nph12471-sup-0001-FigS1-S4_TableS1-S4_NoteS1

advertisement
Supporting information Notes S1, Figs S1–S4, Tables S1–S4
Notes S1 Detailed information on the identification of the Arabidopsis fluorescent
compounds as scopoletin and derivatives.
High-resolution spectra were acquired in the 50-1000 m/z range during the whole HPLC
run to obtain a three-dimensional dataset (time, m/z, and intensity). The RT of the
phenolics standards ranged from 4.6 (L-phenylalanine) to 21.5 min (quercetin), and the
ion chromatograms for each standard were extracted at the m/z value of the [M+H]+ ion
(Supporting information Fig. S2). The raw datasets from the richest materials in
fluorescent compounds, -Fe Col0 growth media and -Fe pdr9-2 root extracts, were
processed, along with the corresponding +Fe counterparts, with the DISSECT algorithm
(Data Analysis 4.0, Bruker). From all the analyzed spectra (approximately 100), only
nine were chosen that: i) eluted at the RT where fluorescence was found, and ii) either
occurred only in the Fe-deficient samples or increased in peak area with Fe-deficiency.
Then, these MS spectra were examined in detail in the Fe-deficient samples, ions
coming from adducts (formed with salts or solvents), dimers and trimers were generally
discarded, and the ion chromatograms of all major remaining ions (that included nonfragmented [M+H]+ ions and fragment ions produced in the ESI source) were extracted
with a precision of ±0.02 m/z. From these, we selected major ions showing large
changes in peak areas with Fe deficiency (Table 1 includes the RT, exact m/z and
assigned elemental formulae, all of them with m/z errors <5 ppm). Fragments and minor
ions were not considered. To obtain further structural information, HPLC/ESI-MSMS(ion trap) was used, allowing for selection and isolation of specific ions and the
subsequent fragmentation and detection of product ions. This was done in multiple MS
stages (MS2, MS3, etc.), increasing progressively the amount of structural information
gained. A comprehensive study of the MSn of phenolics standards was used to build a
fragmentation template (see Table 2 for the m/z values and relative intensities of the
fragments).
Annotations proposed for compound 9 are in agreement with the RTs, which indicate
relative polarities in the order fraxetin > scopoletin > isofraxidin > 9. Compound 9
produced MS2 fragment ions matching well with that of isofraxidin (Tables 1 and 2),
indicating that the methoxy group must be in the benzenic ring as it occurs in the
standard, since a methoxy group in the heterocyclic ring would yield a different MS2
fragmentation pattern. The 5- position is the only one possible in the benzenic ring apart
from the 8- occurring in the standard.
A similar glucosyl moieity loss was also found in the standard glucoside of esculetin
(esculin), which produced an ion at m/z of 179.0343 corresponding to the aglycone
(esculetin). This, along with the fact that 1-5 eluted at RTs close to that of esculin (8.8
min), much lower than those of all non-glucosylated coumarins (13-16 min), supports a
putative annotation as glucosides of coumarins. In fact, the MS2 of 1-5 (Table 1) show
that the isolation and subsequent fragmentation of the parent ions (387, 355, 357, 401
and 387 m/z, respectively) produced generally just one major fragment ion in each case
(at 225, 193, 195, 239 and 225 m/z, respectively), all consistent with the loss of the
glucosyl moiety, with the rest of fragments having generally relative intensities below
10%. A similar MS2 fragmentation pattern was found for esculin (m/z of parent and
major fragment ions of 341 and 179, respectively, with a loss of -162 Da; Table 2).
Therefore, compounds 1-5 were confirmed to be glucosides, and their identity was
further deciphered by MS3 using as a model the fragmentation of esculin. The esculin
MS3 spectrum 341179 produced the same fragment ions than those present in the
aglycone esculetin MS2 (Table 2), confirming that esculin is initially fragmented in MS2
in a very abundant ion corresponding to the aglycone after the loss of the glucosyl
moiety. Compound 2 was identified as glucoside of scopoletin (scopolin), since the MS3
spectrum 355193 produced several fragment ions matching with those present in the
scopoletin MS2 (Tables 1 and 2). Compounds 1 and 5 were annotated as two different
glucosides of dihydroxyscopoletin. First, their MS3 spectra, in both cases 387225,
produced several m/z losses similar to those observed in the MS2 spectra of the
coumarins studied (see Supporting information Fig. S3), indicating that they can be two
glucosides of a coumarin with a [M+H]+ 225 m/z. Taking advantage of the fact that ions
with m/z 225.0393 and 225.0386 were observed in the TOF analysis, we were able to
assign the elemental formula C10H9O6 to the 225 m/z coumarin (with an error <4 ppm).
Both this m/z and the elemental formula difference with scopoletin are consistent with
the addition of two hydroxyl (-OH) groups to scopoletin, resulting in a change of
+31.99 Da. Compound 4 was annotated as a glucoside of hydroxymethoxyscopoletin.
The MS3 spectra 401239 also produced several m/z losses similar to those of the
coumarins MS2, indicating that it can be a glucoside of a coumarin with a [M+H] + 239
m/z. In TOF, 4 showed a major ion at m/z 239.0547, which permitted to assign the
formula C11H11O6 to the 239 m/z (with an error of 1.3 ppm). Both this m/z and the
elemental formula difference with scopoletin are consistent with the addition of a
hydroxyl (-OH) and a methoxy group (-OCH3) to scopoletin, resulting in a change of
+46.00 Da. Compound 3 was annotated as a glucoside of ferulic acid. The MS3
357195 and MS4 357195
the MS2 and MS3 (195
Additionally, compound 3 showed a major ion at m/z 195.0646 in TOF, which
permitted to assign the formula C10H11O4 (with an error of -3.1 ppm). This elemental
formula corresponds to two different compounds involved in coumarin synthesis (Yang
et al., 2010), ferulic acid and 6’-hydroxyconiferyl aldehyde. However, the
fragmentation pattern of compound 3 matches well with that of ferulic acid, and differs
from that of coniferyl aldehyde (Table 2).
Fig. S1 Removal of scopoletin and derivatives by Sep-Pak C18 column from the
Arabidopsis nutrient solution. HPLC/ESI-MS(TOF) chromatograms of growth media
extracts from Fe-deficient Arabidopsis plants. Plants were grown in hydroponics for
four weeks in presence of 50 µM Fe(III)-EDTA in culture media, and then transferred
on a nutrient solution without Fe. The nutrient solution was re-circulated continuously
using a peristaltic pump in the presence (blue) or absence (red) of a C18 resin column.
The nutrient solution was sampled at day 20 after imposing the treatments. The
chromatograms were zoomed to show the peaks corresponding to fraxetin (a),
scopoletin (b) and isofraxidin and methoxyscopoletin (c). Chromatograms were
extracted at the m/z ( 0,02) ratios corresponding to [M+H]+ ions. The numbers in
italics shown after the compound names refer to the labels used for each compound in
Table 1. The concentrations of isofraxidin and methoxyscopoletin found in the nutrient
solutions at 20 d were lower that those found at 7 d (Fig. 3).
Fig. S2 Analysis of phenolic compound standards by HPLC/ESI-MS(TOF). Typical
chromatograms of phenolic standard solutions extracted at the m/z (± 0.02) ratio
corresponding to the [M+H]+ ions. The chromatograms corresponding to cinnamic, ocoumaric acid and p-coumaric acids were extracted at the m/z ratios of both [M+H]+ and
[M-H2O+H]+ ions.
Fig. S3 MS2 spectra of the coumarin standards scopoletin (a), fraxetin (b) and
isofraxidin (c), and MS3 spectra of the compounds 1 (d), 5 (e) and 4 (f) occurring in
Arabidopsis roots. Common mass-to-charge (m/z) losses from the precursor ion are
indicated with arrows.
(a)
Intens.
x10 4
1.0
Intens.
Scopoletin
(d)
132.9
Compound 1
387→225
25
-60
0.8
209.7
-15
20
0.6
15
0.2
10
177.8
148.9
0.4
164.9
-15
5
164.8
140.0
0.0
Intens.
1.
6000
100
125
Fraxetin
150
148.9
175
m/z
75
(e)
-60
162.9
4000
2000
200
176.8
135.0
150
175
200
Compound 5
387→225
-15
m/z
209.8
-15
-60
178.9 -46
164.8 191.8
10
0
75
Intens.
x10 4
125
20
0
(c)
100
30
-46
180.8
107.1
Intens.
40
193.8
75
(b)
-60
0
.
100
125
150
175
200
m/z
75
(f)
Isofraxidin
2.0
Intens.
800
162.9
-60
1.5
-15
125
150
175
200
223.8
-15
600
205.8
189.8
1.0
m/z
Compound 4
401→239
207.8
107.1
100
-33
400
-33
135.0
0.5
178.8
91.3
0
0.0
75
100
-60
200
125
150
175
200
m/z
75
100
125
150
175
200
m/z
Fig. S4 Elution of scopoletin and derivatives trapped in the C18 resin column.
HPLC/ESI-MS(TOF) chromatograms of growth media extracts from Arabidopsis
plants. Plants were grown in hydroponics for four weeks in presence of 50 µM Fe(III)EDTA in culture media, and then transferred on a nutrient solution without Fe. The
nutrient solution was re-circulated continuously using a peristaltic pump in the presence
or absence of the C18 resin column. At day 7 after imposing the treatments, the
phenolics trapped in the C18 resin column were eluted three times with 10 ml of
metanol. The chromatograms correspond to the second elution step. The chromatograms
were zoomed to show the peaks corresponding to fraxetin (a), scopoletin (b) and
isofraxidin, methoxyscopoletin (c). Chromatograms were extracted at the m/z ( 0,02)
ratios corresponding to [M+H]+ ions. The number in italics shown after the compound
names refer to the labels used for each compound in Table 2.
Table S1 Primers used for qRT-PCR
gene
ID
orientation
sequence
PP2
At1g13320
FW
TAACGTGGCCAAAATGATGC
REV
GTTCTCCACAACCGCTTGGT
FW
GCTCCTCCTGATGCACCAAT
REV
CCATCACCAACAGGGAGCAT
FW
TGCTCCTTCTCATCCTGGTAT
REV
CACGCAATGTTCGTCACTCC
FW
GCCTGATATCTGCAGGAATGAAA
REV
ACTCTAGAAGCCTCCTCACCA
FW
GCGACTTGTAGTGCGGCTATG
REV
CGTTGCACGAGCGATTCTTG
FW
CGGTTGGACTTCTAAATGC
REV
CGATAATCGACATTCCACCG
FW
GCGAAACTCAGAGCTTGTGA
REV
AGTGCGCCGAAGATCAAAGA
CCoAMT1
COMT
F6’H1
FRO2
IRT1
ABCG37 (PDR9)
At4g34050
At5g54160
At3g13610
At1g01580
At4g19690
At3g53480
Table S2 List of chemicals (solvent and phenolic standards) used for analytical
measurements
Name
lithium hydroxide monohydrate
formic acid
methanol
2-propanol
caffeic acid
2,4-dihidroxycinnamic acid
5-hidroxyferulic acid
ferulic acid
isoferulic acid
o-coumaric acid
p-coumaric acid
sinapic acid
trans-cinnamic
chlorogenic acid
cynarine
rosmarinic acid
coniferyl alcohol
sinapyl alcohol
coniferyl aldehyde
sinapic aldehyde
esculetin
esculin
scopoletin
fraxetin
isofraxidin
quercitin
L-phenylalanine
Quality grade
99.995%
50%
LC-MS grade
LC-MS grade
≥99%,
97%
≥95%
99%
99%
97%
≥98%
≥98%
99%
≥95%
≥95%
96%
98%
80%
98%
98%
≥98%
≥98%
≥98.5%
98%
95%
≥98%
certified reference material
Manufacturer
Aldrich
Fluka
Riedel-de-Haën
Riedel-de-Haën
Fluka
Aldrich
Sigma
Aldrich
Aldrich
Aldrich
Fluka
Aldrich
Aldrich
Aldrich
Fluka
Aldrich
Aldrich
Aldrich
Aldrich
Aldrich
Aldrich
Fluka
Fluka
Biorbyt
Fluka
Sigma
Fluka
All phenolic standards were purchased from Sigma-Aldrich (St. Louis, MO, USA), with
the exception of fraxetin, which was purchased from Biorbyt (St. Francisco, CA, USA).
Table S3 Operating conditions of the time-of-flight (TOF) and ion trap mass
spectrometers (MS) used for analytical measurements
MS(TOF)
Source
Polarity
Endplate voltage
Spray tip voltage
Orifice voltage
Nebulizer gas
Nebulizer gas pressure
Drying gas
Drying gas (N2) flow rate
Drying gas temperature
Electrospray
Positive
-0.5 kV
4.5 kV
100 V
N2
2.7 bar
N2
9.0 l min-1
200 ºC
MS/MS(ion trap)
Nebulizer gas
Nebulizer gas pressure
Drying gas
Drying gas (N2) flow rate
Drying gas temperature
Operation mode
Target for full scan mode
Maximum accumulation time for full scan
mode
Mass-to-charge ratio (m/z) range for full
scan mode
Target for MRM mode
Maximum accumulation time for MRM
mode
Mass-to-charge ratio (m/z) range for
MRM mode
Fragmentation amplitude for MS2 and
MS3
Isolation width for MS2 and MS3
Cutoff selection to precursor mass for
MS2 and MS3
N2
40 psi
N2
9.0 l min-1
350 ºC and 200 ºC
Full scan and Multiple Reaction
Monitoring (MRM)
30,000
200 ms
50-1200 u
30,000
200 ms
50-500 u
1.0 V
1.0 and 2.0 u
27.0%
Table S4 Manganese, Cu and Zn concentrations (µg g-1 DW) in young leaves and roots
from Arabidopsis thaliana plants
Mn
Cu
Zn
Young leaves
-Fe+C18 resin column
-Fe
795±82
616±54
-Fe+C18 resin column
-Fe
2,290±171
7,708±417
14.6±1.3
22.7±1.4
Roots
137±8
110±14
358±21
300±9
4,071±129
3,608±307
Plants were grown in hydroponics for 4 weeks in presence of 50 µM Fe3+-EDTA in the
culture media. They were then transferred on a medium without Fe (Fe-deficient; -Fe).
The medium of the Fe-deficient plants was continuously circulated with a peristaltic
pump in presence (-Fe+C18 resin column) or absence (-Fe) of a C18 Sep-Pak cartridge.
Leaf and root material were sampled from plants after 20 days of recirculation of the
medium. Data are means ± SE of 8 independent measurements.
Download
Related flashcards
Create Flashcards