C-Check surrogate reporter vector cloning protocol
DREAMlab
Protocol 1: For Complementary Oligo Annealing
1. Design and synthesize C-Check oligos as belows:
C-Check-COA-F: 5’-GTCGGAt(NCS-SS)ataGGT
C-Check-COA-R: 5’-CGGTACCtat(CS-AS)aTC
(Noted that: For CRISPR/Cas9 target sites, the PAM should be included for
each target site. Besides, the total length for each oligos should avoid more
than 120 bp. NCS and CS represent none complementary strand and
complementary strand sequences of the protospacer(s), respectively. For
TALENs target sites, the sense strand (SS) and the complementary
antisense strand (AS) should be enclosed to the position in brackets), also
seen Additional File 8 for designing the oligos.
2. Anneal oligos:
Set up the following oligo anneal mix:
NEB buffer 2 10X, 2µL
C-Check-COA-F (100 µM), 1 µL
C-Check-COA-F (100 µM), 1 µL
ddH2O, 16 µL
First denature at 95 °C for 5 min in a heating block, then let oligos annealed
slowly by turning off the heating block.
3. Ligation
Option 1 (no BsaI recognition site presented in the target site):
Setup the following ligation reaction in a PCR tube:
C-Check plasmid (100 ng/ul), 1 µL
Annealed oligo, 1 µL;
T4 ligase buffer, 2 µL;
BsaI restriction enzyme, 1 µL;
T4 ligase, 1 µL;
H2O, 14 µL;
Perform the ligation with a thermal cycler using the following program:
10 cycles at 37 °C for 5 min, 22 °C for 10 min
1 cycle at 37 °C for 30 min,
1 cycle at 75 °C for 15 min,
save at 4 °C.
1
C-Check surrogate reporter vector cloning protocol
DREAMlab
Option 2 (if there is BsaI recognition site presented in the target sites)
Predigest the C-Check plasmid with BsaI restriction enzyme and purified the
plasmid backbone by agarose gel.
Then set up the following ligation reaction:
C-Check plasmid backbone (50 ng/µL), 1 µL;
Annealed oligo, 1 µL;
T4 ligase buffer, 1 µL;
T4 ligase, 2 µL;
H2O, 15 µL;
4. Transform competent bacterial cells with 2-3 µL of ligation product, and
plate 1/5 of the transformed cells to Spec50 LB agar plate together with 8 µl
IPTG (0.5 M) and 8 µl X-gal (100 mg/µl)
5. Miniprep three Spectinomycin/X-gal positive bacterial clones and digest
plasmid with BamH1, KpnI. The correct C-Check reporter plasmid should
give one band of approximately 6 kb and another band of 626bp+size of the
target sites inserted.
6. The C-Check reporter plasmid should be further sequenced with primer: CCheck-seq-F: ATGGTGAGCAAGGGCGAGGAG by Sanger sequencing especially
for the PCR-based protocol (see below)
7. Prepare the sequenced correct C-Check plasmid for downstream application.
It’s VERY important that the plasmid with prepared with high quality
miniprep or midiprep kits. Presentation of linearized plasmids will increase
the background signal as well as false positive rate.
2
C-Check surrogate reporter vector cloning protocol
DREAMlab
Protocol 2: For PCR-Based generation of C-Check reporter vector
1. Analyze the target region by TALENs or CRISPRs for the presence of BsaI,
BsmbI, and BbsI restriction enzyme recognition sites
2. Choose one of the enzyme sites that is NOT presence.
3. Design PCR primers as follow:
For BsaI cloning
SSA-F: ATAAGGTCTCAGTCGGAt---SS---SSA-R: ATAAGGTCTCACGGTACCtat---AS---For BsmbI cloning
SSA-F: ATAACGTCTCAGTCGGAt---SS---SSA-R: ATAACGTCTCACGGTACCtat---AS---For BbsI cloning
SSA-F: ATAAGAAGACATGTCGGAt----SS---SSA-R: ATAAGAAGACATCGGTACCtat---AS---Noted that the amplicon size should avoid larger than 300 bp in order to
retain the high HDR efficiency cells.
Perform PCR using a high fidelity PCR polymerase. Isogenic DNA from
targeted cells or organisms should be used as template for PCR.
4. Digest PCR product with the corresponding enzyme and purified by agarose
gel electrophoresis.
5. Ligation:
BsaI digested C-Check plasmid (50 ng), 1 µL;
Restriction enzyme digested PCR product, 20 ng
T4 ligase buffer, 1 µL;
T4 ligase, 1 µL;
H2O to a final volume of 20 µL;
Ligation was performed at 22 °C for 2 hours using a thermal cycler
After that following the protocol described above.
3