeting all bacteria) (Garcia et al., 2011) and
852R (5’- AATGCGTTAGCTGCGTCGCA -3’) (specific for acI) (Warnecke et al., 2005). The
annealing temperature for the respective primer pairs was optimized to obtain a better
detection limit. The number of 16S rRNA genes was determined using Maxima SYBR Green
qPCR Master Mix (2x) (Fermentas) and the manufacturers protocol with a forward and
reverse primer concentration of 0.3 µM, respectively.
Standard curves were generated. 16S rRNA gene standards were amplified from single
amplified genome (SAG) acI-B1 DNA (Garcia et al., 2013b) using the 8F (5’AGAGTTTGATCMTGGCTCAG -3’) (Youssef et al., 2009) and 1492R (5’GGTTACCTTGTTACGACTT-3’) (Labrenz et al., 2004) primer sets. The PCR products were
extracted using Zymoclean Gel DNA Recovery Kit (Zymo Research). DNA concentrations were
measured fluorometrically by QUBIT (Life Technologies) and the dsDNA HS assay kit (Life
technologies). DNA concentration of both standards was adjusted to 1.6 µg ml -1 .The
concentration of sequences in the standards was calculated based on the measured DNA.
Standard curves were based on a dilution series of six concentrations of the standards
ranging from 102 to 107 copies µl-1 and were run in duplicate. It was found that freezethawing and long term storage of the standards caused gradual degradation, making the
determination of the 16S rRNA gene copy number very inexact. After several preliminary
tests we found that preparing dilutions of the standards with TE Buffer pH 8.0 (Ambion) and
storing them using DNA LoBind Tubes (Eppendorf) keeps the standards more stable and
reduced DNA degradation of the standard considerably.
Reaction efficiencies averaged at 78.5% (range 72.3-84.4%) for all bacteria, for acI
Actinobacteria at 78.4% (range (72.6-86.7%). Detection limits were (in gene copies per
reaction): for all bacteria 16S rRNA gene copies = 9.95 × 101, for acI 16S rRNA gene copies =
1.82 × 101
The relative abundances of acI-16S rRNA genes was calculated using the ratio between the
quantified acI gene copy number and the total bacterial 16S rRNA genes. It is important to
mention that relative abundance of 16S rRNA genes is not exactly the same as cell number
since some bacteria have >1 16S rRNA gene in their genome. However, we note that the acIB1 SAG (Garcia et al., 2013b) genome contained only one 16S rRNA operon (Meincke et al.,
2012).
Clone libraries
DNA was extracted in two different ways: i) For small volume (100 µl) enrichments, DNA
extraction was performed directly from the liquid culture; ii) For larger volumes (>5 ml), cells
were filtered onto 0.1 µm Isopore membrane filters (Millipore) and the DNA was extracted
from the filter. DNA was extracted in both cases using the ZR Soil Microbe DNA MiniPrep kit
(Zymo Research) as previously described (Garcia et al., 2011). Small subunit rRNA genes
were amplified by using the primer 356F in combination with the primer 1016R (5’CRRCACGAGCTGACGAC-3’) (Andersson et al., 2008) for most of the clone libraries (primers
8F and 1492R were, however, also used to obtain nearly full length sequences). PCR was
performed on the extracted DNA by using the Platinum PCR SuperMix High Fidelity (Life
Technologies). The PCR conditions consisted of an initial denaturation at 94°C for 10 minutes
followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 50°C for 30 s and
extension at 68°C for 60 s. The final extension was carried out at 68°C for 10 minutes. The
PCR product was visualized by electrophoresis on 1% agarose gels, stained with Gel Red
(VWR) and further purified using the Zymoclean Gel DNA Recovery Kit (Zymo Research). For
cloning, the TOPO TA Cloning Kit for Sequencing was used (Life technologies) following the
manufacturer’s instructions.
Sequencing and phylogenetic analysis
All sequencing was performed at GATC biotech (gatc-biotech.com). The obtained 16S rRNA
sequences were aligned and phylogenetically classified using the software package ARB
(Ludwig et al., 2004) and the taxonomy framework introduced by Newton and colleagues
(Newton et al., 2011). Sequences were deposited into Genbank under KC702667-KC702668
accession numbers.
CARD-FISH
Fluorescence in situ hybridization with horseradish-peroxidase-labeled probes and tyramide
signal amplification was performed as described previously using the acI-852 probe and its
helper probes (Warnecke et al., 2005). Actinobacterial abundances were observed on an
Axio Scope.A1 LED microscope (Carl Zeiss).
Supplemental Figure 1. Density of acI-16S rRNA gene copies at day seven. The effects of the
addition of 0.5 g l-1 of several carbon compounds can be observed. (LW = lake water;
Negative control = non-inoculated triple filtered lake water; NAG = N-acetylglucosamine).
3000
2500
2000
1500
1000
500
0