Amplification of the D-loop in mtDNA by PCR
Overview: You are sequencing the D-loop of mitochondrial DNA (mtDNA). mtDNA
replication begins here. It is a non-coding region that is highly variable (though there are
some conserved regions). Many population genetics and evolutionary studies examine the
D-loop (because of its variability).
Goal: Use polymerase chain reaction (PCR) to make many copies of the mtDNA D-loop of
your sample of interest.
1. Prepare the tubes. Label the side of one Ready-To-Go PCR tube for each PCR
reaction you are setting up.
2. For every reaction you are going to do, you will need:
Contents
Ready-To-Go PCR
Bead
19 ul dH2O
Purpose
Provides dNTPs (DNA building blocks), puReTaq DNA
polymerase, reaction buffer (gives a stable reaction
environment), and MgCl2 (an important DNA
polymerization cofactor)
Resuspends the PCR bead and brings reaction to total
volume of 25 ul
Sequence: TCCCATTAGCACCCAAAG
2.0 ul forward
primer
2.0 ul reverse
Sequence: GCCGTCTAAACATTTCAGTC
primer
2.0 ul DNA
Provides your template to copy
sample
25 ul Total Volume
3. Pipette the dH2O into the PCR tube, followed by the forward and reverse primer,
and finally the DNA sample.
4. Mix tube contents. Snap the lid shut. Mix the tube contents by placing on the vortex
machine for 2-3 seconds. If contents are all over the tube, spin or shake liquid to the
bottom of the tube. Keep on ice if you can begin the thermocycler immediately.
5. Place in thermocycler and begin program. This program makes millions of copies of
your target sequence by melting the DNA strands apart at high temperature,
copying them at lower temperature, and repeating the process for 40 cycles.
Initial
40 cycles
Hold
95C for 4-5
min
95C for 30 sec
60C for 30 sec
72C for 30 sec
4C
Initial denaturation of genomic DNA
Denaturation of DNA fragments
Annealing step (primers bind to DNA)
Extension step (polymerase copies DNA)
Keeping PCR product cool until ready to use