Lab: Who da Baby Daddy Part 2
Biology / Mrs. O’Connor
Background Information
You have learned that DNA is a linear sequence of nucleotides made up of adenine, thymine,
guanine, and cytosine. This sequence of A, T, G, and C is unique to each individual.
Restriction enzymes cut DNA. Each restriction enzyme recognizes a specific group of “target”
base pairs and makes a cut within this area. The resulting fragments are called restriction
fragment length polymorphisms or RFLPs for short.
A DNA molecule containing several such targets will be cut into a number of fragments. The
DNA from one individual will always give the same pieces when cut with a specific restriction
enzyme because all of that person’s DNA is the same. DNA from different individuals may give
different size fragments.
Specialized gels are used to separate the fragments. During gel electrophoresis DNA is
injected into gels. The gel is place into a tray where it is subjected to an electrical current. Since
DNA is negatively charged, the DNA moves toward the positive end of the electric field. The
fragments move through the gel at rates relative to their size. Smaller fragments move towards
the positive end more rapidly than larger ones.
These fragments provide use with a DNA fingerprint, which like real fingerprints, are unique to
each individual. These fingerprints can be used to identify familial relationships, answer
questions about paternity, and solve crimes.
Part A: Restriction Enzyme Simulation
Two common restriction enzymes are EcoRI and PstI which will be provided to you in this lab
procedure. To better understand how EcoRI and PstI may help you in performing your DNA
fingerprinting experiment, first you must understand and visualize the nature of the cutting effect
of a restriction enzyme on DNA.
The line through the base pairs in this diagram represents the sites where bonds will break if the
restriction enzyme EcoRI recognizes the site GAATTC. The following analysis questions refer to
how a piece of DNA would be affected if a restriction enzyme were to cut the DNA molecule in
the manner shown below:
1. How many pieces of DNA would result from this cut? ______
2. Write the base sequence of the DNA fragments on both the left and right side of the “cut”.
Left
Right
3. DNA fragment size can be expressed as the number of base pairs in the fragment.
a. The smaller fragment is _____ base pairs (bp).
b. What is the length of the longer fragment? _____ bp
4. Consider the following sample of DNA shown below – single strands are shown for simplicity.
The sample is treated with the restriction enzyme EcoRI with a recognition sequence of
GAATTC.
CAGTGATCTCGAATTCGCTAGTAACGTT
a. How many fragments of DNA result from using this restriction enzyme? ______
b. List the fragment size in order from largest  smallest.
5. Now examine another strand of DNA. This sample is also treated with the restriction enzyme
EcoRI.
TCATGAATTCCTGGAATCAGCAAATGCA
a. How many fragments of DNA result from using this restriction enzyme? ______
b. List the fragment size in order from largest  smallest.
Part B: Gel Electrophoresis Simulation
Now that you know how restriction enzymes work, it’s time to look more closely at the gel
electrophoresis process.
1. Navigate to this website: http://learn.genetics.utah.edu/content/labs/gel/
2. As you go through the tutorial, fill in the information in the chart below.
Material / Tool
Agarose gel (also
referred to as gel)
Loading buffer
DNA size standard
Electric current
DNA staining
solution
Function – What does it do? What is its purpose?
Part C: Analysis and Conclusions – Answer questions in complete sentences.
1. Based upon your data, who is Bubba’s father? Explain how you know.
2. When Bubba is 5 years old, he has a serious injury that requires a blood transfusion.
Can Bubba’s father donate blood to him? Why or why not?
3. Look at the picture of the gel. Which DNA sample had the smallest fragment? Which one
had the largest?
4. When you placed the gel into the electrophoresis chamber, the wells containing the DNA
were located near the negative end of the chamber. Why was this necessary?
5. If you were called away during the electrophoresis procedure and were not able to
monitor your electrophoresis run, what do you think would happen if the electricity were
to remain running in your absence?
6. The technology that you used in this lab is the same as what is being used by forensic
scientists in real life situations. Think about how this technology is being used and
describe its impact on our society.