Supplementary Figure Legends
Supplementary Figure 1. Pol β mRNA levels in colon cancer cells following
oxaliplatin treatment.
HCT116 and HCT-OR cells were treated with oxaliplatin (10 and 75 μM, respectively)
for 4 h. Cells were harvested, RNA prepared using the RNeasy kit (Qiagen, Crawley,
UK), cDNA was generated using the SuperScript RT-PCR system (Invitrogen, Paisley,
UK) and Pol β was amplified using the following primers: 5′GAGAAGAACGTGAGCCAAGC-3′ and 5’-CGTATCATCCTGCCGAATCT-3′ using
cycling conditions of 1 cycle at 95°C for 5 min, 30 cycles at 95°C for 30 sec, 58°C for 30
sec and 72°C for 30 sec, and 1 cycle at 72°C for 5 min. Glyceraldehyde-3-Phosphate
Dehydrogenase (GAPDH) was amplified using identical cycling conditions and the
following primers: 5′-CAATGACCCCTTCATTGACC-3′ and 5′GACAAGCTTCCCGTTCTCAG -3′. PCR products were separated by 2% agarose gel
electrophoresis containing SYBR Green (Invitrogen, Paisley, UK) and analysed using
Molecular Imager FX (Bio-Rad, Hemel Hempstead, UK). No significant increase in Pol
β mRNA was observed after 4 h of oxaliplatin treatment (Ox) compared to control (C)
cells treated with DMSO.
Supplementary Figure 2. Representative MS trace for MEF cells treated with
oxaliplatin.
Pol β+/+ MEF cells were treated with oxaliplatin (50 µM) for 24 h, the medium was
changed and cells were harvested 4 h later. DNA was extracted, digested and subjected
1
to solid phase extraction prior to analysis of 1,2-GG oxaliplatin adduct levels by LC-ICPMS. The retention time for the 1,2-GG standard was 4.68 min, which co-eluted with the
peak present in the treated samples. Satisfactory co-elution with the 1,2-AG standard
was not achieved; these data were not analysed. As negative controls, cells were treated
with cisplatin and transplatin.
2
REFERENCES
Albertella MR, Lau A, O'Connor MJ (2005). The overexpression of specialized DNA
polymerases in cancer. DNA Repair (Amst) 4: 583-93.
Bergoglio V, Canitrot Y, Hogarth L, Minto L, Howell SB, Cazaux C et al (2001).
Enhanced expression and activity of DNA polymerase beta in human ovarian tumor cells:
impact on sensitivity towards antitumor agents. Oncogene 20: 6181-7.
Boyer J, Allen WL, McLean EG, Wilson PM, McCulla A, Moore S et al (2006).
Pharmacogenomic identification of novel determinants of response to chemotherapy in
colon cancer. Cancer Res 66: 2765-77.
Boyer J, McLean EG, Aroori S, Wilson P, McCulla A, Carey PD et al (2004).
Characterization of p53 wild-type and null isogenic colorectal cancer cell lines resistant
to 5-fluorouracil, oxaliplatin, and irinotecan. Clin Cancer Res 10: 2158-67.
Canitrot Y, Frechet M, Servant L, Cazaux C, Hoffmann JB (1999). Overexpression of
DNA polymerase beta: a genomic instability enhancer process. Faseb Journal 13: 11071111.
Dianova II, Bohr VA, Dianov GL (2001). Interaction of human AP endonuclease 1 with
flap endonuclease 1 and proliferating cell nuclear antigen involved in long-patch base
excision repair. Biochemistry 40: 12639-44.
Horton JK, Baker A, Berg BJ, Sobol RW, Wilson SH (2002). Involvement of DNA
polymerase beta in protection against the cytotoxicity of oxidative DNA damage. DNA
Repair (Amst) 1: 317-33.
Kelland L (2007). The resurgence of platinum-based cancer chemotherapy. Nat Rev
Cancer 7: 573-84.
Le Pla RC, Ritchie KJ, Henderson CJ, Wolf CR, Harrington CF, Farmer PB (2007).
Development of a liquid chromatography-electrospray ionization tandem mass
spectrometry method for detecting oxaliplatin-DNA intrastrand cross-links in biological
samples. Chem Res Toxicol 20: 1177-82.
Ochs K, Lips J, Profittlich S, Kaina B (2002). Deficiency in DNA polymerase beta
provokes replication-dependent apoptosis via DNA breakage, Bcl-2 decline and caspase3/9 activation. Cancer Res 62: 1524-30.
Ochs K, Sobol RW, Wilson SH, Kaina B (1999). Cells deficient in DNA polymerase beta
are hypersensitive to alkylating agent-induced apoptosis and chromosomal breakage.
Cancer Res. 59: 1544-51.
3
Parsons JL, Tait PS, Finch D, Dianova, II, Allinson SL, Dianov GL (2008). CHIPmediated degradation and DNA damage-dependent stabilization regulate base excision
repair proteins. Mol Cell 29: 477-87.
Rixe O, Ortuzar W, Alvarez M, Parker R, Reed E, Paull K et al (1996). Oxaliplatin,
tetraplatin, cisplatin, and carboplatin: spectrum of activity in drug-resistant cell lines and
in the cell lines of the National Cancer Institute's Anticancer Drug Screen panel. Biochem
Pharmacol 52: 1855-65.
Servant L, Cazaux C, Bieth A, Iwai S, Hanaoka F, Hoffmann JS (2002). A role for DNA
polymerase beta in mutagenic UV lesion bypass. J Biol Chem 277: 50046-53.
Shibuya K, Mathers CD, Boschi-Pinto C, Lopez AD, Murray CJ (2002). Global and
regional estimates of cancer mortality and incidence by site: II. Results for the global
burden of disease 2000. BMC Cancer 2: 37.
Sobol RW, Horton JK, Kuhn R, Gu H, Singhal RK, Prasad R et al (1996). Requirement
of mammalian DNA polymerase-beta in base-excision repair. Nature 379: 183-6.
Srivastava DK, Husain I, Arteaga CL, Wilson SH (1999). DNA polymerase beta
expression differences in selected human tumors and cell lines. Carcinogenesis 20: 104954.
Starcevic D, Dalal S, Sweasy JB (2004). Is there a link between DNA polymerase beta
and cancer? Cell Cycle 3: 998-1001.
Tice RR, Agurell E, Anderson D, Burlinson B, Hartmann A, Kobayashi H et al (2000).
Single cell gel/comet assay: guidelines for in vitro and in vivo genetic toxicology testing.
Environ Mol Mutagen 35: 206-21.
Vaisman A, Chaney SG (2000). The efficiency and fidelity of translesion synthesis past
cisplatin and oxaliplatin GpG adducts by human DNA polymerase beta. Journal of
Biological Chemistry 275: 13017-13025.
Woodhouse BC, Dianova, II, Parsons JL, Dianov GL (2008). Poly(ADP-ribose)
polymerase-1 modulates DNA repair capacity and prevents formation of DNA double
strand breaks. DNA Repair (Amst) 7: 932-40.
Zmudzka BZ, Fornace A, Collins J, Wilson SH (1988). Characterization of DNA
polymerase b mRNA: cell-cycle and growth response in cultured human cells. Nucleic
Acids Research 16: 9587-9596.
4