Genomic DNA Extraction
Extract DNA from sample.
 DNeasy Blood and Tissue Kit (Qiagen, #69504 (50 reactions; $135) or #69506 (250
reactions; $583))
1.
2.
Follow kit instructions for genomic DNA extraction. DO include the treatment with RNase
A. Elute in two steps, with 200 L AE for the first elution and 100 L AE for the second.
Combine the two elutions. 25 individuals should yield 10-20 g of DNA, which is enough
for 2-4 genomic library preps. For maximal DNA recovery, digest overnight with
proteinase K. Increasing the amount of starting material will not linearly increase the
amount of recovered DNA (25 mg is the maximum amount of starting tissue recommended
for this kit).
Quantify DNA concentration with Nanodrop.
Shear DNA
Shear DNA to optimal fragment size.
 5 g genomic DNA
 MinElute PCR Purification Kit (Qiagen, #28004 (50 reactions; $108) or #28006 (250
reactions; $495))
1.
2.
3.
4.
Bring total volume of DNA sample to 150-200 L with AE (the elution buffer used for
genomic DNA extraction).
Sonicate DNA to shear. You should optimize the timing based on whatever system you’re
using. A good place to start is to sonicate for 3 cycles, with each cycle being 15 minutes of
[20 seconds on, 1 minute off]. I found this to be optimal for generating the most fragments
of ~200 bp in size, the ideal fragment size for Illumina sequencing.
Run 10 L of sheared product on a 2% agarose gel to ensure DNA has been fragmented
successfully.
Add 5 volumes Buffer PB (750-1000 L, depending on volume of sonicated sample) to
remaining sheared DNA and mix. Place a MinElute column in a collection tube. Transfer
650 L DNA solution to MinElute column, and centrifuge for 1 min at 13,000 rpm to bind
DNA. Discard flow-through, and place column back in collection tube. Transfer remaining
DNA solution to MinElute column, and centrifuge for 1 min at 13,000 rpm to bind
remaining DNA. Discard flow-through, and place column back in collection tube. Add 750
L Buffer PE to column, and centrifuge for 1 min at 13,000 rpm. Discard flow-through,
and place column back in collection tube. Centrifuge again for 1 min at 13,000 rpm. Place
MinElute column in a clean 1.5mL tube. Add 20 L Buffer EB to membrane, let column
stand for 1 min, and centrifuge for 1 min at 13,000 rpm. Add additional 16 L Buffer EB to
membrane, let column stand for 1 min, and centrifuge for 1 min at 13,000 rpm. Save flowthrough.
End Repair
Create blunt ends on DNA.
 Sample DNA, ~34L
 End-It DNA End-Repair Kit (Epicentre Biotechnologies, #ER0720 (20 reactions; $90) or
#ER81050 (50 reactions; $200))

MinElute PCR Purification Kit (Qiagen, #28004 (50 reactions; $108) or #28006 (250
reactions; $495))
1. Add 5 L End-Repair 10X Buffer, 5L dNTP mix, 5L ATP, and 1L End-Repair Enzyme
Mix to 34 l eluted DNA. Incubate at room temperature for 45 minutes.
2. Add 250 L Buffer PB to end-repaired DNA. Place a MinElute column in a collection tube.
Transfer DNA solution to MinElute column, and centrifuge for 1 min at 13,000 rpm. Discard
flow-through, and place column back in collection tube. Add 750 L Buffer PE to column,
and centrifuge for 1 min at 13,000 rpm. Discard flow-through, and place column back in
collection tube. Centrifuge again for 1 min at 13,000 rpm. Place MinElute column in a clean
1.5mL tube. Add 20 L Buffer EB to membrane, let column stand for 1 min, and centrifuge
for 1 min at 13,000 rpm. Add additional 14 L Buffer EB to membrane, let column stand for
1 min, and centrifuge for 1 min at 13,000 rpm. Save flow-through.
Add Single A Base
Use Klenow 3 to 5 exo- to add single A base overhang to DNA.
 Eluted DNA with blunt ends, ~32L
 Klenow 35 exo- (comes supplied with 10X NEBuffer 2) (New England BioLabs,
#M0212S (200 units; $56) or #M0212L (1000 units; $224))
 dATP (New England Biolabs dNTP set, #N0446S, $150)
 MinElute PCR Purification Kit (Qiagen, #28004 (50 reactions; $108) or #28006 (250
reactions; $495))
1. Add 3 L Klenow 3’5’ exo-, 5 L 10X NEBuffer 2, and 10 L 1 mM dATP to eluted
DNA. Incubate at 37C for 30 mins.
2. Add 250 L Buffer PB to sample. Place a MinElute column in a collection tube. Transfer
DNA solution to MinElute column, and centrifuge for 1 min at 13,000 rpm. Discard flowthrough, and place column back in collection tube. Add 750 L Buffer PE to column, and
centrifuge for 1 min at 13,000 rpm. Discard flow-through, and place column back in
collection tube. Centrifuge again for 1 min at 13,000 rpm. Place MinElute column in a clean
1.5mL tube. Add 11 L Buffer EB to membrane, let column stand for 1 min, and centrifuge
for 1 min at 13,000 rpm. Add additional 11 L Buffer EB to membrane, let column stand for
1 min, and centrifuge for 1 min at 13,000 rpm. Save flow-through.
Adaptor Ligation
Ligate Illumina sequencing adaptor to DNA with A-tail.
 Eluted DNA with A-tail, ~20 L
 Sequencing adaptor (already annealed)
 T4 DNA Ligase (Rapid)* (comes supplied with 2X DNA Ligase Buffer) (Enzymatics,
#L603-HC-L, $350)
*5l (3000units) of UltraPure Ligase from enzymatics (Enzymatics T4 DNA Ligase (Rapid)
L603-HC-L 240,000 total units @ 600,000 U/mL)--expensive, but this is good, it lacks
contaminating exonucleases that are often found in T4 ligases. See Quail, Dec 2008 Nature
Methods.
1. Add 25 L 2X DNA Ligase Buffer, 0.25 L 50 M sequencing adaptor, and 5 L T4 DNA
Ligase, to eluted DNA. Incubate sample at room temperature for 15 mins.
2. Add 250 L Buffer PB to sample. Place a MinElute column in a collection tube. Transfer
DNA solution to MinElute column, and centrifuge for 1 min at 13,000 rpm. Discard flowthrough, and place column back in collection tube. Add 750 L Buffer PE to column, and
centrifuge for 1 min at 13,000 rpm. Discard flow-through, and place column back in
collection tube. Centrifuge again for 1 min at 13,000 rpm. Place MinElute column in a clean
1.5mL tube. Add 15 L Buffer EB to membrane, let column stand for 1 min, and centrifuge
for 1 min at 13,000 rpm. Save flow-through.
Gel Purify
Size-select DNA templates using gel extraction.
 Eluted DNA with adaptors, ~10uL
 2% agarose gel in 1X TAE Buffer
 100 bp DNA ladder (Invitrogen, #15628-019 (50 g, $99) or #16628-050 (250 g, $361))
 SYBR Gold nucleic acid gel stain (Invitrogen, #S-11494, $122)
 1X TAE
 GeneCatcher disposable gel excision tips (Gel Company, #PKB6.5, $62)
 QIAquick Gel Extraction Kit (Qiagen, #28704 (50 reactions, $99) or #28706 (250
reactions, $464))
1. Load 1 L of ladder in each of the outermost wells. Load 10 L of each sample in gel,
leaving 1-2 (depending on well size) empty wells between each sample. Run at 80V for 90
mins or until sufficient separation of 100bp and 200bp bands of ladder is reached.
2. Warm SYBR Gold to room temperature, and briefly centrifuge to deposit DMSO at bottom
of vial. Dilute SYBR Gold 10,000-fold in 1X TAE to make 1X solution (e.g., 10 L in 100
mL TAE). Place gel and SYBR Gold in staining pan, and cover with aluminum foil.
Incubate at room temperature for 30 mins on agitator.
3. Use DarkReader (avoid UV light exposure) to visualize gel. Cut out gel slice at 200 bp (+/25 bp) using GeneCatcher tip. Weigh empty 1.5mL Eppendorf tube. Place gel slice in 1.5 mL
tube. Weigh tube and gel slice, and calculate weight of gel slice.
4. Add 3 volumes Buffer QG to 1 volume of gel (e.g., 300 L Buffer QG to 100mg gel).
Incubate at ROOM TEMPERATURE (avoids melting AT rich DNA—see Quail, Dec 2008
Nature Methods) for as long as it takes to dissolve the gel, vortexing tube every 2-3 mins.
Mixture should be yellow. If mixture is orange or violet, add 10uL 3M NaOAc, pH 5.0.
5. Add 1 gel volume isopropanol to sample and mix (e.g., 100 L isopropanol for 100 mg gel).
6. Place QIAquick spin column in 2 mL collection tube. Apply sample to column and
centrifuge for 1 min at 13,000 rpm. Discard flow-through and place column back in
collection tube. Add 500 L Buffer QG to column and centrifuge for 1 min at 13,000 rpm.
Discard flow-through and place column back in collection tube.
7. Add 750 L Buffer PE to column, let sit for 5 mins, and centrifuge for 1 min at 13,000 rpm.
Discard flow-through, and place column back in collection tube. Add additional 500 L
Buffer PE to column, let sit for 5 mins, and centrifuge for 1 min at 13,000 rpm. Discard flow-
through and place column in a clean 1.5 mL tube. (Incubation with PE longer than suggested
and multiple washes are to rid the sample of the chaotropic salts that absorb at 230).
8. To elute DNA, add 20 L Buffer EB, let stand for 1 min, and centrifuge for 1 min at 13,000
rpm. Add additional 10 L Buffer EB, let stand for 1 min, and centrifuge for 1 min at 13,000
rpm.
PCR Enrichment of Purified DNA Templates
Use PCR to amplify DNA templates with ligated adaptors. This protocol yields ~300 ng DNA
per PCR reaction. This is more than sufficient for a single lane of Illumina sequencing. For chipcapture, you need 1-3 g of DNA. If you are not barcoding, then you should do 5-6 PCR
reactions per sample and combine the PCR products together. If you are barcoding, depending on
how many samples you’re pooling for chip-capture, you can do fewer PCR reactions. For 12
different barcoded libraries to be combined into a single chip-capture run, do 2 PCR reactions
per library prep and combine those 2 PCR reactions together for cleanup.









DNA Template, 1 L
PCR primer long (order from IDT or Operon, see below)
PCR primer short (order from IDT or Operon, see below)
Phusion polymerase (comes supplied with 5X Phusion HF Buffer) (New England
BioLabs, #F-530S (100 units; $103) or #F-530L (500 units, $412))
AMPureXP Kit (Agencourt, #A63880 (5 mL, $199) or #A63881 (60 mL, $700))
8% Acrylamide gel
100 bp DNA ladder (Invitrogen, #15628-019 (50 g, $99) or #16628-050 (250 g, $361))
SYBR Gold nucleic acid gel stain (Invitrogen, #S-11494)
Magnet stand (Promega, #Z5332 (two-position, $41) or #Z5342 (twelve-position, $142)
1. Allow AMPure beads to come to room temperature. Vortex beads to resuspend. Add 90 L
of AMPure beads to gel-extracted DNA. Mix by pipetting and vortex briefly. Incubate
sample at room temperature for 5 mins. Place tube on magnetic stand and let sit for >10
mins. When solution is clear, pipette off solution and discard. Add enough 70% EtOH to
cover beads (>200 L). Incubate for 30 sec at room temperature, and pipette off EtOH.
Repeat EtOH wash. Ethanol washes should be performed on the magnetic stand, and the 70%
ethanol solution should be made fresh for best results.
2. Allow beads to air dry for 20 mins at room temperature off of magnetic stand (or at 37
degrees for ~10 minutes). Add 30 L of EB and vortex. Place tube on magnet stand, wait
until solution is clear, then remove solution to clean tube (this solution is your template DNA
for the PCR reaction).
3. Mix 1 L template, 10 L 5X Phusion HF Buffer, 3 L 10 mM (total; 2.5 mM each dNTP)
dNTP mix, 0.25 L of each (100 M) PCR primer, 0.5 L Phusion polymerase, and 35 L
water in thin-wall PCR tube. Run PCR:
 98C 30 sec
 13 total cycles:
o 98C 10 sec
o 65C 30 sec
o 72C 30 sec
4.
5.
6.
7.
8.
 72C 5 mins
 4C hold
Allow AMPure beads to come to room temperature. Vortex beads to resuspend. Add 90 L
of AMPure beads to PCR-amplified DNA. Mix by pipetting and vortex briefly. Incubate
sample at room temperature for 5 mins. Place tube on magnetic stand and let sit for >10
mins. When solution is clear, pipette off solution and discard. Add enough 70% EtOH to
cover beads (>200 L). Incubate for 30 sec at room temperature, and pipette off EtOH.
Repeat EtOH wash two additional times. Ethanol washes should be performed on the
magnetic stand, and the 70% ethanol solution should be made fresh for best results.
Allow beads to air dry for 20 mins at room temperature off of magnetic stand (or at 37
degrees for ~10 minutes). Add 30 L of EB and vortex. Place tube on magnet stand, wait
until solution is clear, then remove solution to clean tube (this solution is your library!).
Quantify 2 L of cleaned PCR product on NanoDrop, and run same aliquot an 8% Native
acrylamide gel with 100 bp ladder. Run at 100 V for 90 mins. Stain with 1:10,000 dilution of
SYBR Gold, and visualize (on Dark Reader or on transilluminator).
There may be a gel band below 100 bp, which is probably the result of primer dimers or
priming of adaptors. If there is a band below 100 bp, run entire sample on a 2% gel with 100
bp ladder (make sure that there are at least 1-2 empty wells between each sample). Stain with
1:10,000 dilution of SYBR Gold, and visualize on Dark Reader (avoids UV light exposure).
Extract region around 200bp (+/- 25bp) using GeneCatcher. Use QIAquick Gel Extraction kit
as described previously, but wash three times with Buffer PE (750uL, 500uL, and 500uL—
gets rid of chaotropic salts). Elute in two steps (with 20 L Buffer EB, then 10 L Buffer
EB). Quantify 2 L of sample on NanoDrop, and reuse aliquot to run on an acrylamide gel.
Band below 100 bp should be greatly reduced. If not, repeat gel extraction procedure.
If you do not see a discrete band just below 100 base pairs, then you can use the AMPureeluted DNA directly.
Quantify DNA
Picogreen assay is used to measure concentration of DNA. If barcoding is not being performed,
quantifying DNA using Nanodrop is sufficient. If combining multiple libraries in equal
concentrations, use picogreen assay.
 1X TE
 96 well black microtiter plate (Costar #3915, $355)
 Quant-It PicoGreen dsDNA Assay kit (Invitrogen, #P11496, $362)
1. Create 25 L of a dilution of each sample DNA – 2 L DNA and 23 L of 1X TE.
2. Make a serial dilution of the concentration standard (DNA standard is provided in the kit).
Start with 100 L ~5 ng/L DNA and create 1/2 dilutions down to <0.5 ng/L (e.g., 5 ng/L,
2.5 ng/L, 1.25 ng/L, 0.625 ng/L, 0.3125 ng/L, 0.15625 ng/L). You should have 50+
L of each concentration in the serial dilution. You can do this by making 100 L of the ~5
ng/L solution, transferring 50 L to a tube containing 50 L 1X TE, transferring 50 L of
that to a tube containing 50 L 1X TE, etc.
3. Add 25 L of each concentration of the serial dilution to column 1 of a black microtiter plate.
Add 25 L of 1X TE to the next empty well in that column (probably well G1). Repeat for
column 2 in the microtiter plate. Add the dilutions of samples to any of the remaining wells.
4. Create 1/200 dilution of PicoGreen in 1X TE. Add 25 L of diluted PicoGreen to each well
in microtiter plate containing serial dilution standard, blank, or sample. Centrifuge briefly,
and make sure the solution covers the bottom of the well completely. If adhesion and
cohesion have kept the solution to one side of the well, take a pipette tip and spread the
solution around so it covers the bottom of the well. This is critical—if the solution doesn’t
cover the bottom of the well, the readings will be unreliable.
5. Quantify fluorescence on spectrofluorometer (excitation at 485 nm, emission at 535 nm if
using the Buckler lab spectrofluorometer, 490 nm and 525 nm if using the Clark lab
spectrofluorometer). Graph fluorescence against concentration for the serial dilution. Use
equation of the regression line to determine concentration of DNA samples.
The picogreen reagent is light sensitive, so keep it covered. Upon receipt, I aliquot it into 10 L
aliquots and wrap those aliquots in foil. Each aliquot can be thawed once. If all 10 L are not
required for the assay, throw the unused picogreen away.
Adaptor and Primer Sequences
Adaptors:
5’ P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG 3’
(5’ end phosphorylated for ligation and HPLC purified)
5’ ACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3’
(phosphorothioate bond between C & T at 3’ end and HPLC purified)
PCR primers:
5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGAT
CT 3’
(PAGE purified)
5’ CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT 3’
(standard desalting)
Sequencing primer:
5’ ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3’
provided by the facility
General Notes
1. Any DNA extraction kit can be used for the first step. I used Qiagen, so I provided the
details of the methodology that worked for me for this kit.
2. DNA can be sheared using sonication or nebulization or a Covaris instrument. AFA
(Covaris) is the best, but it is not required. If a Covaris is not available, sonication is
preferable to nebulizing because of reduced sample loss, and a tighter distribution of
fragment sizes in the desired range. If nebulizing, you need to buy the disposable
nebulizing units. They cost approximately $25 each.
3. This protocol is for single-end sequencing. If you are performing paired end sequencing,
there are likely to be several changes that need to be made. One issue in particular is that
of concatamers, which can account for up to 5% of your final reads (Quail Nature
Methods 2008). You can perform a gel extraction prior to adaptor ligation in addition to
the one after ligation, and any concatamers should be separated out in the second gel
extraction.
4. This protocol yields ~200-300 ng DNA per PCR reaction. This is more than sufficient for
a single lane of Illumina sequencing. For chip-capture, you need 1-3 g of DNA. If you
are not barcoding, then you should do 5-6 PCR reactions per sample and combine the
PCR products together. If you are barcoding, depending on how many samples you’re
pooling for chip-capture, you can do fewer PCR reactions. For 8-12 different barcoded
libraries to be combined into a single chip-capture run, do 2 PCR reactions per library
prep and combine those 2 PCR reactions together for cleanup.
5. The volume of AMPure beads described for the post-PCR cleanup is for a 50 L PCR
reaction. If combining multiple PCR reactions together, change the volume of AMPure
beads used. 2 PCR reactions require 180 L AMPure beads, for instance—check the
product literature to find the appropriate volume required.
6. The bead cleanup steps were optimized for AMPure beads, which are no longer available
at Agencourt (the 5 mL size is already discontinued, and the 60 mL size is only available
until their current supply runs out, which could be soon). The new product, AMPureXP,
is an ‘improvement’ in that it binds to smaller (< 100 bp) products more efficiently, and
binds to single-stranded DNA (in addition to double stranded DNA). With respect to
library preparation, these are both bad things. Some additional tweaking may be required
for these steps with this new product.
7. The bead cleanup step before PCR amplification was added because the amount of
adapter being used in the adapter ligation step is too high. I ran out of time before I could
optimize this concentration, and instead opted for the additional cleanup step. We know
that 0.5 L of a 1 M stock is not nearly enough, and 0.25 L of a 50 M stock is too
high. There could be an optimal amount between these two bounds that would obviate the
need for the bead cleanup step immediately following the gel-extraction. The cleanup
step post-PCR will still always be required, however.
8. The Illumina protocol suggests a Qiagen column-based cleanup post-PCR. I’ve found
that the beads, while more cumbersome, are SO much better at removing the super small
stuff than the columns, and the yield is much higher than column-based approaches. I
would recommend sticking with the AMPure beads.
9. This protocol is based on Mike Guertin’s protocol for cDNA library preparation. I have
optimized most of the steps for genomic DNA library prep, but he deserves much of the
credit for the protocol and the written version of the protocol.
10. If you purchase your own adapters, you need to anneal each adapter pair together prior to
the adapter ligation step. I reconstitute my oligos in water (they can be reconstituted in
other things, too, obviously—the Lis lab uses 10 mM Tris (pH 7.9)) to a concentration of
100 M. To anneal, take 10 L of each oligo and mix them together in an Eppendorf
tube. This solution is still 100 M. Bring a beaker with water to a boil on a heat plate.
Place Eppendorf tube containing oligos in boiling water for two minutes. Remove beaker
(with tubes in it) from heat source and allow to cool to room temperature. Freeze for
storage. This slow cooling process is key, so don’t rush it. This solution is now 50 M,
which is the concentration used in the above protocol.
11. The 100 bp ladder suggested is just a suggestion. Use whatever you have—all that’s
required is that you can distinguish 100 from 200 from 300 bp in size.