Loop-mediated isothermal amplification (LAMP) approach
for sex identification of human blood stained samples
Panan Kanchanaphum1*, Titinan Sarataphan1, Wirat Thirasan1 and Gun Anatasomboon2
1Biochemistry
2Anatomy
Unit, Department of Medical Science, Faculty of Science, Rangsit University, Pathumthani 12000, Thailand
Unit, Department of Medical Science, Faculty of Science, Rangsit University, Pathumthani 12000, Thailand
Correspondence to: Dr. Panan Kanchanaphum Biochemistry Unit, Department of Medical Science, Faculty of Science,
Rangsit University, Pathumthani 12000, Thailand ; E-mail : panan.k@rsu.ac.th
Abstract
Sex determination of the source of forensic DNA evidence is an importance step in crime investigation.
LAMP method is a novel molecular technique for determine the gender. SRY gene is male specific gene and used
to indicate male genotype. We sought to develop the new method to determine gender by using LAMP technique
from fresh blood sample and blood stained sample. DNA templates from fresh blood samples were extracted and
added in LAMP reaction. DNA from blood stained samples on filter papers and cloths were crude extracted and
also added in LAMP reaction. Blood stained samples in filter and cloths were stored in room temperature for 0,1,
7, 14, 30 and 45 days. After that, these samples were crude extracted and followed with LAMP technique. Sex
determination was achieved with LAMP technique of fresh blood samples and both blood stained samples on filter
papers and cloths. LAMP products showed smear band only in male sample. LAMP products of samples from
blood stained on filter paper that kept in room temperature for 7 days were detected while as LAMP products of
samples from blood stained on cloth that stored in room temperature for 30 days were showed smear band. We
have developed LAMP method to amplify SRY gene from fresh blood samples and blood stained samples on filter
paper and cloth for determine the gender. Blood stained samples on cloth are more sustain longer than on filter
paper.
Keywords
:
Sex determination ,Loop-mediated isothermal amplification, LAMP, SRY gene, Blood
stained sample
1.
Introduction
Sex determination from biological specimens gathered from crime scenes is very important in criminal
investigations [1]. Sex determination is the first step for person identification in forensic science. In general, the
sexual determination of unidentified body can be indentified based on anatomical characteristics of the external
genitalia or the gonads are ovaries or testes. Bones and teeth are used to sex determine in markedly decayed or
skeletonized bodies [2]. The molecular biological method for sex determination based on polymerase chain
reaction (PCR) has been used to determine sex especial in forensic DNA evidence [3]. The sex-determining
region Y or SRY gene on the Y chromosome is used for sex determination [4, 5] . In mammals, the inducing of
male sex determination required the Y-chromosome gene SRY. SRY encodes a protein with a central high
mobility group domain (HMG) of about 78 amino acid.[6]. Methods for sex determination using PCR for
amplification SRY gene have also been reported [4, 5]. These methods can indicated a male genotype by the
presence of the amplified product of SRY gene.
Recently, loop-mediated isothermal amplification (LAMP) has become an interesting alternative to
PCR for rapid and sensitive detection. Furthermore, LAMP has been developed and used for sex determination
of bovine embryo, female calves, salmon and Columbidae bird [7-9]. This method involved amplification of
DNA targets under isothermal conditions in the temperature range 60C-65C for 60 minutes [10]. Two sets of
primer , inner primer and outer primer sets used in LAMP were specific at six different areas located within the
target sequence and primary DNA
amplification was begun by the inner primer set. The characteristic
intermediary DNA structure formed by LAMP, called a stem-loop DNA fragment, was generated and large
amounts of DNA products were produced by an auto-cycle reaction[8].
Therefore, the objective of this study was to determine the human gender form fresh blood and blood
stained on filter paper and on cloth by using LAMP technique. A major advantage of our method is more faster,
more sensitive and inexpensive method for sexual determination. Another advantage is usage this technique in
crime scenes.
2.
Objective
Sex determination of the source of forensic DNA evidence is an importance step in crime investigation.
LAMP method is a novel molecular technique for determine the gender. SRY gene is male specific gene
and used to indicate male genotype. We sought to develop the new method to determine gender by using
LAMP technique from fresh blood sample and blood stained sample.
3.
Material and Methods
Materials
DNA polymerase and chemical reagents were purchased from New England Biolabs and Sigma
chemical. There were of high quality commercially available. Nucleospin-blood extraction kit was obtained
from Macherey-Nagel, Germany. The 1 Kb DNA ladder was from New England Biolabs.
Template preparation
Genomic DNA from fresh blood samples were extracted with Nucleospin-blood extraction kit. One
drop of blood samples were spread to filter paper and cloth then let them dried and kept in room temperature.
LAMP primer design
The design of the LAMP primers was based on a Homo sapiens SRY gene (GenBank accession No.
JQ811934). The PrimerExplorer V4 software available on the Eiken Chemical Co.Ltd., website
(http://primerexplorer.jp/e/) was used to design F3, B3, FIP and BIP primers that shown in Table 1.
Table 1 Primer sequences used for LAMP amplification
Sequence (5’-3’)
Primer
F3
AACAGTAAAGGCAACGTCCA
B3
TCTCTGTGCATGGCCTGTA
FIP
CCATCTTGCGCCTCTGATCGCTTTTAGAGTGAAGCGACCCATGAA
BIP
AGAGATCAGCAAGCAGCTGGGTTTTAGAATGGCCATTTTTCGGCT
LAMP reactions and analysis
All reactions were carried out in 25 µl of 1XBst DNA polymerase buffer containing 5 mM MgSO 4, 400
mM betaine, 1.2 mM dNTPs, 0.8 µM F3 and B3 primers, 2 µM FIP and BIP primers, and 8 U Bst DNA
polymerase (New England Biolabs). As template, 1 µl or 5 ng of each DNA from Nucleospin-blood extraction
kit was used. Reactions were incubate at 65C for 45 min and followed by enzyme inactivated at 80C for 5
min. The LAMP products were analyzed by loading 10 µl of reaction products on 1.5% agarose gel. Also, after
gel electrophoresis, agarose gel was stained with ethidium bromide and visualized under an ultraviolet light.
The blood stained samples on filter papers or cloths were cut in to small pieces and added 100 µl of
Red blood cell lysis buffer (RBC buffer) that contained 10% W/V sucrose, 10% Trition X-100 and 5mM MgCl2.
The 2 µl of proteinase K was also added in this reaction and incubated at 56 C for 2 h then inactivated enzyme
at 95C for 5 min. The supernatant was taken in 1.5 ml microcentrifuge tube. After adding
Phenol:Chloroform:Isoamyl alcohol (25:24:1) (Sigma) at ratio 1:1, the reactions was centrifuged at 10,000 X g
for 10 min. Then the upper solution was taken and added with isopropanol (Sigma) at equal volumn. The
solution was centrifuged at 10,000 X g for 10 min and discarded the supernatant . The DNA pellet was washed
with 70% ethanol and centrifuged at 10,000 x g for 10 min. . After that the pellet was air dried and suspended
with 20 µl of sterile distilled water.
The crude extraction of DNA from blood stained sample were used in LAMP reaction. The condition
of LAMP reactions were carried out 25 µl like DNA from fresh blood sample.
For time course detection in both blood stained samples on filter papers and on cloths, the blood
stained samples were stored for 0,1,7,14 and 30 days in room temperature. Then the cut blood stained samples
into small pieces and took one small piece of these samples to extract DNA. After that these samples were used
in LAMP amplification.
4.
Results
LAMP reactions and analysis
For sex determination, the amplified products were detected only in male blood sample. Fig.1 showed
the electrophoresis of LAMP reaction of fresh blood samples. In Fig.1, lane 1 and 2 (male samples) showed
smear band but lane 3 (female sample) showed no smear bands. It indicated that LAMP amplification of this
experiment was specific only male samples. For blood stained samples on filter papers that show in Fig.2, male
samples in both lane 1 and 2 showed smear bands after LAMP reaction. But there was no smear band in lane 3
that form female sample. As same as in Fig.3 that showed LAMP products from blood stained samples on
cloth. Lane 1 and 2 that male samples, showed smear band as same as in fresh blood samples and blood stained
samples on filter papers in Fig.1 and 2. The smear band did not occur in lane 3 (female sample). These results
indicated that the LAMP technique for sex determination can be use for blood stained samples on many
materials such as on filter paper or on cloth.
For time course detection of blood stained samples on filter paper, the result showed in Fig.4. It was a
gel electrophoresis of LAMP product of blood stained samples on filter paper in various time. LAMP products
can be detected within 7 days. But there was not any band in lane 4 or within 14 days. Time course detection of
blood stained samples on cloth was shown in Fig.5. It shows gel electrophoresis of LAMP product of blood
stained samples on cloth in various time. The LAMP products had appeared for 30 days. After 30 day, there
was no any bands. From these results shows that DNA from blood stained samples on cloth are sustained longer
than in filter paper.
Fig.1 Agarose gel electrophoresis of LAMP products from fresh blood samples. Lane M is FastRuler Middle
Range DNA ladder. Lane 1 and 2, fresh blood samples from male No.1 and No.2. Lane 3 , fresh blood sample
from female.
Fig.2 Agarose gel electrophoresis of LAMP products from blood stained samples on filter paper. Lane M is
FastRuler Middle Range DNA ladder. Lane 1 and 2, blood stained samples from male No.1 and No.2. Lane 3 ,
blood stained sample from female.
Fig.3 Agarose gel electrophoresis of LAMP products from blood stained samples on cloth. Lane M is FastRuler
Middle Range DNA ladder. Lane 1 and 2, blood stained samples from male No.1 and No.2. Lane 3 , blood
stained sample from female.
Fig.4 Agarose gel electrophoresis of LAMP products from blood stained samples on filter paper of various
time. Lane M is 100 bp DNA ladder. Lane 1-4 are dry blood samples on filter paper that stored in room
temperature for 0,1,7 and 14 days, respectively.
Fig.5 Agarose gel electrophoresis of LAMP products from blood stained samples on cloth of various time. Lane
M is 100 bp DNA ladder. Lane 1-6 are dry blood samples on filter paper that stored in room temperature for
0,1,7,14, 30 and 45 days, respectively.
5.
Discussion
Current molecular technique for sex determination is mainly PCR of SRY gene [11-14]. But LAMP is
a novel technique for sex determination. This technique was developed by Notomi et al.[10] for decade ago. It
is involved 4 specific primers based on 6 specific sequences on the target gene. This process takes about one
hour and uses one constant temperature in the presence of Bst DNA polymerase[10]. It generates the smear
band. LAMP technique is highly easy ,fast, sensitive and specific. Moreover, this technique does not require
any specific reagents or equipment to perform. In addition, the amplification results can be evaluated by
electrophoresis or fluorescent dye stain. Nowadays, it has been also used to detect of infectious disease, foodborne bacteria, virus and parasites [15-18]. However, there have been no reports on the application of LAMP
method in this study can determine sex in blood stained samples on filter paper and cloth.
Blood stained sample is the common evidence that found in crime scene. In real crime scene, blood
stained sample is usually found and difficult to determine sex. Nevertheless, LAMP technique in this study can
get rid of this hindrance. Anticoagulant is needless for blood stained samples. RBC buffer in this method is
used to dissolve blood stained s from filter paper or cloth after that proteinase K lyses membrane of white blood
cell. Then DNA from cells is purified and precipitated before using in LAMP reaction.
In comparison to blood stained on filter paper, LAMP products of blood stained samples on filter paper
are detected within 7 days while LAMP products of dry blood samples on cloth have appeared for 1 month. This
result shows the DNA stability of blood stained samples on cloths are longer than blood stained samples on
filter paper.
Determining the sex of the source of forensic DNA sample at times can be informative in various
forensic investigations, especially in sexual assault cases. With focusing objective of this study for sex
determination from blood stained sample on filter paper and cloth, the present work can be used for blood
stained collected evidences in crime scene.
6.
Conclusion
Sex determination was achieved with LAMP technique of fresh blood samples and both blood stained
samples on filter papers and cloths. LAMP products showed smear band only in male sample. LAMP products
of samples from blood stained on filter paper that kept in room temperature for 7 days were detected while as
LAMP products of samples from blood stained on cloth that stored in room temperature for 30 days were
showed smear band. Further step of this technique will use direct blood or fresh blood without DNA extraction
step before LAMP reaction for more rapid and simplify detection.
7.
Acknowledgements
We thank Assist.Prof. Dr. Busaba Pipitaporn and Dr.Ratchanok Kumsiri at Pathology unit, faculty of
Science, Rangsit University, for their support in blood sample collection. This work supported by a grant of
Biochemistry unit, faculty of Science, Rangsit University.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
von Wurmb-Schwark, N., H. Bosinski, and S. Ritz-Timme, What do the X and Y chromosomes tell us
about sex and gender in forensic case analysis? J Forensic Leg Med, 2007. 14(1): p. 27-30.
Murakami, H., et al., Forensic study of sex determination using PCR on teeth samples. Acta Med
Okayama, 2000. 54(1): p. 21-32.
Kastelic, V., B. Budowle, and K. Drobnic, Validation of SRY marker for forensic casework analysis. J
Forensic Sci, 2009. 54(3): p. 551-5.
Santos, F.R., A. Pandya, and C. Tyler-Smith, Reliability of DNA-based sex tests. Nat Genet, 1998.
18(2): p. 103.
Thangaraj, K., A.G. Reddy, and L. Singh, Is the amelogenin gene reliable for gender identification in
forensic casework and prenatal diagnosis? Int J Legal Med, 2002. 116(2): p. 121-3.
Whitfield, L.S., R. Lovell-Badge, and P.N. Goodfellow, Rapid sequence evolution of the mammalian
sex-determining gene SRY. Nature, 1993. 364(6439): p. 713-5.
Hirayama, H., et al., Rapid sex chromosomal chimerism analysis in heterosexual twin female calves by
Loop-mediated Isothermal Amplification. Anim Reprod Sci, 2007. 101(1-2): p. 38-44.
Zhang, Z.P., et al., Codeposition of dNTPs detection for rapid LAMP-based sexing of bovine embryos.
Reprod Domest Anim, 2009. 44(1): p. 116-21.
Chan, K.W., et al., A novel loop-mediated isothermal amplification approach for sex identification of
Columbidae birds. Theriogenology. 78(6): p. 1329-38.
Notomi, T., et al., Loop-mediated isothermal amplification of DNA. Nucleic Acids Res, 2000. 28(12):
p. E63.
Luptakova, L., et al., Sex determination of early medieval individuals through nested PCR using a new
primer set in the SRY gene. Forensic Sci Int. 207(1-3): p. 1-5.
Hanley, N.A., et al., SRY, SOX9, and DAX1 expression patterns during human sex determination and
gonadal development. Mech Dev, 2000. 91(1-2): p. 403-7.
Finch, J.L., R.M. Hope, and A. van Daal, Human sex determination using multiplex polymerase chain
reaction (PCR). Sci Justice, 1996. 36(2): p. 93-5.
Sato, Y., et al., Proteomics and transcriptome approaches to investigate the mechanism of human sex
determination. Cell Biol Int, 2009. 33(8): p. 839-47.
Maruyama, F., et al., Detection of bacteria carrying the stx2 gene by in situ loop-mediated isothermal
amplification. Appl Environ Microbiol, 2003. 69(8): p. 5023-8.
Yoshikawa, T., et al., Detection of human herpesvirus 7 DNA by loop-mediated isothermal
amplification. J Clin Microbiol, 2004. 42(3): p. 1348-52.
Ikadai, H., et al., Molecular evidence of infections with Babesia gibsoni parasites in Japan and
evaluation of the diagnostic potential of a loop-mediated isothermal amplification method. J Clin
Microbiol, 2004. 42(6): p. 2465-9.
Song, L., et al., Establishment of loop-mediated isothermal amplification (LAMP) for rapid detection of
Brucella spp. and application to milk and blood samples. J Microbiol Methods. 2012. 90(3): p. 292-7.