유산균의 동정 및 김치 유산균의 다상 연구 한국생명공학연구원 생물자원센터 유전자은행 이정숙 Lactic acid bacteria Gram-positive, non spore-forming, catalasenegative, devoid of cytochromes, of nonaerobic habit but aerotolerant, fastioius, acid-tolerant, cocci or rods, which produce lactic acid as a major sole end product of the fermentation of sugar Consist of several genera including Aerococcus, Alloiococcus, Carnobacterium, Dolosigranulum, Enterococcus, Globicatella, Lactobacillus, Lactococcus, Lactosphaera, Leuconostoc, Oenococcus, Pediococcus, Streptococcus, Tetragenococcus, Vagococcus, and Weissella (16 genera) The lactic acid bacteria are of paramount importance in the food industry, both as beneficial organisms and as spoilage organisms. They are used in the production of fermented milk products such as yogurt, sour cream, cheese and butter, and in the production of sausage, pickles, sauerkraut and kimchi. The results of these fermentations are more shelf-stable products with characteristic aromas and flavors. If the growth of lactic acid bacteria is not in some way controlled, they can be a major cause of food spoilage. The souring of milk and the greening of meat are common examples of spoilage resulting from the unchecked activity of these organisms. Differential characteristics of lactic acid bacteria Rods Cocci Character Carnob. Lactob. Aeroc. Enteroc. Lactoc. Vagoc. Leuconoc. Oenoc. Pedioc. Streptoc. Tetragenoc. Weissella Tetrad formation - - + - - - + - + - CO2 from glucose - ± - - - + - - - + Growth at 10ºC + ± + + + + ± - + + Growth at 45ºC - ± - + - - ± ± - - ND ± + + - ± ± - + ± - - - - - - - - + - Growth at pH 4.4 ND ± - + ± ± + - - ± Growth at pH 9.6 - - + + - - - - + - Lactic acid L D, L, DL L L L D L, DL L L D, DL Growth NaCl at 6.5% Growth at 18% NaCl Schematic, unrooted phylogenetic tree of the lactic acid bacteria, including some aerobic and facultatively Gram-positives of the low G+C subdivision. Note: evolutionary distances are approximate. (Lactic Acid Bacteria: microbiology and functional aspects/ edited by Seppo Salminen & Atte von Wright. 2nd ed.) Lactic acid bacteria 분류, 동정의 문제점 동일한 선택 배지에서 생육이 가능하며 생리생화학적 특 성에 따른 명확한 구분이 어렵다. 16S rRNA sequence 분석을 통한 분자분류학적 연구 결 과로부터 genus간의 혼재되는 양상이 보고되었고, 새로운 genus로의 전이가 진행중이다. 분류학 연구의 목적 기존의 미생물 분류체계 확립 분리균의 정확한 동정 새로운 유용한 미생물의 발견 Bacterial systematics 의 최근 동향 Polyphasic taxonomy 분자계통분류 (Molecular systematics) 신속 동정 재분류 새로운 유용한 유전자의 응용 Type of modern bacterial systematics Numerical taxonomy Phenotypic data Molecular systematics Nucleic acid sequencing RFLP RAPD Chemotaxonomy Protein analysis Cell wall composition Whole-organism fingerprinting Molecular systematic and Chemosystematic analyses of the bacteria cell, and the taxonomic level at which they are generally most useful Cell components Analyses & Methods Chromosomal DNA Base composition(mol% G+C) DNA:DNA hybridsation DNA restriction patterns rRNA RFLP(ribotyping) Genus Species Ribosomal RNA Nucleotide sequence DNA:rRNA hybridsation Species and subspecies Protein Amino acid sequence Serological comparisons Electrophoretic patterns Cell walls and membranes Peptidoglycan structure Polysaccharides Teichoic acids Fatty acids Polar lipids Mycolic acids Isoprenoid quinones Taxonomic ranks covered Species and subspecies Genus and above Species and genus Genus and species Species and subspecies Genus and species Metabolic produces Fatty acids Species and subspecies Complete cell Pyrolysis mass-spectrometry Rapid enzyme tests Genus, species and below Species and subspecies ( modified from Priest and Austin, 1993) 분자계통분류 환경적 요인에 영향을 받지 않음 많은 세균의 재분류의 기반 조성 종 (species) 을 정의 세균 분류학에서의 종 (species)이란? 분류학에서의 정의가 가능한 기본 단위 DNA-DNA 상동성이 70% 이상인 균주들 (70% 이하일 경우 다른 종) - 1987 국제세균분류위원회 *16S rRNA gene 상동성 97% 이하 DNA-DNA 상동 성이 60% 이하 다른 종 (Stackebrandt & Goebel, 1994) 새로운 유전자의 필요성 16S rRNA gene 및 DNA-DNA 상동성의 단점 - 16S rRNA gene : 유연관계가 가까운 균주의 비교에는 적당치 않음 - DNA-DNA 상동성 : 실험상의 어려움 다른 유전자가 새로운 정보를 줄 수도 있음 16S rRNA gene in molecular systematics 모든 세균에 존재 염기서열의 variable region과 conserved region의 분산 존재 많은 균주의 염기서열이 결정되어 있음 Chemotaxonomy 분석기기 발달 컴퓨터 발달 균체지방산 조성 분석 - 세포 지질의 필수 구성성분으로 모든 미생물에 존재 - 10 - 24개 정도의 carbon chain으로 이루어져 있으며 그들의 길이, 이중결합의 위치, 치환기 등에 따라 다양한 형태로 존재 - 최근에는 Microbial Identification System (MIDI; Microbial ID, Inc., Newark, Del., USA) 이라는 Automated Gas Chromatography로 분석 Fatty acids found in bacteria. HARVESTING Third Quadrant 4mm Loop Coat Bottom SAPONIFICATION Add 1.0 ml Reagent # 1 100 ° C 5 min Vortex 5-10 sec Vortex 5-10 sec 100 ° C 25 min cool METHYLATION Add 2.0 ml Reagent # 2 80 ± 1 ° C , 10 ± 1 minCool apidly Vortex 5-10 sec EXTRACTION Add1.25 ml Reagent # 3 10 min Remove Bottom Phase Save Top Phase WASH Add 3.0 ml Reagent # 4 5 min Remove 2/3 Top Phase Transfer to GC Vial Cap 95개 탄소원 이용성 분석 (BIOLOG system) 95개의 탄소원 이용성을 분석하여 미생물의 동정과 분류에 응용하는 자 동화 시스템 Biolog GP microplate water αcyclodextrin βcyclodextrin dextirn glycogen inulin mannan tween 40 tween 80 N-acetyl-Dglucosamin e N-acetyl-Dmannosami ne amygdalin L-arabinose D-arbitol arbutin cellobiose D-fructose L-fucose D-galactose Dgalacturonic acid gentiobiose D-gluconic acid α-D-glucose m-inositol α-D-lactose lactulose maltose maltotriose D-mannitol D-manose Dmelezitose D-melibiose α-methyl Dgalactoside β-methyl Dgalactoside 3-methyl glucose α-methyl Dglucoside β-methyl Dglucoside α-methyl Dmannoside palatinose D-psicose D-raffinose L-rhamnose D-ribose salicin sedoheptulo san D-sorbitol stachyose sucrose D-tagalose D-trehalose turanose xylitol D-sylose acetic acid αhydroxybuty ric acid βhydroxybuty ric acid γhydroxybuty ric acid ρhydroxyphe nyl acetic acid α-keto glutaric acid α-keto valeric acid lactamide D-lactic acid methylester L-lactic acid D-malic acid L-malic acid methyl pyruvate monomethyl succinate propionic acid pyruvic acid succinamic acid succinic acid N-acetyl Lglutamic acid alaninamide D-alanine L-alanine L-alanylglycine Lasparagine L-glutamic acid glycyl-Lglutamic acid Lpyroglutami c acid L-serine putrescine 2,3butanediol glycerol adenosine 2'-deoxy adenosine inosine thymidine uridine adenosine5'monophosp hate tymidine-5'monophosp hate uridine-5'monophosp hate fructose-6phosphate glucose-1'phosphate glucose-6phosphate D-L-αglycerol phosphate DNA 염기 조성 분석 DNA 염기 조성은 • mol % G+C로 표기 • 미생물의 전체 DNA 염기 조성에서 Guanine (G)과 Cytosine (C)이 차지하는 상대적 비율을 나타내며 미생물마다 고유의 조성을 가짐 • 미생물의 속 (genus)과 종 (species)을 기술하는 최소 요건 중 하나로 이용 •세균의 DNA 염기조성의 차이 : 24 - 76 mol % •분석 방법 : Tm법, Bd법, HPLC법 •G+C mol % 차이 5% 이상 : 다른 종 10% 이상 : 다른 속 G+C content of taxa taken to represent the main lines of descent of procaryotes Weissella koreensis sp. nov., isolated from kimchi Morphological and physiological characteristics irregular short or coccoid rods Gram-positive, catalase-negative and facultative anaerobes grew at 10 and 37 C but not at 42 C (optimum temperature : 25 C) grew at pH 4.0-8.0 (optimum pH : pH 6.0) Chemotaxonomic characteristics Cell wall type : Lys-Ala-Ser Major whole-cell fatty acids : octadecenoic acid (18:1) and hexadecanoic acid (16:0) DNA base compositions : 37 mol% DNA-DNA reassociation analysis Phylogenetic analysis Differential Characteristics of species of the genus Weissella. W. kandleri* W. viridescens* W. minor* W. halotolerans* W. confusa* W. paramesenteroi des* W. hellenica* W. thailandensis* S-5623T S-5673 L-Arabinose - - - - - d + + + + Cellobiose - - + - + (d) - - - - Galactose + - - - + + - + - - Maltose - + + + + + + + - - Melibiose - - - - - + - + - - Raffinose - - - - - d - + - - Ribose + - + + + d - + + + Sucrose - d + - + + + + - - Trehalose - d + - - + + + - - Xylose - - - - + d - - + + Hydrolysis esculin - - + - + (+) ND + - - NH3 from arginine + - + + + - - - + + Dextran formation + ND - ND + - - - + + Lactic acid configuration DL DL DL DL DL D D D D D Murein type Lys-Ala-GlyAla2 Lys-Ala-Ser Lys-Ser-Ala2 Lys-Ala-Ser Lys-Ala Lys-Ala; Lys-Ser-Ala2 Lys-Ala-Ser Lys-Ala2 Lys-Ala-Ser Lys-Ala-Ser Cell Morphology Irregular rods Small irregular rods Irregular short coccoid rods with rounded to tapered ends Irregular short or coccoid rods Short rods thickened at one end Spherical or lenticular cells Large spherical or lenticular cells Cocci in pairs or in chains Irregular short or coccoid rods Irregular short or coccoid rods 39 41-44 44 45 45-47 37-38 39-40 38-41 37 37 Characteristic Acid produced from: G + C content (mol%) Scanning electron micrograph of strain S-5623T. Bar, 1m. 970 990 Leuconostoc argentinum DSM 8581T (AF175403) Leuconostoc lactis JCM 6123T (AB023968) Leuconostoc citreum KCTC 3526T (AF111948) 712 Leuconostoc kimchii KCTC 3286T (1F173986) 930 Leuconostoc gelidum DSM 5578T (AF175402) Leuconostoc carnosum NCFB 2776T (X95977) 1000 Leuconostoc mesenteroides subsp. cremoris DSM 20346T (M23034) 1000 934 Leuconostoc mesenteroides subsp. mesenteroides DSM 20343T (M23035) Leuconostoc pseudomesenteroides NCDO 768T (X95979) Leuconostoc fallax DSM 20189T (S63851) Oenococcus oeni ATCC 23279T (M35820) 998 Weissella paramesenteroides DSM 20288T (M23033) Weissella thailandensis FS61-1T (AB023838) 976 Weissella hellenica NSFB 2973T (X95981) Weissella confusa DSM 20196T (M23036) 1000 1000 Weissella minor DSM 20014T (M23039) Weissella viridescens DSM 20410T (M23040) Weissella halotolerans DSM 20190T (M23037) 1000 992 Weissella koreensis S5673 (AY035892) Weissella koreensis S5623T (AY035891) Weissella kandleri DSM 20593T (M23038) Lactobacillus kimchii KCTC 8903PT (AF183558) Lactobacillus .plantarum NCDO 1753T (X52653) 828 999 928 Lactobacillus brevis ATCC 14869T (M58810) Lactobacillus delbrueckii subsp. delbtueckii ATCC 9649T (M58814) Escherichia coli (V00348) 0.1 Phylogenetic relationships between Weissella koreensis S5623T, S5673, Weissella species and other related bacteria based on 16S rDNA sequences. The branching pattern was generated by the neighbour-joining method. The numbers indicate bootstrap values > 700. The scale bar indicates 0.1 nucleotide substitutions per nucleotide position. DNA-DNA reassociation values between S-5623T, S-5673, W. kandleri KCTC 3610T and W. viridescens KCTC 3504 T. Species % Reassociation with labeled DNA from: S-5673 S-5623T KCTC 3610T KCTC 3504T S-5673 100 103 25 16 S-5623T 90 100 24 16 W. Kandleri KCTC 3610T 21 20 100 14 W. viridescens 3504T 13 16 9 100 KCTC Description of Weissella koreensis sp. nov. Weissella koreensis (ko.re.ensis N. L. adj. koreensis, for Korea, which the new organisms were isolated) Cells are irregular short rod-shaped or coccoid organism. Gram-positive, non-motile, non-spore-forming, catalase-negative and facultative anaerobes. Grows at 10 and 37 C and pH 4.0-8.0 but not at 42C. The optimum temperature and pH for growth were 25C and 6.0, respectively. They did not grow in 8% and 10% NaCl. Arginine is hyrolysed and dextran from sucrose is formed. D(-)-lactic acid and gas from glucose are produced. Acid is produced from L-arabinose, ribose and xylose, but not from cellobiose, galactose, maltose, melibiose, raffinose, sucrose and trehalose. The G+C content of the DNA is 37 mol %. Lys-Ala-Ser in the cell walls. Major cellular fatty acids are C18:1 7c and C16:0. Source: kimchi, Korean traditional fermented vegetable food. The type strain is S-5623T (= KCTC 3621T = KCCM 41516T = JCM 11263T), and reference strain includes S-5673 (= KCTC 3622 = KCCM 41517 = JCM 11264). Polyphasic Study for Monitoring of the Lactic Acid Bacterial Communities during Kimchi Fermentation 연구의 목적 •김치 발효 과정에서의 젖산균의 다양성과 변화 분석 •김치유래 젖산균의 분류•동정 Culture-dependent approach for diversity and dynamics of the microbial communities during kimchi fermentation Analysis of FAMEs of isolates from MRS medium A great diversity of fatty acid, at least 37 different ones, was detected in the isolates from kimchi, but 15 of them appeared in less than 5% of the strains tested and will not be considered in detail further. Four fatty acids such as C14:0, C16:0, C18:1 ω9c, and summed feature 7 appeared in all strains tested. Four fatty acids such as C16:1 ω7c, C18:0, C19:0 CYCLO ω8c, and Summed feature 9 appeared in more than 70% of the strains tested. Cluster analysis revealed 7 major FANE clusters and 1 single cluster that are presented in an abridged dendrogram. The clusters defined at Euclidian distance of 17.5. Analysis of FAMEs of isolates from PES medium The fatty acid compositions of the 79 presumptive Leuconostoc strains were determined. Three of the 28 different fatty acid types were excluded from the final data analysis since these were detected in less than 5% of the strains All 79 strains contained C14:0, C16:0, C18:0, C18:1 ω9c, summed feature 4, and summed feature 7. Seven fatty acids such as C15:0, C16:1 ω5c, C17:1 ω8c, C19:1 iso, C19:0 CYCLO ω8c, summed feature 6, and summed feature 9 appeared in more than 70% of the strains tested. All 79 strains were identified to known clusters, i.e. B, C and D, at a Euclidian distance of 17.5. Euclidian distance 30.00 20.00 10.00 0.00 Cluste r Number of strains A 6 B 61 C 79 Identity Leu. mesenteroides subsp. dextranicum Leuconostoc sp. Leu. citreum Leu. pseudomesenteroides G 8 Lab. delbruekii subsp. delbruekii Lab. casei F 28 Lab. plantarum Lab. parabuchneri Lab. plantarum E F 21 H 1 Lab. animalis Lab. brevis Leuconostoc sp. Leu. mesenteroides subsp. mesenteroides D 24 Leu. mesenteroides subsp. cremoris Leu. carnosum Leu. lactis Dendrogram showing the relationship between the isolates from MRS medium based on their cellular fatty acid profiles. Analysis of carbon-source utilization patterns of isolates from MRS medium The test strains were recovered in five major, one minor and twelve single clusters defined at the SSM level of 80%. Analysis of carbon-source utilization patterns of isolates from PES medium All 75 strains were identified to known clusters, i.e. M, N, O and P, at the SSM level of 80%. Percentage Similarity 50 60 70 80 Cluster 90 Number of strains Identity 100 R 2 Lactobacillus sp. M 54 Leu. ameliobiosum N 59 Leu. m. mesenteroides Q 20 Lab. plantarum Lab. d. delbrueckii Lab. casei S5386 O 25 S3 S136 S5486 S185 S176 P 11 KCTC3526 S123-2 S178 S5299 S199 S5393 Leuconostoc sp. Leu. pseudomesenteroides Leu. lactis Lab. animalis Lab. brevis Lab. parabuchneri Leuconostoc sp. Leuconostoc sp. Lactobacillus sp. Leu. citreum Leuconostoc sp. Abridged dendrogram showing the relationships between the isolates from MRS medium defined in the SSM, UPGMA analysis. 1. 균체지방산 조성 분석이나 탄소원 이용성 분석에 따라 lactic acid bacteria의 그룹화가 이루어지며, 이에 따른 데이터베이스를 구축할 수 있다. 그리고 분리 균주를 각각의 데이터베이스와 비교하여 분류하는 것도 가능하다. 2. 그러나, 두가지 방법에 따른 데이터베이스 상호간의 일치점을 명확히 규명하기 는 어렵다. 3. Culture-dependent methods의 한계점을 극복할만한 새로운 측면의 연구 방 법 모색이 필요하다. Molecular monitoring for diversity and dynamics of the microbial communities during kimchi fermentation Denaturing Gradient Gel Electrophoresis (DGGE) DGGE is based on the principle that increasing denaturant concentration will melt double-stranded DNA in distinct domains. When the melting temperature (Tm) of the lowest domain is reached, the DNA will partially melt, creating branched molecules with reduced mobility in a polyacrylamide gel. The denaturing environment is created by a uniform run temperature between 50 and 65C and a linear denaturant gradient formed with urea and formamide. The gradient may be formed perpendicular or parallel to the direction of electrophoresis. DGGE is one of the most sensitive mutation detection methods, providing efficiency up to 99%. Based on this principle, DGGE is used to be a suitable tool for the study of microbial diversity. Perpendicular denaturing gradient gel in which the denaturing gradient is perpendicular to the electrophoresis direction. This shows a single melting domain. At low denaturant concentration (left) the DNA fragment remains double stranded, but as the concentration increases (moving right) the DNA fragment begins to melt, creating a branched molecule. At very high concentrations, the DNA fragment can completely melt, creating two single strands. (Upper) A, Perpendicular denaturing gradient gel in which the denaturing gradient is perpendicular to the electrophoresis direction. B, Parallel denaturing gradient gel in which gradient is parallel to the electrophoresis direction. lane 1, mutant fragment; lane 2, wild-type fragment; lane 3, mutant and wild-type fragments. (lower) 방법 Isolation of DNA PCR-DGGE analysis •Primer set (gc338f/518r) •PCR condition (“touchdown” PCR) •8% (wt/vol) polyacrylamide gels in 1X TAE •denaturing gradient ranging from 10% to 50% urea-formamide denaturing gradient (with 100% defined as 7 M urea and 40% [vol/vol] formamide) •gel electrophoresis : 16 h at 60 V •Staining : SYBR Green I (Sigma Co., St. Louis, MS) for 30 min Sequencing of DGGE fragments Analysis of the sequence data 16S rRNA-targeted PCR primers used in this study. Primer Sequence (5’-3’) Position Reference 338f 518r ACT CCT ACG GGA GGC AGC AG ATT ACC GCG GCT GCT GG 357-338 534-518 Lane, D. J. (1991) Muyzer, A. E. et al. (1993) A GC clamp was attached to the 5’ end of primer 338f to obtain primer gc338f (GC clamp, 5’CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGCACGGGGGG). Muyzer, A. E. et al. (1993) PCR product obtained from amplification of chromosomal DNA with gc338f/518r primer set 200bp A days 0 1 4 5 6 8 11 14 17 20 26 30 Weissella confusa group Leuconostoc citreum Lactobacillus sakei Lactobacillus curbatus Leuconostoc gelidium B days 0 1 2 3 5 6 8 10 14 18 20 Weissella confusa group Leuconostoc citreum Leuconostoc gelidium Lactobacillus sakei Lactobacillus curbatus Lactococcus lactis subsp. lactis DGGE analysis of PCR-amplified 16S rDNA fragments of microbial communities from kimchi fermented at 10C (A) and 20C (B). DGGE profiles from LAB reference strains and kimchi samples. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 a b c d e f g Lanes: 1, Weissella confusa KCTC 3499T; 2, kimchi sample for 26 days at 10C; 3, kimchi sample for 18 days at 20C; 4, Leuconostoc citreum KCTC 3526T; 5, Leuconostoc gasicomotatum KCTC 3752T; 6, Leuconostoc gelidium KCTC 3527T; 7, Leuconostoc pseudomesenteroides KCTC 3652T; 8, Leuconostoc mesenteroides subsp. mesenteroides KCTC 3505T; 9, Leuconostoc mesenteroides subsp. dextranicum KCTC 3530T; 10, Leuconostoc mesenteroides subsp. cremoris KCTC 3529T; 11, Lactobacillus brevis KCTC 3498T; 12, Lactobacillus curvatus KCTC 3767T; 13, Lactobacillus sakei KCTC 3603T; 14, Lactobacillus plantarum KCTC 3108T; 15, Lactobacillus fermentum KCTC 3112T; 16, Lactococcus lactis subsp. lactis KCTC 3769T. Conclusion main microorganisms for kimchi fermentation in DGGE analysis Weissella confusa group (Weissella cibaria, Weissella confusa and Weissella kimchii), Leuconostoc citreum, Lactobacillus curvatus, and Lactobacillus sakei • We demonstrated that the ecology of kimchi cannot be effectively studied by cultivation-dependent methods alone, because some of dominating taxa, although culturable, are not recovered by this traditional approach. • A polyphasic approach should allow us to better understand the dynamic changes during kimchi fermentation.
0
You can add this document to your study collection(s)
Sign in Available only to authorized usersYou can add this document to your saved list
Sign in Available only to authorized users(For complaints, use another form )