SUPPLEMENTARY MATERIAL
Flavonostilbenes from Sophora alopecuroides L. as multidrug
resistance associated protein 1 (MRP1) inhibitors
Kai Nia, Lei Yanga, Chuan-xing Wanb, Yuan-zheng Xiaa, Ling-yi Konga*
a
State Key Laboratory of Natural Medicines, Department of Natural Medicinal
Chemistry, China Pharmaceutical University, 24 Tong Jia Xiang, Nanjing 210009,
People’s Republic of China
b
Key Laboratory of Protection and Utilization of Biological Resources in Tarim Basin
of Xinjiang Production & Construct ion Group, Tarim University, Alaer 843300,
People's Republic of China
Correspondence to: Ling-yi Kong, State Key Laboratory of Natural Medicines,
Department of Natural Medicinal Chemistry, China Pharmaceutical University.
Tel.: +86-25-8327-1405
Fax.: +86-25-8327-1405
E-mail: cpu_lykong@126.com
Flavonostilbenes from Sophora alopecuroides L. as multidrug
resistance associated protein 1 (MRP1) inhibitors
Abstract
Flavonoids have been always attracted much attention about their reversal activity on
multidrug resistance (MDR). Eight flavonoids isolated from Traditional Chinese
Medicine (TCM) Sophora alopecuroides L. were applied to test their effect on
multidrug resistance associated protein 1 (MRP1) through the established predicting
assay. Three flavonostilbenes (alopecurone A, B and D) were firstly found exhibiting
potent inhibitory activity on MRP1. All of them dramatically increased
6-carboxyfluorescein
diacetate
(CFDA)
and
doxorubicin
accumulation
in
MRP1-transfected U-2 OS cells. The compounds significantly increased the
cytotoxicity and decrease the IC50 value of doxorubicin on the MDR cells (12, 5,
8-fold, respectively) at a non-toxic concentration (20 μM). Besides, Q-PCR analysis
reveals that the MRP1 mRNA level in U-2 OS/MRP1 was also markedly decreased by
the three compounds. These findings indicate a new therapeutic role of the herb. The
three flavonostilbenes may have the possible for further development as novel
therapeutic reversal agents against MDR.
Keywords: Sophora alopecuroides L.; flavonostilbenes; multidrug resistance (MDR);
MRP1; inhibitors; MRP1-transfected U-2 OS
CONTENTS
S1.
Tables
Table S1.
The reversal of the drug resistance of U-2 OS/MRP1 by compounds
1-3 or probenecid
Table S2.
Different substituent groups with different effects on intracellular
CFDA accumulation in U-2 OS/MRP1 by compounds.
Table S3.
S2.
The primer sequences used for quantitative real-time PCR
Figures
Figure S1.
Multidrug resistance associated protein 1 (MRP1) expression and
function analysis.
Figure S2.
Effects of compounds on CFDA accumulation in U-2 OS/MRP1 cells.
Figure S3.
Cytotoxicity of compounds 1-3 (A) and probenecid (B) on U-2
OS/pcDNA6 cells.
Figure S4.
Effects of Compounds 1-3 on doxorubicin (DOX) accumulation in U-2
OS/MRP1 (A) and U-2 OS/pcDNA6 (B).
Figure S5.
Effect of compound 1-3 on the MRP1 mRNA level in U-2 OS/MRP1
cells.
S3.
Experimental
S4.
References
S1. Supplementary Tables
Table S1. The reversal of the drug resistance of U-2 OS/MRP1 by compounds 1-3
or probenecid
IC50(μΜ) of Drugs
U-2 OS/pcDNA6
DOX+Com
U-2 OS/MRP1
Vehiclea
Com1b
Com2
10.85±1.98
0.91±0.32(12)c
2.14±0.58(5)
Com3
PRB(100μΜ)
PRB(200μΜ)
1.25±0.35(8)
2.92±0.70(3.7)
1.53±0.31(7)
1.00±0.33
Note：Date represents mean value ± SD from three independent experiments.
a
Cells treated with DOX in DMSO (≤0.1%).
b
Cells treated with DOX in the presence of compounds (20 μΜ) and probenecid.
c
The reversal fold (ratio of IC50s) of drug resistance.
Table S2. Different substituent groups with different effects on intracellular
CFDA accumulation in U-2 OS/MRP1 by compounds.
Fluorescence
Com
ratio*
1
+
-
+
5.34
2
+
-
+
4.20
3
+
-
+
4.62
4
-
+
+
1.33
5
+
-
-
1.46
6
+
-
-
1.63
Note：* Fluorescence ratio = (FlMDR treated – FlMDR blank) / (FlMDR control −
FlMDR blank)
Table S3. The primer sequences used for quantitative real-time PCR
Forward primer (5’-3’)
Reverse primer (5’-3’)
GAPDH
GAAAGCCTGCCGGTGACTAA
AGGAAAAGCATCACCCGGAG
MDR1
AGAGTCAAGGAGCATGGCAC
ACAGTCAGAGTTCACTGGCG
MRP1
TAATCCCTGCCCAGAGTCCA
ACTTGTTCCGACGTGTCCTC
BCRP1
AGATTGAGAGACGCGGCAAG
CACCCGGACCTTCCAAACAA
Genes
S2. Supplementary Figures
Supplementary Figure S1. Multidrug resistance associated protein 1 (MRP1)
expression and function analysis. (A) The mRNA levels of three main MDR
proteins (MDR1, MRP1 and BCRP1). (B) MRP1 expression of the three cell lines
was detected by flow cytometry. (C) Cytotoxicity of DOX on the cells. **P<0.01
compared with control group.
Supplementary Figure S2. Effects of compounds on CFDA accumulation in U-2
OS/MRP1 cells. (A) “Nc” and “Control” represent U-2 OS/pcDNA6 and U-2
OS/MRP1 treated with 2 μM CFDA in absence of compounds. “PRB100”, “PRB200”
and “Com” represent U-2 OS/MRP1 treated with CFDA in presence of 100 and
200μM probenecid and 20μM compounds (1-8) respectively. (B) U-2 OS/MRP1 cells
incubated with compounds (1-3) alone (20 μM, blue line) or CFDA alone (2 μM,
orange line) or CFDA plus compounds (1-3) (red line). *P<0.05 and
**
P<0.01 vs.
group in absence of test compounds.
Supplementary Figure S3. Cytotoxicity of compounds 1-3 (A) and probenecid (B)
on U-2 OS/pcDNA6 cells.
Supplementary Figure S4. Effects of Compounds 1-3 on doxorubicin (DOX)
accumulation in U-2 OS/MRP1 (A) and U-2 OS/pcDNA6 (B). Cells were treated
with compounds or probenecid and then DOX (10 μM). *P<0.05 and
**
P<0.01 as
compared to control group.
Supplementary Figure S5. The effect of compound 1-3 on the MRP1 mRNA level
in U-2 OS/MRP1 cells. U-2 OS/MRP1 cells were incubated with compound 1-3 (20
μM, 48 hours) for Q-PCR analysis. *P<0.05 as compared to U-2 OS/MRP1.
S3. Experimental
3. Materials
3.1. Reagents
Doxorubicin (DOX), probenecid (PRB), 6-carboxyfluorescein diacetate (CFDA), and
3-(4, 5-dimethylthiazol-2-yil)-2, 5-diphenyltetrazolium
bromide (MTT) were
purchased from Sigma-Aldrich (St. Louis, MO, USA). Lipofectamine 2000 Reagent
and Blasticidin S HCl (BSD) were obtained from Invitrogen (Carlsbad, CA). All other
compounds and reagents not listed were of analytical grade.
3.2. Biological materials
FITC conjugated mouse anti-human MRP1 monoclonal antibody was purchased from
BD Pharmingen (San Diego, CA, USA). The plasmid vector pcDNA™6/V5-His A
was purchased from Invitrogen (Carlsbad, CA) and the recombinant plasmid
(pcDNA™6/V5-His A-MRP1) encoding the whole human MRP1 gene were
constructed by Novobio Scientific (Shanghai, China).
3.3. Plant materials and natural compounds
Traditional Chinese Medicine Sophora alopecuroides L. was purchased from the
Affiliation Hospital of Anhui College of Traditional Chinese Medicine, identified by
Prof. Min-jian Qin (Department of Medicinal Plants, China Pharmaceutical
University). And the natural compounds studied in present work were isolated from
the root of the herb by our laboratory. Briefly, the crushed root of Sophora
alopecuroides L. (1.0kg) was extracted with 95% EtOH (8 L) for 3 h thrice at 80°C
and then the EtOH extract was concentrated under reduced pressure. To obtain the
compounds studied in present work, the EtOAc extract was sequentially separated by
MCI, ODS, silica gel, and Sephadex LH-20 column chromatography as well as
further purified by pHPLC. Based on their physical and spectral data compounds 1-8
were identified as alopecurone D (1), alopecurone A(2), alopecurone B(3),
alopecurone F(4) (Iinuma et al. 1995) ， sophoraflavanone G(5) (Yoshiaki et al.
1988)， lehmannin(6) (Bakirov et al. 1987)， liquiritin(7) (Fu et al. 2005) and
luteolin(8) (El-Ansari et al. 2009). The chemical structures of these compounds were
showed in Figure 1 in original text. The compounds and herb voucher specimens
(No.200909101) were deposited at State Key Laboratory of Natural Medicines,
Department of Natural Medicinal Chemistry, China Pharmaceutical University.
3.3. Cell lines and culture condition
The U-2 OS cells were obtained from Shanghai Cell Bank (Shanghai, China) and
maintained in RPMI 1640 supplemented with 10% fetal bovine serum and antibiotics
(100 U mL-1 penicillin and 100 µg mL-1 streptomycin). U-2 OS transfected with
pcDNA™6/V5-His A-MRP1 (U-2 OS/MRP1) and empty vector (U-2 OS/pcDNA6)
were grown in RPMI 1640 containing 4μg/mL BSD.
4. Methods
4.1. Transfection
Cell lines (U-2 OS) were transfected with the empty and recombinant plasmid by
Lipofectamine 2000 Reagent as the manual described (Invitrogen). Briefly,
transfection was done with a complex (3.5 μg DNA plasmid, 9 μL Lipofectamine
2000 Reagent and 250 μL Opti-MEM free serum medium (Invitrogen)) adding into
each well of six-well plates containing 2 mL complete medium when the cells reached
70%-90% confluence. Forty-eight hours later, cells were passaged at a rate of 1:10 or
more with medium containing 8 μg/mL BSD. About 4-5weeks later, BSD-resistance
clones were selected and amplified into cell culture plates for the following
experiments.
4.2 Quantitative real-time PCR (Q-PCR) analysis
Total RNA of 2×106 U-2 OS cells with different treatments were extracted using 1 mL
TRIzol reagent (Invitrogen, Carlsbad, California, USA) according to the
manufacturer’s illustration. 1 μg of total RNA was used to prepare first-strand cDNA
by reverse transcription using a Superscript II reverse transcriptase (Invitrogen,
Shanghai, China) with oligo d(T) primer according to the manufacturer’s instructions.
For quantitative real-time PCR, triplicates of 20μl PCR reactions were performed on
2μl of cDNA, according the operation manual of SYBR Green PCR Master Mix
(Toyobo Co., Ltd., Life Science Department, Osaka Japan) on the LightCycler 480
(Roche Molecular Biochemicals, Mannheim, Germany). The primer pairs for PCR
were listed in Table S3. Data were analyzed using the comparative cycle threshold (Ct)
method as a means of relative quantization, normalized to an endogenous reference
(GAPDH) and relative to a calibrator (normalized Ct value obtained from control
group cells) and expressed as 2−ΔΔCt.
4.2. MRP1 expression analysis by flow cytometry
The BSD-resistance cell lines (U-2 OS/pcDNA6 and U-2 OS/MRP1) were harvested
with trypsin on their exponential growth phase, washed and suspended in phosphate
buffered saline (PBS). According the manuals (BD Pharmingen), cells were incubated
with the MRP1-antibodies following fixed and permeabilized. The fluorescent density
of cells was detected by BD FACSCalibur flow cytometer (BD Biosciences, Franklin
Lakes, NJ). At least 1×104 cells of every sample were collected and detected.
4.3. MTT assay
The DOX sensitivity on cells was performed by MTT assay. Briefly, cells were seeded
in 96-well culture plates (5-6×103 cells and 200 μL/well) respectively, and allowed to
attach overnight, the cells were treated with a series of concentrations (10-4 to 102 μM)
of DOX for 48 h. DMSO (≤0.1%) was used as a vehicle. 20 μL MTT, 5 mg/mL in
PBS after filtered to sterilized, was then added to each well for an additional 4 h
incubation at 37℃ in dark. After that, DMSO (150 μL per well) was added to
dissolve the formed purple precipitate formazan crystals. The optical density (OD)
was detected with an ELISA reader (SpectraMax Plus384, Molecular Devices,
Sunnyvale, CA) at a test wavelength of 570 nm (reference wavelength of 630 nm).
Cell viability was calculated using the formula:
Cell viability rate（%）= (average OD of DOX treated wells − average OD of
blank wells) / (average OD of control wells − average OD of blank wells) ×100%
4.4. Flow cytometry-based CFDA accumulation assay
Carboxyfluorescein diacetate (CFDA), a specific substrate for MRP1, was extensively
as a fluorescent probe for MRP1 activity in MRP1 over-expressing cell lines (Dogan
et al. 2004；Sun et al. 2007).
In this part, CFDA accumulation experiment was performed as described
previously with some modification (Sun et al. 2007). Namely, U-2 OS/MRP1 cells
were seeded in 6-wells culture plates for 1 or 2 days with complete medium
containing 4 μg/mL BSD. Until the cells reached 70%-80% confluence, all wells were
treated with medium change in presence of tested compounds (20 μM) and PRB (in
low cytotoxicity). After 2 h incubation, CFDA was added to a terminal concentration
of 2 μΜ and then cells were incubated for another 90 min. U-2 OS/pcDNA6 cells
were also performed as aforementioned procedure as a control. After that, cells were
washed by cold PBS for 3 times, harvested with trypsin and suspended in PBS, then
detected by flow cytometer (BD FACSCalibur). The acquired date (1×104 cells per
sample) was analyzed with FlowJo7.6.1 software (Tree Star, San Carlos, CA).
4.5. Intracellular DOX accumulation assay
Intracellular doxorubicin accumulation was determined by fluorimetry as described
previously (Payen et al. 2001；Yang et al. 2011) for appropriate adjustment.
Procedures were just like described above. After incubation with compounds 1-3 (a
range of concentrations) and DOX (10μM), U-2 OS/MRP1 cells were washed three
times with ice-cold PBS and lysed in 200 μL Cell lysis buffer for Western and IP
(Beyotime biotechnology, China) and meanwhile ultrasonication was also performed.
After centrifuged at 12000 rpm/min for 10 min, 150 μL supernatant was added into a
black 96-well microplate (Fluotrac 200; Greiner Bio-One, Germany), fluorescence
intensity was then determined using a SpectraMax Paradigm Multi-Mode Detection
Platform instrument (Molecular Devices); excitation and emission wavelengths were
470 nm and 585 nm, respectively. Cellular protein content of each sample was
determinated simultaneously by Enhanced BCA Protein Assay Kit (Beyotime) to
normalize the fluorescence arbitrary units.
4.6. MDR reversal activity
The chemotherapy sensitization assay of compound 1, 2, 3 at a completely non-toxic
concentration and positive control probenecid were performed by MTT assay on U-2
OS/MRP1. Cells were seeded into 96-well culture plate with 5×103 cells per well.
Anti-cancer drug (DOX) at a series of concentrations (102 to 10-4 μM) was added into
wells in quadruplicates in the presence or absence of compounds (20 μM) or
probenecid (100 and 200 μM). After 48 h, MTT assay procedure was performed. The
IC50 values of DOX were calculated using GraphPad Prism 5.0 (GraphPad Software,
San Diego, California, USA). The reversing folds as potency of reversal were
obtained by the formula: (IC50 of doxorubicin alone) / (IC50 of doxorubicin in the
presence of compound).
4.7. Statistical analysis
All experiments were repeated at least three times. The results analysis was performed
using one-way ANOVA with Tukey multiple comparison test. The data are given as
the mean ± SD. P<0.05 was considered as statistically significant.
S4. References
Bakirov EK, Yusupova S, Sattikulov A, Vdovin A, Malikov V, Yagudaev M. 1987.
Flavonoids of Ammothamnus lehmannii. Structure of lehmannin and of
ammothamnidin. Chemistry of Natural Compounds.23:429-435.
Dogan AL, Legrand O, Faussat AM, Perrot JY, Marie JP. 2004. Evaluation and
comparison of MRP1 activity with three fluorescent dyes and three modulators
in leukemic cell lines. Leuk Res.28:619-622.
El-Ansari MA, Aboutabl EA, Farrag ARH, Sharaf M, Hawas UW, Soliman GM,
El-Seed GS. 2009. Phytochemical and pharmacological studies on Leonotis
leonurus. Pharm Biol.47:894-902.
Fu B, Li H, Wang X, Lee FS, Cui S. 2005. Isolation and identification of flavonoids in
licorice and a study of their inhibitory effects on tyrosinase. J Agric Food
Chem.53:7408-7414.
Iinuma M, Ohyama M, Tanaka T. 1995. Six flavonostilbenes and a flavanone in roots
of Sophora alopecuroides. Phytochemistry.38:519-525.
Payen L, Delugin L, Courtois A, Trinquart Y, Guillouzo A, Fardel O. 2001. The
sulphonylurea glibenclamide inhibits multidrug resistance protein (MRP1)
activity in human lung cancer cells. Br J Pharmacol.132:778-784.
Sun M, Xu X, Lu Q, Pan Q, Hu X. 2007. Schisandrin B: a dual inhibitor of
P-glycoprotein and multidrug resistance-associated protein 1. Cancer
Lett.246:300-307.
Yang L, Wei DD, Chen Z, Wang JS, Kong LY. 2011. Reversal of multidrug resistance
in human breast cancer cells by Curcuma wenyujin and Chrysanthemum
indicum. Phytomedicine.18:710-718.
Yoshiaki S, Ichiro Y, Mami N, Tsuyoshi T, Manki K. 1988. Studies on the
Constituents of Sophora Species. XXII.: Constituents of the Root of Sophora
moorcroftiang BENTH. ex BAKER.(1). Chem Pharm Bull.36:2220-2225.