SOM Schambach et al.
1/6
Supplemental Online Material
A. Schambach et al.
Equal potency of gammaretroviral and lentiviral SIN vectors for
expression of O6-methylguanine-DNA-methyltransferase
in hematopoietic cells
(Note: Reference numbering differs from published paper)
Vector construction
The MGMT-P140K cDNA was subcloned into pBluescript SK+ (Stratagene, La Jolla, CA)
and its sequence was confirmed. From there it was transferred into the retroviral vector
pMP71 [1] as an NcoI / EcoRI fragment. Subsequently, the posttranscriptional regulatory
element (PRE) of Woodchuck Hepatitis Virus (WHV) was inserted via BamHI / HindIII to
obtain pMP71.MGMTp. This PRE version has several possible ATGs mutated and ends
before the X protein ORF [2]. To obtain SF91.MGMTp, the MGMTp cassette was
introduced into the retroviral vector pSF91 [1].
To construct a retroviral self-inactivating (SIN) retroviral vector, the 3’ SIN LTR was
excised from pSinSF91P [3] with HindIII/XhoI and cloned into pSF11 [1]. Into the resulting
vector pSin11.GFP, we inserted the SFFVp U3 promoter (including the enhancer; -342 to
+18, relative to the transcriptional start site, GenBank acc. No. AJ224005) and the PRE
(see above), thus obtaining pSin11.SF.GFP.p. To clone pSin11SF.MGMTp, the GFP was
excised and substituted by MGMT-P140K cDNA.
The lentiviral construct pRRL.PPT.PGK.GFPpre was kindly provided by L. Naldini (Milano,
Italy). For pRRL.PPT.PGK.MGMTp the MGMT/P140K cDNA was inserted via AgeI and
SalI. For the corresponding retroviral vector, pSin.PGK.MGMTp, pRRL.PPT.PGK.GFPpre
SOM Schambach et al.
2/6
was cut with EcoRV and SalI to excise the PGK promoter and the GFP. In a second step,
the GFP cDNA was replaced by MGMT-P140K.
To design pRRL.PPT.SF.MGMTp and pRRL.PPT.SF91.MGMTpre, the SFFVp promoter
(see above) alone or the SFFVp promoter followed by a retroviral intron was excised from
pSSF91P [3] and cloned into the lentiviral constructs.
For pRRL.PPT.EF1.MGMTp the EF1 (intron-containing) promoter was excised from
pHR’ EF1 EGFP (kindly provided by S. Karlsson, Lund, Sweden). To obtain
pRRL.PPT.EFS.MGMTp, containing an EF1-promoter without an intron (EFS, EF1
short), primers 5’EFSnotcla (5’ CTTAGCGGCCGCATCGATTGGCTCCGGTGCCCGTCAGT 3’) and 3’EFSeco47bam (5’ CGATAGCGCTGGATCCCGCGTCACGACACCTGTGTTCTGGCGGCAAA 3’) were used to amplify a 240 bp EFS PCR product (template
pRRL.PPT.EF1.MGMTp).
This
was
cloned
as
a
BamHI/ClaI
fragment
into
pRRL.PPT.EF1.MGMTp to substitute for the longer version of the EF1 promoter. The
EFS PCR fragment cut with NotI and Eco47III was used to obtain the retroviral
counterpart, pSin.EFS.MGMTp.
To construct pRRL.SFLTR.MGMTp, a Bst1107I site was introduced into the U3 deletion of
the 3’ LTR at -3 (relative to the R region) by overlap-PCR. The SFFVp U3 was amplified
via
Pfu-PCR
from
pSSF91P
(see
above)
using
primers
5’SFFVU3blunt
(5’
GCTAGCTGCAGTAACGCCATTTTGC 3’) and 3’SFFVU3blunt (5’ CAAGCAAAAAGCAGCTGCTTATAGAGCTCGGGAAGCAGAAGCGC 3’) and cloned into the opened Bst1107I
site. All PCR products were sequenced.
Production of vector supernatants, titrations, and transduction of cell lines
Phoenix gp packaging cells (kindly provided by G. Nolan, Stanford) and 293T cells were
used for retroviral and lentiviral supernatant production, respectively. Phoenix gp, 293T
and SC1 cells were maintained in Dulbecco’s modified Eagles medium (DMEM)
supplemented with 10% FCS, 100 U/ml penicillin/streptomycin, and 2 mM glutamine. SC1
SOM Schambach et al.
3/6
cells were grown in the latter mentioned medium. 32D cells were kept in RPMI, 10% FCS,
100 U/ml penicillin/streptomycin, 2 mM glutamine and 3 ng/ml IL-3 (Peprotech, Rocky Hill,
NJ).
The day before transfection, 5x106 Phoenix gp or 293T cells were plated on a 10-cm dish.
For transfection, the medium was exchanged and 25 µM chloroquine (Sigma-Aldrich) was
added. 8 µg transfer vector DNA, 1 µg of a GFP reporter plasmid to determine transfection
efficiencies, and 2 µg of an ecotropic envelope plasmid [4] were used. In addition, 10 µg of
retroviral gag/pol plasmid (M57) or 12 µg of a lentiviral gag/pol plasmid (pcDNA3 g/p
4xCTE) were transfected using the calcium phosphate precipitation method. When using
lentiviral vectors, 5 µg of a Rev plasmid (pRSV-Rev, kindly provided by T. Hope, Chicago)
was cotransfected. For the transduction of human cells, 5 µg of a RD114/TR envelope
plasmid [5] (containing an amphotropic cytoplasmic tail, kindly provided by F. L. Cosset,
Lyon) were used to pseudotype retro- and lentiviral vectors. Medium was changed after
10-12 h. Equal transfection efficiency was controlled by FACS analysis. Supernatants
containing the viral particles were collected 24-72 h after transfection, filtered through a
0,22-µm filter, and stored at -80°C until usage.
SC1 or 32D cells (5x104 – 3x105) were transduced by centrifugation for 60 min at 2000
rpm at 32°C in the presence of 4 µg/ml protamine sulfate (Sigma-Aldrich).
After
transduction, cells were grown for 4-5 days and subsequently analyzed by flow cytometry,
fluorescence microscopy, western blot, and northern blot. Titration of the vector
supernatants on SC1 cells was performed as previously described [3].
SOM Schambach et al.
4/6
Supplemental data to Figure 3A. Column chart of FACS data obtained with transduced
32D cells. The percentage of transduced cells (□) and the mean fluorescence intensity
(MFI) of MGMT (■) were calculated and are shown for all vectors. Errors bars indicate
standard deviations of 2 experiments. Data were reproduced in 2 different experiments
(data not shown).
SOM Schambach et al.
Supplemental data to Figure 3. Kinetics of methyl transfer to wild type (Raji,
5/6
■) and P140K
mutant (RRL.SFLTR-transduced 32D cells, ♦, dashed line) protein. MGMT activity is given
as percentage of maximum activity (at 4h). See Materials and Methods for details. Similar
data were obtained in transduced human K562 cells (Figure 4D).
SOM Schambach et al.
References of supplemental material
1.
2.
3.
4.
5.
Schambach, A., et al. (2000). Context dependence of different modules for
posttranscriptional enhancement of gene expression from retroviral vectors.
Molecular Therapy. 2: 435-445.
Egelhofer, M., et al. (2004). Inhibition of HIV-1 entry in cells expressing Gp41derived peptides. J Virol. 78: 568-575.
Kraunus, J., et al. (2004). Self-inactivating retroviral vectors with improved RNA
processing. Gene Ther. 11: 1568-1578.
Morita, S., Kojima, T., and Kitamura, T. (2000). Plat-E: an efficient and stable
system for transient packaging of retroviruses. Gene Ther. 7: 1063-1070.
Sandrin, V., et al. (2002). Lentiviral vectors pseudotyped with a modified RD114
envelope glycoprotein show increased stability in sera and augmented transduction
of primary lymphocytes and CD34+ cells derived from human and nonhuman
primates. Blood. 100: 823-832.
6/6