MOLECULAR BIOLOGY I
Tissue preparation for DNA isolation
Principle: DNA can be isolated by an isolation kit based
on DNA adsorption on silicate.
Material for examination (bird blood or other tissue) is
lysed by lysis buffer (it contains detergents that
dissolve cell membranes and denature proteins),
enzyme proteinase K (it splits proteins including histons
bound to DNA) and enzyme RNase A (it splits RNA).
Material after lysis is transferred into isolation column
with silicate on surface (SiO2 - glass). In the presence of
chaotrope salts (part of the lysis buffer), DNA adheres to
silicate. The column with DNA adhered to silicate is
rinsed with buffers and finally DNA is released by elution
buffer.
General instruction:
 Each student will prepare one sample, students will
work in groups and share set of pipettes and all
other material.
 Required volume can be set on pipette - be careful
not to rewind the pipette out of given volume range.
 To prevent contamination of pipette, chemicals and
samples, new tips are used for each step of the
procedure.
 To prevent contamination of pipette by DNA, filtered
tips are used during working with DNA.
 To ensure accurate pipetting, tips should be
properly set to a pipette.
 To obtain required volume, pipette should be
pressed to the first position and tips should be
merged into solution. By relaxing the pressing the
liquid is sucked. After transferring the solution into
other tube, the pipette should be pressed to the
second position to release transferred material.
 The homogenization of liquid in a tube is done by
repeated sucking into the pipette and emptying
(three times)
 Tubes should be marked with the group number and
student number
Process of Lysis:
1. Tissue: take a piece of tissue (required size
corresponding to two pinheads) and transfer it into
microtube (1.5 ml) marked by marker.
(Blood: take fresh or thawed blood and transfer (use
tip with filter) 10 μl into microtube (1.5 ml) marked
by marker.
2. Tissue: use micropestle to grind the tissue and add
200 μl GT Buffer
(Blood: add 200 μl GT Buffer)
2. Add 20 μl proteinase K using new tips
3. Close the microtube, shake in your hands and let it
incubate 2 minutes in room temperature.
4. Add 200 μl buffer for lysation (GBT Buffer) using
new tip.
5. Close the microtube, shake it and place it into
thermoblock (or water bath) to incubate at 55 oC.
Tissue: incubate for 6 -18 hours
(Blood: incubate for 10 minutes)
6. Lysed samples will be stored at room temperature
for next week.
MOLECULAR BIOLOGY II
DNA isolation and PCR
DNA isolation:
1. Add 200 μl 96% ethanol to lysed sample (from
previous week).
2. Close the microtube and shake it by repeated
turnover of the microtube.
3. Take a column with collecting microtube and mark
the cover of column by marker.
4. Pour the content of microtube into the column.
5. Centrifuge for 2 min at 14 000 rpm (rounds per
minute).
6. Pour off collecting microtube and use it again
7. Add 400 μl washing solution 1 (W1 Buffer) into the
column using new tip.
8. Centrifuge for 1 minute at 14 000 rpm.
9. Pour off collecting microtube and use it again.
10. Add 600 μl washing solution 2 (W2 Buffer) into the
column using new tip.
11. Centrifuge for 3 minutes at 14000 rpm.
12. Transfer the column into a new microtube (1.5 ml)
marked by marker (discard the used collecting
microtube).
13. Add 100 μl elution solution into the center of column
(elution buffer)
14. Incubate for 2 minutes in room temperature.
15. Centrifuge for 1,5 minute at 14000 rpm
16. Discard the column and close the microtube that
contains isolated DNA.
PCR:
1. Each group of students prepares PCR mixture into
one microtube (1.5 ml) according to the sample
number (n + one extra):
Mixture for one sample:
 10 μl - PCR master mix (mixture of nucleotides
(dNTP), DNA polymerase and Mg2+ ions)
 0.2 μl - primer PP (TCTGGATCGCTAAATCCTTT)
 0.2 μl - primer P8 (CTCCCAAGGATGAGRAAYTG)
 7.6 μl - PCR water
2. Add 18 μl PCR mixture into PCR microtube (0.2 ml)
marked by marker on the cover and side of tube.
3. Add 2 μl isolated DNA using new filtered tip.
4. Close PCR microtube, place it into thermocycler and
run the appropriate PCR programme.
5. PCR product will be stored in fridge after finishing
PCR programme.
Programme of PCR amplification:
Initial DNA denaturation
94°C 1 min 30 sec
Primer attachment (annealing)
49°C 45 sec
Synthesis of complementary DNA strains (extension) 72°C 1 min 30x
DNA denaturation
94°C 1 min
Completion of DNA synthesis (final extension)
72°C 10 min
MOLECULAR BIOLOGY III
Restriction reaction with PCR products, DNA
electrophoresis, visualization and evaluation
Principle: Bird sex can be detected by analysis of CHD
gene (Chromo-Helicase-DNA binding gene), which
encodes a protein that regulates transcription on the
chromatin level. In birds, this gene is located on sex
chromosomes.
 Males are homogametic with sex chromosomes ZZ
 Females are heterogametic with sex chromosomes
ZW
The PCR (Polymerase Chain Reaction) is used to
amplify DNA fragment corresponding to a part of gene
located on chromosome W (CHD-W) and on
chromosome Z (CHD-Z). PCR products is cleaved by
restriction endonuclease (restrictase) Hae III (isolated
from bacteria Haemophilus aegyptius) in specific
restriction site.
5´-GG↓CC-3´
3´-CC↑GG-5´
This restriction site is present only in the PCR product of
gene CHD-Z, thus the enzyme cleaves it into two
fragments, while PCR product of gene CHD-W is not
cleaved (doesn´t contain restriction site). DNA fragments
are then separated by gel electrophoresis, visualized
under UV light and the result is evaluated.
Gel electrophoresis and DNA visualization
Principle: Gel electrophoresis is used to separate DNA
fragments according to their size. Gel electrophoresis is
based on the movement of negatively charged DNA
molecules in electric field towards anode. DNA
movement is inversely proportional to DNA size (smaller
molecules move faster). Electrophoresis is preceded in
suitable carrier, usually in agarose or polyacrylamide gel
(in the practical, agarose will be used).
Agarose gel is prepared in different concentration (% of
agarose). Agarose is dissolved in buffer, which is also
present in electrophoretic bath as an electrolyte. In the
practical, TBE buffer containing Tris. boric acid and
EDTA will be used. The samples are applied to wells
made in the gel by a comb.
The size of DNA fragment is estimated by comparing to
the size of fragments of DNA ladder (molecular weight
marker; DNA cleaved into fragments with defined size)
that is applied into one of the wells.
Prior to sample loading, each sample is mixed with the
loading buffer to facilitate DNA loading.
DNA is visualized by staining with DNA-binding dye,
such as ethidiumbromide (in the practical, MIDORI
Green will be used).
PROCEDURE
Restriction reaction:
1. Add 1.2 µl of mixture of restrictase Hae III and
reactivating buffer into new PCR microtube (0.2 ml)
marked with marker.
2. Add 10 µl PCR products using a new filtered tip.
3. Incubate it for 45 min at 37°C in the thermocycler.
1.2 % agarose gel preparation:
One agarose gel will be prepared for all students.
1. Weigh 1.2 g agarose and put it into an Erlenmeyer
flask.
2. Measure 100 ml TBE buffer with a glass cylinder,
pour it into the flask and mix.
3. Place the flask into the microwave oven and boil it at
maximal temperature for 2 minutes (stop the oven if
agarose starts to babble, mix the content of the flask
gently, not to generate bubbles in it); use gloves!
4. After 2 minutes, take the flask out of the microwave
oven and cool it under flowing water to 60 °C (so that
you can hold the flask for several seconds without
gloves).
5. Add 3 µl MIDORI Green (10 thousand times
concentrated solution) using a new tip and mix the
content gently.
6. Prepare electrophoretic form and pour off warm
agarose from the flask into the form up to 8 mm
height.
7. Place the comp into the form and remove eventual
air bubbles by tip.
8. Agar gel will be rigid after 30 min.
Horizontal gel electrophoresis:
1. Remove the comb from the gel, turn the gel in form
and submerge the gel into TBE buffer.
2. Apply 3 µl of DNA ladder (size standard, already
stained) into one well (the central one is the best).
3. Apply 10 µl of mixed PCR product into one of the
well (mixed PCR product = mixture of all your
samples prior to restriction).
4. Apply 10 µl of stained sample (PCR product after
restriction) into a gel well using a new tip (be
careful not to tear the gel).
5. Cover the electrophoretic bath with a lid, plug it in,
set constant voltage of 160 V for at least 20 min
and switch it on.
6. After the electrophoresis is finished, place the gel on
UV-transluminator and evaluate the results. Use
plastic cover to observe the result!
EVALUATION
Female sex: (ZW) two bands are present on gel. The
larger one corresponds to non-restricted CHD-W (with
the same size as a non-restricted PCR product) and
the second one (restricted CHD-Z) is smaller in about
50 bp (base pairs).
Male sex: CHD-Z is cleaved, thus there is just one
shorter fragment present in the gel.
100 bp
200 bp
300 bp
400 bp
500 bp
1
2
3
4
Fig. The result of gel electrophoresis: 1 – size marker, 2
– non-restricted PCR product, 3 – male, 4 – female