Supplementary methods and Figures
Animal experiments
C57BL/6J mice were from Janvier, Germany, and kept in pathogen-free conditions. All animal experiments were approved by the local ethical committee and performed according to their guidelines and the German law for protection of animals. Female C57BL/6J mice were used as recipients, and isogenic male mice as cell donors. Recipient mice were conditioned 24 h before transplantation by myeloablative irradiation (10 Gy). Cells were transplanted by tail-vein injection. For secondary transplantation of #483 T-ALL, animals were sublethally irradiated (7.5 Gy) and 10 6 T-ALL blasts were injected into the tail-vein.
Cell culture, inhibitor assays, flow cytometry
T-ALL clones were established by dissociating the infiltrated thymus or bone marrow from diseased mice. Some clones (#1065,#007,#003) were cultivated on OP9 DL1 cells 1 in RPMI (10% FBS) for two weeks prior to further feeder-free cultivation in suspension. Aliquots were frozen at this point. The other clones were directly established in a feeder free culture. For further analysis, T-ALL fresh aliquots were thawed and kept in culture for no longer than 2 weeks.
The MOHITO cell line has been described 2 and was cultured in RPMI 1640 containing 20% FCS and supplemented with 1 ng/ml murine IL7 and 0.5 ng/ml human IL2 for propagation and the competition-,
BrdU- and ribosome profiling experiments. For the signal transduction experiments MOHITO cells were washed 3 times in PBS and cultured in cytokine free RPMI 1640 + 2% FCS for 5 hrs before lysis. For Gamma-Secretase inhibition10

M DAPT was added 60 hrs before lysis. dTrkA + or PTEN k.d.
MOHITO were established by infection of MOHITO cells with either pRSF91.dTrkA.IRES.EGFP, pRSF91.dTomato.miR30.PTEN.1523 or both with an MOI (multiplicity of infection) of 5. Infected cells were FACS- sorted two days after transduction. For the competition assays three independent experiments were performed by combining wt-MOHITO, dTrkA + - MOHITO, PTEN k.d.
- MOHITO and dTrkA + PTEN k.d.
- MOHITO cells and tracking the relative proportion of each population over time by
Flow Cytometry.
Human T-ALL cell lines were from the German Collection of Microorganisms and cell culture (DSMZ,
Braunschweig, Germany). Apoptosis was measured by Annexin-V/PI (BDBiosciences) according to manufacturers instructions. For cell cycle analysis the APC-BrdU Kit (BDBiosciences) was used.
Median lethal dose (LD
50
) for 4EGI-1 was determined after an incubation time of 24h unless otherwise
1

stated. Cell size and numbers were determined by a CASY Counter (Schärfe, Reutlingen, Germany).
All flow cytometry data were acquired on FACS Calibur and analyzed with FlowJo Software (TreeStar,
Ashland, OR, USA).
Protein lysates, immunoblots, PhosFlow
Cells were washed with ice-cold PBS and lysed in ice-cold lysis buffer (50 mM HEPES (pH 7.6), 150 mM NaCl, 50 mM NaF, 1 mM EDTA, 10 mM sodiumpyrophosphate,10% glycerine, 1% NP-40 and protease inhibitors (Sigma)). Cell lysates were cleared by centrifugation, aliquoted and frozen. Equal amounts of total protein were separated by SDS-PAGE and blotted onto nitrocellulose membranes.
Blots were incubated with antibodies recognizing the phosphorylated proteins, washed and incubated with HRP-conjugated secondary antibodies. Blots were stripped in 2% SDS, 60mM TRIS (pH 6.80),
0.7%

-mercaptoethanol and reprobed with the pan-protein antibodies. For quantitation of luminescence the blots were analyzed with a Fusion FX7 Advance System (Peqlab, Erlangen,
Germany) and data processed with Peqlab Bio1D software. After linear background subtraction band signal intensities were normalized to a loading control on the same blot (Tubulin/ERK). Intracellular phosphospecific flow cytometry was carried out as described 3 , measuring the mean fluorescent intensity (MFI). The fold change (FC) was defined as: FC = MFI of treated /MFI of vehicle treated cells.
The FC value was log
2
transformed for statistical analysis.
Transgenes, viral constructs, virus production, knockdown experiments
Δ TrkA, a deleted form of the human TRKA receptor 4 was inserted into the gammaretroviral pRSF91.IRES.EGFP.WPRE
5 or into the lentiviral pRRL.PPT.SF.IRES.EGFP.WPRE
6 by standard cloning techniques. As controls, the empty vectors containing only the IRES-EGFP.WPRE were used.
Viral supernatants were produced as described 6 . Viral titers were determined on SC-1 murine fibroblasts and an MOI of 5 was used to infect LSK cells.
For knockdown experiments fluorescence-linked shRNAs were constructed and expressed in the context of an optimized human miR30E backbone 7 . shRNAmiRs were designed and validated as described previously 8, 9 and cloned into the pRSF91.dTomato.miR30E backbone. For the competition and reporter assays the dTomato cDNA was replaced by EGFP, EBFP2 or E2.Crimson.
Sequences and K.D. efficacies of the used shRNAmiRs were:
2

GENE 22 bp Guide
Eif4e.723 TAACCAATCACTATCTTCGGAG
Eif4e.389 TTAAATTACTAGACAACTGGAT
Raptor.3283 TAAATCAGAAACATCTGGATAG
Rictor_4476
Rictor_7443
TATTTCTGTGAGACTCATCTGC
TTTAATAGTCTTAAACACCTAT
PTEN.1523 TATATCTTCACCTTTAGCTGGC
Ren.713 TAGATAAGCATTATAATTCCTA k.d. efficacy in Reporter assay
93%
94%
96%
97%
76%
96%
93%
For knockdown of Rictor, Raptor and eIF4E the T-ALL cell lines #483,#1065 and #1003 were infected with a MOI of 10 in the presence of 4
 g/ml Protaminsulfate. Cells were FACS-sorted for dTomatopositive events 2 days after infection. Cells FACS-sorted for dTomato-positive events 2 days after infection were subjected to Western Blots, PhosFlow, BrdU- and Annexin Assays as indicated in the text and figure legends. The competition assay was carried out n=3 times with three independent clones (#483,#1003 and #1065). All cells were infected separately with pRSF91.EBFP2.eIF4E.389, pRSF91.dTomato.Rictor.4476, pRSF91.E2Crimson.Raptor.3283 or pRSF91.EGFP.Ren.713 at a MOI of 10. Two days after infection cells showing a high fluorescence for the respective marker were
FACS-sorted and mixed. The populations in the competition assay were tracked over time using a BD
LSRII Flow Cytometer equipped with 405 nm (EBFP2), 488 nm (EGFP), 532 nm (dTomato) and
633nm (E2Crimson) lasers.
Isolation, cultivation and transduction of LSK cells
Bone marrow cells of C57BL/6J mice were flushed out of femurs and tibias, washed with PBS followed by erythrocyte lysis . For isolation of Lin Sca-1 + c-Kit + (LSK) cells, bone marrow cells were stained with the Mouse Lineage Mixture (Invitrogen), Sca-1 and c-Kit (eBioscience) and sorted on a BD
FACSAria Cell Sorter. LSK cells were cultured in StemSpan serum-free medium supplemented with
2% penicillin/streptomycin and 1% glutamine, 100 ng/mL of murine SCF (mSCF), 100 ng/mL of human
FMS-like tyrosine kinase 3 ligand (hFlt3L), 20 ng/mL of murine interleukin 3 (mIL3), and 100 ng/mL of human interleukin 11 (hIL11) at 5x10 5 cells/mL. For retroviral transduction (48 h post isolation) tissue culture plates coated with RetroNectin (TaKaRa, Otsu, Japan) were preloaded with a multiplicity of infectious units (MOI) of 5. Cells were then added and incubated at 37°C over night. For lentiviral transduction (day 20h post isolation) concentrated viral supernatants were added to LSK cells on
RetroNectin coated plates at an MOI of 10. 24h after transduction an aliquot of the cells was analyzed by FACS. Cell numbers were adjusted accordingly so that 1-3 x10 5 transduced cells were
3

transplanted. Cells were injected intravenously into lethally irradiated C57BL/6 mice, together with
2x10 5 fresh bone marrow cells.
Sucrose gradient fractionation and RNA isolation
For each biological replicate 5 x 10 7 #483 T-ALL cells were treated with 100

M 4EGI-1 or DMSO.
After 2 h incubation at 37°C cells were washed in ice-cold PBS containing Cycloheximide (0.1 mg/ml), pelleted and resuspended in extraction buffer (20 mM Tris-HCl, pH 8.0, 140 mM KCl, 0.5 mM DTT, 5 mM MgCl
2
, 0.5 % nonidet-P40, 0.1 mg/ml Cycloheximide, 10000 IU/ml Dalteparin sodium) and incubated for 5 min on ice. All subsequent steps were carried out in the cold. After centrifugation for 10 min at 12000 x g, 0.4 ml supernatant was layered onto a 12 ml linear sucrose gradient (10 – 50% sucrose [w/v] in extraction buffer without nonidetP40) and centrifuged at 4 °C in an SW40Ti rotor
(Beckman) at 35000 rpm without brake for 120 min. The gradients were harvested and absorbance profiles at 254 nm recorded (type 11 optical unit/UA-6 detector, ISCO). 1 ml fractions were collected and supplied with 0.1 volume of 3 M sodium acetate (pH 5.2) and 1 volume of isopropanol for overnight precipitation at 20 °C. RNA was purified using Nucleospin RNAII tubes (Macherey- Nagel,
Düren, Germany) following the manufacturer´s protocol. For microarray analysis RNA from polysome fractions were pooled, precipitated by adding LiCl to a final concentration of 2 M and resolubilized in
15 µl of RNase-free water. RNA concentrations were determined and the samples were stored at -80
°C. We also obtained a cytosolic total RNA sample using the standard Trizol protocol. The relative ribosomal occupation was calculated by dividing the AUC (area under the curve) from treated samples to control samples after alignment of the curves to the same baseline.
Microarrays
For the polysome profiling cytosolic and polysomal RNA of 4EGI-1 treated and untreated #483 T-ALL cells from 3 independent experiments were subject to microarray analysis. RNA quality was assessed using the Agilent 2100 Bioanalyzer. RNA was amplified by the Applause WT-Amp ST System (NuGEN
Technologies, Bemmel, The Netherlands), amplified cDNA was fragmented and biotin labeled using the Encore Biotin Module (NuGEN Technologies) according to manufacturer’s protocol. Fragmented and labeled cDNA was hybridized to GeneChip Mouse Gene 1.0 ST Array (Affymetrix, High
Wycombe, United Kingdom). Microarray data is available at the GEO database (GSE41382)
4

Comparison of T-ALL and normal thymocytes: To prevent artifacts caused by comparing cells kept in cell culture to thymocytes directly isolated from animals, #483 T-ALL cells were transplanted into
C57BL6/J mice. Engraftment was monitored by FACS analysis of peripheral blood obtained by retroorbital blood collection. 20 days after transplantation EGFP+ T-ALL cells were sorted from the bone marrow and spleen of three individual mice. Total RNA was prepared using the RNeasy Micro
Kit (Qiagen GmbH, Hilden, Germany) and quality of RNA was assessed using the Agilent 2100
Bioanalyzer. RNA was reverse transcribed and amplified using the Affy GeneChip 3’ IVT Express Kit.
Fragmented and labeled cDNA was hybridized to Affymetrix Mouse Genome 430 2.0 GeneChip arrays. We compared the global gene expression profile of the #483 T-ALL to normal, CD4 + CD8 + thymocytes from two independent published datasets that shared the same mouse strain (C57BL6/J),
RNA isolation and amplification technology and microarray platform.
10, 11 The .CEL files from the
Microarray experiments obtained from GEO were preprocessed together with the .CEL files from the
#483 T-ALL clone using RMA. GSEA results were largely identical, for better readability only the comparison of #483 vs DP from Li et al 2008 10 is shown in the manuscript. Microarray data were submitted to the GEO database (GSE41385).
Patient Data from the Rotterdam T-ALL cohort
RTK/ligand expression in T-ALL patients was investigated in the Rotterdam T-ALL study cohort 12
(n=111 T-ALL and 7 Healthy donors; GSE26713) which employs Affymetrix Human Genome U133
Plus 2.0 arrays. After RMA-preprocessing the expression set was filtered for the Gene Ontology identifier “GO:0004714: transmembrane tyrosine kinase activity” to get the expression levels of all
RTK on the chip (n=49). Since it was expected that not all T-ALL samples do express the same set of
RTK we used the ROSE algorithm 13 (recognition of outliers by sampling ends) to identify RTK where a
(potentially small) subset of the samples has a substantially higher expression than the rest. As fixed cut-off we used the 90th percentile (at least 10 patients show an altered expression). Using this parameter 14 RTK showed differential expression in subsets of patients (EpHB3,B2,B1,A1,A4; DDR2;
TRKA; TRKB, c-KIT,EGFR,InsR, IGR1R,FLT3,FGFR1). For these the coexpression of the genes encoding receptor and ligand (where known) as an indicator of potential autocrine activation of the selected RTKs using linear regression as proposed by Eisenberg et al 14 . The p-values denote the probability of H
0
: slope = 0.
5

Bioinformatics and statistical analysis
Data were analyzed using R and Bioconductor. Array quality was assessed using the
ArrayQualityMetrics package.
15 Arrays were background corrected, normalized and summarized using
RMA.
16 The LIMMA package 17 was used to detect differentially expressed probesets applying
Benjamini-Hochberg (BH) multiple testing correction considering a BH-adjusted p-value of <0.05 significant. To identify mRNAs that show differential translational activity, data from polysomeassociated mRNAs were corrected for cytosolic mRNA data using the ANOTA-RVM (Analysis of translation) package.
18 . The resulting p-values were corrected using the Benjamini-Hochberg multiple testing adjustment method and an FDR of 10% was used as cut off. For testing enrichment of gene sets the Broad Institute GSEA software package 19 was employed. The datasets were collapsed into single genes and rank-ordered by signal to noise ratio. 1000 gene set permutations were used to estimate statistical significance. Analyzed gene sets were obtained from MSigDB V3.0. To test enrichment for gene ontology categories the MSigDB_C5 V3.0 was used. 5’-UTR, CDS and 3’ UTR data was retrieved from Ensembl using the BiomaRt package.
20 For calculating the c omplexity of 5’
UTRs we used QuikFold2 (http://mfold.rna.albany.edu/ ?) on the 5’-UTR sequences of the top 150 downregulated, top 150 upregulated and 150 random nonregulated mRNAs.
Statistical analyses were performed with R and GraphPadPrism. Depicted in the bar charts are the mean and standard deviation. For simple two sample comparisons ttests with Welch’s correction
(unassuming equal variances) were used. For multiple sample comparisons one-way ANOVA with
Bonferronis post-test was used. For the inhibitor experiments, the data was fitted to a Hill-sigmoidal dose-response curve with variable slope using GraphPadPrism. The fitted logEC50 was compared between the experimental groups using GraphPadPrisms F-tests for comparisons of nonlinear curve fitting results. For determination of half-life in competition experiments (Supplementary Figure 5F) the data from three independent replicates were fitted to a one-phase exponential decay with the plateau set to be zero. The values for the half-life are given as mean ± 1.96 S.E.M. (95% confidence intervall).
For intracellular flow cytometry the log
2
(MFI treated /MFI ctrl) was tested against H
0
: log
2
(MFI treated
/MFI ctrl)=0 using a one sample t-test. Significance is indicated throughout the manuscript with p<0.05:* ; p<0.01: ** p<0.001:***
6

Northern Blots
Total cellular RNA was prepared using the TRIzol Reagent (Invitrogen) according to the manufactures protocol. Briefly, 10
 g total RNA per sample was incubated with 25
 l DMSO and 7.5
 l Glyoxal at
50°C for one hour and subsequently separated on a 1% Agarose gel in MOPS/NaAc/EDTA buffer pH
7.0. RNA was transferred to a Biodyne B nylon membrane (PALL Life Sciences), dried and fixed at
80°C for 2 h After blocking with herring sperm DNA (Invitrogen) the membranes were hybridized with
[ 32 P]-labeled PCR fragments of the murine Notch 1 Exon 1-2 and Exon 34, respectively. The PCR products were labeled using the DecaLabel TM DNA Labeling Kit (Fermentas). The Primers were:
Notch1 Exon 1 FW: TAGTGCCTCTGCCGCGGGAG, Notch1 Exon 3 REV:
CGTGGCACGTTCCAGCATTC, Notch1 Exon 34 FW: TGAGACTGCCAAAGTGTTGC, Notch1 Exon
34 REV: CCACATTCAAGTGGCTGATG.
Array-CGH
Array-CGH was performed using the Agilent Mouse Genome Microarray Kit 4x180k (Agilent
Technologies, Santa Clara, CA, USA), a high resolution 60-mer oligonucleotide based microarray with median overall probe spacing of about 10 kb. Labelling and hybridization of genomic DNA was performed according to the protocol provided by Agilent. Briefly, 0.75 μg of test DNA were labeled by random priming using the Agilent Genomic DNA Labeling Kit Plus, test DNA (T-ALL cell lines #003,
#007, #480, #483, #958, #1003, #1065) with Cy3-dUTP and reference DNA (Bl57/6Jspleen) with Cy5dUTP. Labeled products were purified by Amicon Ultra 30k filters (Millipore, Billerica, MA, USA), combined and then mixed with mouse Cot1 DNA (50µg), Agilent 10X Blocking Agent, and Agilent 2X
Hy bridization Buffer. This solution was hybridized to Agilent’s 4x180k Mouse Genome CGH microarray at 65°C with 20 rpm rotation for 24h. Washing steps were performed according to the
Agilent protocol. Microarray slides were scanned immediately using an Agilent microarray scanner at a resolution of 2µm. For image analysis, default CGH settings of Feature Extraction Software (Agilent
Technologies, Waldbronn, Germany) were applied. Output files from Feature Extraction were subsequently imported into Agilent’s CGH data analysis software, DNA-Workbench. The Aberration
Algorithm ADM2 was applied and Aberration Filters were set to: threshold 15.0, at least 20 probes with mean log
2
ratio of -0.3. The raw data has been deposited in GEO (accession number GSE59367).
7

Supplementary references
1. Schmitt TM, Zúñiga-Pflücker JC. Induction of T cell development from hematopoietic progenitor cells by delta-like-1 in vitro. Immunity 2002; 17(6):
749-756.
2. Kleppe M, Mentens N, Tousseyn T, Wlodarska I, Cools J. MOHITO, a novel mouse cytokine-dependent T-cell line, enables studies of oncogenic signaling in the Tcell context. Haematologica 2011; 96(5): 779-783.
3. Perez OD, Mitchell D, Campos R, Gao GJ, Li L, Nolan GP. Multiparameter analysis of intracellular phosphoepitopes in immunophenotyped cell populations by flow cytometry. Curr Protoc Cytom 2005; Chapter 6: Unit 6 20.
4. Reuther GW, Lambert QT, Caligiuri MA, Der CJ. Identification and characterization of an activating TrkA deletion mutation in acute myeloid leukemia. Molecular and
Cellular Biology 2000; 20(23): 8655-8666.
5. Li Z, Schwieger M, Lange C, Kraunus J, Sun H, van den Akker E et al. Predictable and efficient retroviral gene transfer into murine bone marrow repopulating cells using a defined vector dose. Exp Hematol 2003; 31(12): 1206-14.
6. Maetzig T, Brugman MH, Bartels S, Heinz N, Kustikova OS, Modlich U et al.
Polyclonal fluctuation of lentiviral vector-transduced and expanded murine hematopoietic stem cells. Blood 2011; 117(11): 3053-64.
7. Fellmann C, Hoffmann T, Sridhar V, Hopfgartner B, Muhar M, Roth M et al. An
Optimized microRNA Backbone for Effective Single-Copy RNAi. CELREP 2013: 1-
35.
8. Dow LE, Premsrirut PK, Zuber J, Fellmann C, Mcjunkin K, Miething C et al. A pipeline for the generation of shRNA transgenic mice. Nat Protoc 2012; 7(2):
374-393.
9. Zuber J, Mcjunkin K, Fellmann C, Dow LE, Taylor MJ, Hannon GJ et al. Toolkit for evaluating genes required for proliferation and survival using tetracyclineregulated RNAi. Nature Biotechnology 2010; 29(1): 79-83.
10. Li X, Gounari F, Protopopov A, Khazaie K, Von Boehmer H. Oncogenesis of T-ALL and nonmalignant consequences of overexpressing intracellular NOTCH1. Journal
of Experimental Medicine 2008; 205(12): 2851-2861.
11. Yuan J, Crittenden RB, Bender TP. c-Myb promotes the survival of CD4+CD8+ double-positive thymocytes through upregulation of Bcl-xL. Journal of
immunology (Baltimore, Md : 1950) 2010; 184(6): 2793-2804.
12. Homminga I, Pieters R, Langerak AW, de Rooi JJ, Stubbs A, Verstegen M et al.
Integrated Transcript and Genome Analyses Reveal NKX2-1 and MEF2C as
8

Potential Oncogenes in T Cell Acute Lymphoblastic Leukemia. Cancer Cell 2011;
19(4): 484-497.
13. Harvey RC, Mullighan CG, Wang X, Dobbin KK, Davidson GS, Bedrick EJ et al.
Identification of novel cluster groups in pediatric high-risk B-precursor acute lymphoblastic leukemia with gene expression profiling: correlation with genomewide DNA copy number alterations, clinical characteristics, and outcome. Blood
2010; 116(23): 4874-4884.
14. Graeber TG, Eisenberg D. Eisenberg_Bioinformatic identification of autocrine loops_Nature_2001. Nature Genetics 2001; 29(3): 295-300.
15. Kauffmann A, Gentleman R, Huber W. arrayQualityMetrics--a bioconductor package for quality assessment of microarray data. Bioinformatics 2009; 25(3):
415-6.
16. Gautier L, Cope L, Bolstad BM, Irizarry RA. affy--analysis of Affymetrix GeneChip data at the probe level. Bioinformatics 2004; 20(3): 307-15.
17. Smyth G. Limma: linear models for microarray data. . In: Gentleman R, Carey V,
Dudoit S, Irizarry S, Huber W (eds). Bioinformatics and Computational Biology
Solutions using R and Bioconductor. Springer: New York, 2005, pp 397-420.
18. Larsson O, Sonenberg N, Nadon R. anota: analysis of differential translation in genome-wide studies. Bioinformatics 2011; 27(10): 1440-1441.
19. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA et al.
Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proceedings of the National Academy of
Sciences of the United States of America 2005; 102(43): 15545-15550.
20. Durinck S, Spellman PT, Birney E, Huber W. Mapping identifiers for the integration of genomic datasets with the R/Bioconductor package biomaRt. Nat
Protoc 2009; 4(8): 1184-91.
21. Li Z, Beutel G, Rhein M, Meyer J, Koenecke C, Neumann T et al. High-affinity neurotrophin receptors and ligands promote leukemogenesis. Blood 2009;
113(9): 2028-2037.
22. Moellering RE, Cornejo M, Davis TN, Bianco CD, Aster JC, Blacklow SC et al. Direct inhibition of the NOTCH transcription factor complex. Nature 2009; 462(7270):
182-188.
23. Hsieh AC, Liu Y, Edlind MP, Ingolia NT, Janes MR, Sher A et al. The translational landscape of mTOR signalling steers cancer initiation and metastasis. Nature
2012; 485(7396): 55-61.
24. Thoreen CC, Chantranupong L, Keys HR, Wang T, Gray NS, Sabatini DM. A unifying model for mTORC1-mediated regulation of mRNA translation. Nature 2012;
486(7396): 109-113.
9

25. Mamane Y, Petroulakis E, Martineau Y, Sato TA, Larsson O, Rajasekhar VK et al.
Epigenetic activation of a subset of mRNAs by eIF4E explains its effects on cell proliferation. PLoS ONE 2007; 2(2): e242.
Supplementary figure legends
Figure S1: Expression of TRKB and BDNF in T-ALL patients
A) Expression of surface-TRKB and intracellular BDNF by FCM 21 . To determine cells positive for respective markers, we used stringent gating criteria, setting gates at the <1% level of the respective isotype controls with appropriate FMO staining combinations. To be considered as TRK + more than
20% of leukemic blasts had to express TRKA, TRKB or TRKC. Patient T39 (mature T-ALL) was
TRKB + BDNF -/low . Patient T75 (mature T-ALL) was classified as TRKB + /BDNF + and patient T38 (pro-
T-ALL) was negative for all Neurotrophins and their respective receptors .
B) Linear regression analysis between pairs of RTK shown in and their respective ligands from the
Rotterdam T-ALL patient cohort 12 (GSE26713). Points represent the log
2
-transformed expression values of a single patient. Dashed line denotes the 95-percent confidence interval of the regression line. Tabulated p-values indicate whether the slope is significantly different from zero.
Figure S2 Surface markers and TRK-signaling properties
32D cells expressing

TrkA from a gammaretroviral vector (SF91.

TrkA.IRES.EGFP.WPRE; red) were compared to 32D cells transduced with empty vector (grey).
A) FACS surface staining of a representative T-ALL (#483)
B) FACS surface staining of a preleukemic T-ALL #003
C) Phospho-specific flow cytometry was used to quantify intracellular levels of p-Akt (Ser473) and p-
ERK (T202/T204) of

TrkA and mock transduced cells.
D) Influence of combined or single AKT inhibition (AKTI), MEK-inhibition (UO126) or TRK inhibition on the survival of

TrkA transduced 32D cells.
E) Influence of combined or single AKT inhibition (AKTI), MEK-inhibition (UO126) or TRK inhibition on the cell cycle (BrdU-staining) of

TrkA transduced 32D cells.
Figure S3. Genomic profiles of the PTEN locus by means of high resolution array-CGH (180 k)
Cy3/Cy5 log2 ratios of fluorescence intensities of probes along 19qC1 (PTEN): Baseline at log2 ratio of zero, log2 values near +1.0 indicate a gain, log2 values near -1.0 indicate a loss of one allele,
(bi-allelic losses are indicated by log2 values around -4).
A) aCGH of the PTEN locus.
Clones #003 - #1065.
B) PhosFlow for pAKT S473 in clone #007 demonstrated two distinct populations.
C) LM-PCR showed identical lentiviral integration sites in #007.1 and #007.2
D) aCGH of the PTEN locus in #007 and after single cell sorting and establishment of #007.1 and
#007.2.
10

Figure S4 Notch1 and Cux1 alterations
A) The murine Notch1 locus and the position of the detected 5’ deletions starting 8188bp 5’ of the initiation ATG and ending 3575 bp after ATG between exon 2 and 3. Nucleotides inserted by the RAG recombinases are written in red font. Right: The insertions and deletions detected in exon 34 (PEST) domain
B) Hierarchical clustering of Notch1 target genes 22 in the T-ALL clone #483 compared to CD4 + CD8 + thymocytes.
C) T-ALL clones were treated with the Gamma Secretase Inhibitor DAPT and/or the TRK-kinase inhibitor GW441756. Viable cells were determined using Annexin/PI staining
D) aCGH of the Cux1 locus in #483 and #958
Figure S5. High resolution array-CGH (180 k) of T-ALL clones
Graphical summary of the results of aCGH. As reference genomic DNA from the spleen of a male
Bl57/6J was used.
Figure S6. The role of individual components of the mTOR pathway in T-ALL
A) Phosphospecific intracellular flow cytometry of p-AKT S473 (mTORC2), p-4EBP1-T37 (mTORC1) and p-S6P (mTORC1) 4 days after infection with the indicated shRNAs. Plots are representative for n=6 independent experiments with independent T-ALL clones (#480,#483,#1003,#1065)
B) Cell proliferation measured by BrdU-7AAD staining of clone #1065 6 days after infection with the indicated shRNAs. Gated on viable cells.
C) Annexin-PI staining of FACS-sorted #1065 transduced with the indicated shRNAmiR30 constructs
8 days after infection.
D) SC1 fibroblasts were infected with dTomato-shRNAmiR30 constructs against eIF4E. Cell viability was assessed 6 days after infection via FSC/SSC in the dTomato+ vs dTomato negative cells.
E) Competition assay of #1065 T-ALL blasts transduced with the shRNAmiR30 constructs shown in
Figure 4E. Cells were mixed 2 days after transduction (day 0). 3D FACS plots show the proportions of the different populations over time.
Supplementary table 1
Summary of genetic alterations in TRK-induced T-ALL as detected by high resolution aCGH.
Supplementary table 2
Toplist of log2-fold changes in translational activity from ANOTA-RVM 18 after correction for cytosolic mRNA levels in 4EGI-1 treated vs non-treated #483 T-ALL. Tabulated are mRNAs with a log2 FC>0.6 or <-0.6 and an FDR ≤ 0.1.
11