DNA Sequencing Activity
In the Sanger method, four reaction tubes are set up:
The A, T, G, C tubes each contain:
1. The DNA template to be sequenced.
2. A primer sequence which is complementary to the beginning of the template to be
sequenced. (Therefore some information about the sequence has to be known in order to
use this protocol)
3. DNA polymerase. (students should understand DNA replication and the function of DNA
polymerase)
4. All four dNTP's (dATP, dTTP, dGTP, dCTP)
5. One radioactively labeled dNTP, usually 32P dATP. This is needed to expose X-ray film and
results in an autoradiogram of a polyacrylamide gel.
6. One di-deoxynucleotide triphosphate per tube:
A reaction tube: di dATP
T reaction tube: di dTTP
G reaction tube: di dGTP
C reaction tube: di dCTP
The ratio of the di deoxynucleotide to the deoxynucleotide in each tube is one to one hundred. So
that once for every 100 nucleotides added to the nucleotide in question in the template, a di deoxy
form of the nucleotide is added. For example, in tube A, each time a thymine nucleotide is
encountered in the sequencing reaction, a deoxyadenosine is added for 99 out of 100 times. One out
of 100 times a di deoxyadenosine is added. At that point, the synthesis of the strand will terminate.
The reaction in the tube will result in collections of DNA strands of differing lengths which reflect
the position of the thymine nucleotide in the template strand in question. When the reactions are
complete, formamide is added to denature the DNA template from the newly synthesized strands.
Each reaction is loaded into a separate lane of a polyacrylamide gel. The gel is fine enough to
resolve DNA fragments that differ by a single nucleotide. After electrophoresis, the gel is exposed to
X-ray film and an autoradiogram is made. The bands correspond to the lengths of fragments in each
reaction tube. The sequence is read from the bottom of the gel to the top. The DNA strand that was
sequenced is complementary to the sequence read on the gel.
Instructions

You will be give 4 sections on 2 pages with a DNA sequence on it and each
section will be labeled A reaction, T reaction, G reaction, and C reaction
respectively.

A primer sequence will also be noted on each page.

Start by writing down the primer at the 3’ end of the DNA sequence.

Write down the complimentary DNA sequence and synthesize the strand in
pieces. Terminate the synthesis with a dideoxynucleotide each time you
reach the nucleotide complementary to that reaction tube di dNTP.

You will end up with a series of fragments. Count how many nucleotides are
present in each fragment.

Last you will be given another piece of paper representing the polyacrimide
gel used for electrophoresis. Now, give each student a piece of paper which
represents a polyacrylamide gel. Draw in the fragments according to size in 4
lanes corresponding to the 4 reactions and determine the DNA sequence.
A reaction – List all DNA fragments and the base number
Primer: ACGGA
DNA Sequence
5’ DNA:ATTGCTACGTAAGGCTAGTACATGCCT 3’
T reaction – List All DNA fragments and the base number
Primer: ACGGA
DNA Sequence
5’ DNA:ATTGCTACGTAAGGCTAGTACATGCCT 3’
G reaction – List All DNA fragments and the base number
Primer: ACGGA
DNA Sequence
5’ DNA:ATTGCTACGTAAGGCTAGTACATGCCT 3’
C reaction – List All DNA fragments and the base numb
Primer: ACGGA
DNA Sequence
5’ DNA:ATTGCTACGTAAGGCTAGTACATGCCT 3’
Gel Electrophoresis – Draw DNA fragments in the correct lanes.
Results : What is the sequence?_______________________________________
STD
30 BP
25 BP
20 BP
15 BP
10 BP
5 BP
0BP
A Tube
T Tube
G Tube
C Tube