Supplementary Information
Production of Δ9-tetrahydrocannabinolic acid from cannabigerolic acid by whole cells of Pichia (Komagataella)
pastoris expressing Δ9-tetrahydrocannabinolic acid synthase from Cannabis sativa L.
Bastian Zirpel 1, Felix Stehle1,*, Oliver Kayser1
1
Laboratory of Technical Biochemistry, Department of Biochemical & Chemical Engineering, TU Dortmund
University, Dortmund, Germany
*Correspondence to:
Felix Stehle
Laboratory of Technical Biochemistry, Department of Biochemical & Chemical Engineering, TU Dortmund
University, Emil-Figge-Str. 66 , 44227 Dortmund, Germany
felix.stehle@bci.tu-dortmund.de
Supplementary Table 1: List of microorganisms used for expression of THCAS
Organism
Strain
Company
Genotype
E. coli
SHuffle
NEB, Frankfurt,
fhuA2 lacZ::T7 gene1 [lon] ompT ahpC gal
T7 Express
Germany
λatt::pNEB3-r1-cDsbC (SpecR, lacIq) ΔtrxB
sulA11 R(mcr-73::miniTn10--TetS)2 [dcm]
R(zgb-210::Tn10--TetS)
endA1
Δgor
∆(mcrC-mrr)114::IS10
E. coli
SHuffle
NEB, Frankfurt,
lacZ::T7 gene1 [lon] ompT ahpC gal
T7 Express lysY
Germany
λatt::pNEB3-r1-cDsbC (SpecR, lacIq) ΔtrxB
sulA11 R(mcr-73::miniTn10--TetS)2 [dcm]
R(zgb-210::Tn10--TetS)
endA1
Δgor
∆(mcrC-mrr)114::IS10
S. cerevisiae
S. cerevisiae
CEN.PK2-1C
Euroscarf, Frankfurt,
MATa; gal1::loxP; ura3-52; trp1-289; leu2-
Δgal1
Germany
3,112; his3Δ 1; MAL2-8C; SUC2
CEN.PK2-1C
this work
MATa; gal1::loxP; pep4::loxP; ura3-52;
Δgal1Δpep4
trp1-289; leu2-3,112; his3Δ 1; MAL2-8C;
SUC2
P. pastoris
PichiaPink1
Invitrogen, Darmstadt,
ade2
Germany
P. pastoris
PichiaPink2
Invitrogen, Darmstadt,
ade2; pep4
Germany
P. pastoris
PichiaPink3
Invitrogen, Darmstadt,
Germany
ade2; prb1
Supplementary Table 2: List of plasmids
Plasmid
Features
pET28a(+)_THCAS
pET28(a+) (Merck, Darmstadt, Germany) with cDNA of THCAS; cloned into NdeI
and HindIII restriction sites
pET32a(+)_THCAS
pET32a(+) (Merck, Darmstadt, Germany) with cDNA of THCAS; cloned into NcoI
and HindIII restriction sites
pDionysos_THCAS
pDionysos with cDNA of THCAS codon usage optimized for S. cerevisiae; Nterminal 5’UTR (AAAAAA) followed by sequence coding for 24 aa signal peptide
of proteinase A (Uniprot P07267); C-terminal sequence coding for 3 additional
histidines; cloned into HindIII and XbaI restriction sites
pPink_HC_THCAS
pPink-HC (Invitrogen, Darmstadt, Germany) with cDNA of THCAS codon usage
optimized for P. pastoris; N-terminal 5’UTR (AAAAAA) followed by sequence
coding for 24 aa signal peptide of proteinase A (Uniprot F2QUG8); C-terminal
sequence coding for 3 additional histidines; cloned into EcoRI and KpnI restriction
sites
pPink_LC_THCAS
pPink-LC (Invitrogen, Darmstadt, Germany) with cDNA of THCAS codon usage
optimized for P. pastoris; N-terminal 5’UTR (AAAAAA) followed by sequence
coding for 24 aa signal peptide of proteinase A (Uniprot F2QUG8); C-terminal
sequence coding for 3 additional histidines; cloned into EcoRI and KpnI restriction
sites
Figures
Supplementary Figure 1: Screening of P. pastoris clones - volumetric THCAS activity; cultures were inoculated
at 0.105 gCDW l-1. Cultures were grown at 200 rpm and 20 °C. Methanol was added every 24 h at 0.5 % (v/v).
Values are calculated from biological duplicates.
Supplementary Figure 2: Screening of P. pastoris clones - specific THCAS activity; cultures were inoculated at
0.105 gCDW l-1. Cultures were grown at 200 rpm and 20 °C. Methanol was added every 24 h at 0.5 % (v/v). Values
are calculated from biological duplicates.
Supplementary Figure 3: Expression of THCAS using PP2_HC; Cultures were grown in 3-baffled shake-flasks
at 200 rpm and 10 °C. Methanol was added every 24 h at 0.5 % (v/v). Data points represent the means of three
biological replicates with two technical replicates and error bars represent the standard deviation.
Supplementary Figure 4: Expression of THCAS using PP2_HC; Cultures were grown in 3-baffled shake-flasks
at 200 rpm and 20 °C. Methanol was added every 24 h at 0.5 % (v/v). Data points represent the means of three
biological replicates with two technical replicates and error bars represent the standard deviation.
Supplementary Figure 5: Expression of THCAS using PP2_HC; Cultures were grown in 3-baffled shake-flasks
at 200 rpm and 25 °C. Methanol was added every 24 h at 0.5 % (v/v). Data points represent the means of three
biological replicates with two technical replicates and error bars represent the standard deviation.
Additional Information
Media composition
2 x YPAD medium (pH 5.5): 20 g yeast extract l-1, 40 g peptone l-1, 4.41 g citric acid monohydrate l-1, 25.63 g
tripotassium citrate monohydrate l-1, 10 mg riboflavin l-1, 80 mg adenine hemisulfate l-1, 40 g fructose l-1, 5 g
galactose l-1.
BMGY medium (pH 6): 10 g yeast extract l-1, 20 g peptone l-1, 100 mM phosphate buffer pH 6.0, 13.8 g yeast
nitrogen base l-1, 0.4 mg biotin l-1, 10 g glycerol l-1.
Modified BMMY (mBMMY) medium (pH 5.5) (adapted from Taura et al. 2007): 10 g yeast extract l-1, 20 g
peptone l-1, 5 g casamino acids l-1, 100 mM sodium citrate buffer pH 5.5, 13.8 g yeast nitrogen base l-1, 0.4 mg
biotin l-1, 10 mg riboflavin l-1, 1 % (v/v) methanol.
Generation of E. coli strains for intracellular THCAS expression
pGEM-T-easy(modified) carrying the plant cDNA of THCAS – THCAS sequence was amplified using the
primers (5’-GATCCATATGAATCCTCGAGAAAACTTCCTTAAATGCTTCT-3’ and 5’-GCATAAGCTT
CTATTAATGATGATGCGGTGGAAGAGG-3’) and cut with NdeI and HindIII for insertion into pET28a(+) or
with primers (5’-GACTCCATGGCTAATCCTCGAGAAAACTTCCTTAAATGCTTCT-3’ and 5’-GCATA
AGCTTCTATTAATGATGATGCGGTGGAAGAGG-3’) and cut with NcoI and HindIII for insertion into
pET32a(+). The vectors generated contained the cDNA of THCAS without signal peptide and were transformed
into E. coli SHuffle T7 Express and E. coli SHuffle T7 Express lysY.
Generation of S. cerevisiae strains for intracellular THCAS expression
A cDNA coding for the THCAS without the first 84 bp (native signal peptide) and optimized for the codon-usage
in S. cerevisiae was obtained from GeneArt (Regensburg, Germany). The cDNA was amplified by PCR with
gene-specific
primers
(5’-GGGAATTCAAGCTTAAAAAAATGTCCAGCTTGAAAGCATTAT
TGCCATTGGCCTTGTTGTTGGTCAGCGCCAACCAAGTTGCTGCAAACCCTAGAGAAAACTTTTTGA
ATG-3’ and 5’-GACTTCTAGATCATTAATGATGATGATGGTGATGTGGAGGCAATG GAGGGATGG-3’)
to introduce a 5’UTR consensus sequence from S. cerevisiae in the 5’ untranslated region followed by a sequence
coding for a 24 amino acid signal peptide from S. cerevisiae vacuolar proteinase A (UniProt accession number
P07267) and three histidine residues to complement a His6-tag at the C-terminus of the protein. The PCR product
was purified from gel and cloned into pDionysos using HindIII and XbaI restriction sites. The empty vector was
transformed as negative control. Transformants were selected on minimal medium agar without leucine.
Generation of P. pastoris strains for intracellular THCAS expression
A cDNA coding for the THCAS without the first 84 bp (native signal peptide) and optimized for the codon-usage
in P. pastoris was ordered from GeneArt. The cDNA was amplified by PCR with gene-specific primers
(5’-GCATACGAATTCAAAAAAATGTCTATATTTGACGGTACTACGATGTCAATTGCCATTGGTTT
GCTCTCTACTCTAGGTATTGGTGCTGAAGCCAACCCAAGAGAAAACTTCTTGAAGTG-3’
and
5’-CGCTAGGGTACCTTATTAATGATGATGATGATGATGTGGTGGCAATGG-3’) to introduce a 5’-UTR
consensus sequence from S. cerevisiae in front of the start codon followed by a sequence coding for a 24 amino
acid signal peptide from P. pastoris vacuolar proteinase A (UniProt accession number F2QUG8) and 3 histidine
residues to complement a His6-tag at the C-terminus of the protein. The PCR product was purified from gel and
cloned into the low copy number (pPink -LC) and high copy number (pPink -HC) vectors downstream of the
AOX1 promoter using EcoRI and KpnI restriction sites. The three PichiaPink strains 1, 2 and 3 were transformed
with linearized (cut with SpeI; chromosomal introduction into TRP2 gene) pPink-LC_THCAS or pPink –
HC_THCA plasmids. The empty vectors were transformed as negative controls. Transformants were selected on
Pichia adenine dropout (PAD) agar.
Cell lysis of E. coli cells
Cell cultures were centrifuged for 20 min at 4 °C and 5,000 g. Cell pellet was resuspended in 6 ml 100 mM sodium
citrate buffer pH 5.5. The cell suspension was supplemented with 10 mg lysozyme ml -1 and incubated for 20 min
at room temperature. Afterwards 10 mg DNaseI ml -1 was added and the cell suspension incubated at room
temperature for 10 min. Cells were lysed by sonication on ice at an amplitude of 10 % (10 x 6 s pulse on, 30 s
pulse off). The lysate was centrifuged for 30 min at 5.000 g and 4 °C and the supernatant used for activity assays.
Cell lysis of S. cerevisiae and P. pastoris cells
Cells were harvested by centrifugation of 450 µl cell suspension at 13,000 g at 4 °C for 5 min. Supernatants were
discarded and cells resuspended in 450 µl 100 mM sodium citrate buffer pH 5.5. After addition of 75 U lyticase
ml-1 (Sigma Aldrich), cells were incubated at 37 °C and 1,100 rpm for 10 min in a shaking incubator. Cell
suspension was transferred to 0.5 ml tubes and filled with 0.25 mm – 0.5 mm glass beads. Cells were lysed by
vortexing at maximum speed at 4 °C for 10 min. Cell lysate was centrifuged and supernatant used for activity
assays.
Screening of P. pastoris transformants for high THCAS activity
From PAD agar plates five white colonies of each strain were picked for inoculation of 2 ml BMGY in glass tubes.
Cells were incubated at 30 °C in a rotary shaker. After 24 h cultures were centrifuged and pellet washed with
0.9 % NaCl, centrifuged and pellet resuspended in 2 ml of BMMY. 50 µl of the suspensions was used to inoculate
2 ml of BMMY in glass tubes, respectively. Cells were cultivated at 30 °C in the rotary shaker for 72 h. The clone
with the highest activity was selected of each strain and used for inoculation of 50 ml BMGY in 500 ml nonbaffled flasks. Cultures were incubated at 200 rpm at 30 °C for 24 h. After washing with 0.9 % NaCl, the pellets
were resuspended in BMMY and used for inoculation of 50 ml BMMY in 500 ml baffled flasks at a starting OD600
of 0.5. Cultures were grown at 20 °C, 200 rpm and supplemented every 24 h with 0.5 % (v/v) methanol.