Section J – Analysis and uses
of cloned DNA
Animal cell
Plant cell
Contents
J1 Characterization of clones
Characterization, Restriction mapping, Partial digestion, Labeling
nucleic acid, Southern and Northern blotting
J2 Nucleic acid sequencing
DNA sequencing, RNA sequencing, Sequence databases, Analysis of
sequences, Genome sequencing projects
J3 Polymerase of cloned genes
PCR, the PCR cycle, Template, Primers, Enzymes, PCR optimization,
PCR variations
J4 Organization of cloned genes
Organization, Mapping cDNA on genomic DNA, S1 nuclease
mapping, Primer extension, Gel retardation, DNaseⅠ footprinting,
Reporter genes
J5 Mutagenesis of cloned genes
Deletion mutagenesis, Site-directed mutagenesis, PCR mutagenesis
J6 Applications of cloned genes
Applications, Recombinant protein, Genetically modified organisms,
DNA fingerprinting, Medical diagnosis, Gene therapy
J1 Characterization of clones —
Characterization
Preparation of pure DNA is the first step of any
characterization.
Plasmid DNA: from bacterial colonies
Bacteiophage DNA:
Plaque purified phage → → infecting a bacterial culture → →
cell lysis → → phage particles → → phenol-chloroform, ethanol
precipitate → → Bacteiophage DNA
J1 Characterization of clones —
Restriction mapping
Example1：
Digests
Resultant
Fragments
EcoRI
3 kb, 5 kb
HindIII
2 kb, 6 kb
EcoRI + HindIII 2 kb, 1 kb, 5 kb
• The most common application of restriction mapping is presented:
Determining the orientation of a cloned insert. This method requires
that restriction maps of the cloning vector and the insert are already
available.
J1 Characterization of clones —
Restriction mapping
HindIII (8)
Example2：
PstI (21)
BamHI (35)
AvaI (40)
XmaI (40)
Sma I (42)
EcoRI (53)
ApaLI (2332)
ApaLI (589)
pGEM -1
2865 bp
ApaLI (1835)
J1 Characterization of clones —
Partial digestion
3kb
1kb
Complete
digestion
2kb
4kb
10 kb insert
Partial
digestion
10 kb
7 kb
6 kb
4 kb
3 kb
2 kb
1 kb
Can not delineate
the restriction sites.
Delineate the restriction sites by partial digested
end-labeled radioactive DNA.
*
**
*
3kb
E
1kb
E
3 kb
2kb
4 kb
E
4kb
10 kb insert
6 kb
End-labeled radioactive DNA
Partial digestion
Agarose electrophoresis
Autoradiography
10 kb
6 kb
4 kb
3 kb
J1 Characterization of clones —
Labeling nucleic acid
Radioactive labeling: display and/or magnify
the signals by radioactivity
Non-radioactive labeling: display and/or
magnify the signals by Biotin and digoxin etc
1.End labeling: put the labels at the ends
2.Uniform labeling: put the labels internally
1.End labeling
（1）Single stranded DNA/RNA
5’-end labeling: dephosphorylation  polynucleotide
kinase
3’-end labeling: terminal transferase
（2）Double stranded DNA/RNA
Fill in the recessive 3’-ends（ 3’-凹端） by
DNA polymerase.
Labeled at both ends
5’pAATTC ---------------------G
G ---------------------CTTAAp5’
For restriction mapping, cut the DNA
with another enzyme
2. Uniformly labeling of DNA/RNA
（1）Nick translation
（切口平移）:
DNase I to introduce
random nicks DNA Pol I
to remove dNTPs from 5’ to
3’ and add new dNTP
including labeled nucleotide
at the 3’ ends.
（2）Hexanucleotide
primed labeling(六聚
核苷酸引物标记，
random labeling 随机
标记）:
Denature DNA  add
random hexanucleotide
primers and DNA pol 
synthesis of new strand
incorporating labeled
nucleotide.
3. Specific probes
（1）Strandspecific DNA
probes:
e.g.M13 DNA
as template the
missing strand
can be resynthesized by
incorporating
radioactive
nucleotides.
（2）Strand-specific
RNA probes
J1 Characterization of clones —
Southern and Northern blotting
1. Southern blotting, for detecting DNA ;
2. Northern blotting, for detecting RNA;
3. Western blotting, for detecting protein.
Blot type
Target
Probe
Applications
Southern
DNA
DNA or RNA mapping genomic clones
estimating gene numbers
Northern
RNA
DNA or RNA RNA sizes, abundance,
and expression
Western
Protein
Antibodies
protein size, abundance
1.Genomic DNA
preparation
2.Restriction
digestion
3.Denature with
alkali
4.Agarose gel
electrophoresis
5.DNA blotting/
transfer and
fixation
6.Probe labeling
7.Hybridization
(temperature)
8.Signal detection
(X-ray film or
antibody)
Southern analysis
Northern blotting
J2 Nucleic acid sequencing —
DNA sequencing
• Three main methods:
1. Maxam and Gilbert chemical method
 2. Sanger`s enzymatic method
 3. Sequencing by hybridization (SBH)
1. Maxam and Gilbert chemical method
The end-labeled DNA is subjected to basespecific cleavage reactions prior to gel
separation.
Modification of bases:
•
Methylation by dimethyl sulfate ：G (DMS)
•
Formic acid: Purines A & G
•
Hydrazine : hydrolyze T & C
•
Hydrazine + high salt: only C
A A A G A T T A A G C C
*
Dimethyl sulfate
Formic acid
Hydrazine
G
A+G
C+T
烷基转移酶
Hydrazine+high salt
C
2. Sanger`s enzymatic method
Uses
dideoxynucleotides
as chain terminators
to produce a ladder
of molecules
generated by
polymerase
extension of primer
Sanger’s method
A C G T
Template
+primer (15-17nt)
+dNTPs
+ddNTPs
+[35S]dATP
+T7 DNA pol
PAGE
Autoradiography
3’GTGACTACTCAGGCACTTGCTTTGCC5’
Automatic sequencer
3. Sequencing by hybridization
(SBH)
J2 Nucleic acid sequencing —
RNA sequencing
• By base-specific cleavage of 5’-endlabeled RNA using RNases that cleave
3’ to a particular nucleotide. Partial
digestion is required to generate a
ladder of cleavage products which are
analyzed by PAGE.
RNase T1: cleaves after G
RNase U2: after A
RNase Phy M: after A and U
Bacillus cereus RNase: after U and C
J2 Nucleic acid sequencing —
Sequence databases
• DDBJ(日本国家遗传学研究所)
http://www.ddbj.nig.ac.jp
• EMBL-EBI (欧洲生物信息研究所) :
http://www.ebi.ac.uk/Databases/index.html
• Genbank at NCBI （美国国家生物技术信息中
心）:
http://www.ncbi.nlm.nih.gov
J2 Nucleic acid sequencing —
Analysis of sequences
• Using computers and software packages,
such as GCG sequence analysis package.
• 1. Identify important sequence features such
as restriction sites, open reading frames,
start and stop codons, as well as potential
promoter sites, intron-exon junctions, etc.
ORF #2
ORF #1
100
200
300
400
500
600
700
Sequence analysis of a cloned
DNA sequence revealed some
important features
2. Homology search by BLAST (NCBI)
or FASTA (EBI):
Compare new sequence with all
other known sequences in the
databases, which can determine
whether related sequences have been
obtained before.
J2 Nucleic acid sequencing —
Genome sequencing projects
• With the development of automated DNA
sequencers and robotic workstations to
prepare samples for sequencing, the entire
genome sequence of several organisms have
been determined.
• Many phages and viruses
• Several Bacteria (E. coli, 4 x 106)
• Plant (Arabidopsis 6.4 x 107 , rice)
• Human 3.3 x 109
J3 Polymerase of cloned genes —
PCR
• The polymerase chain reaction (PCR)：
• To amplify a sequence of DNA using a
pair of primers each complementary to
one end of the DNA target sequence.
J3 Polymerase of cloned genes —
the PCR cycle
• Denaturation : The target DNA (template) is
separated into two stands by heating to 95℃
• Primer annealing : The temperature is
reduced to around 55℃ to allow the primers
to anneal.
• Polymerization (elongation, extension): The
temperature is increased to 72℃ for optimal
polymerization step which uses up dNTPs and
required Mg++.
J3 Polymerase of cloned genes —
Template
• Single-or double-stranded form;
• The size of the template DNA is not critical;
• In the case of mammalian or plant genomic DNA,
up to 1.0 ug of DNA is utilized per reaction. The
typical amounts of yeast, bacterial, and plasmid
DNAs used per reaction are 10 ng, 1ng, and 1pg,
respectively;
• Template DNA is dissoved in 10 mM Tris-Cl (pH
7.6) containing a low concentration of EDTA
(<0.1 mM).
J3 Polymerase of cloned genes —
Primers
• PCR primers：about 18 to 30 nt long
and with similar G+C contents.
• Tm=2(a+t)+4(g+c): determine
annealing temperature. If the primer is
18-30 nt, annealing temperature can be
Tm-5oC.
If the target DNA is not known,there is only
limited amino acid sequence available.
Degenerate primers
An oligo pool derived from protein sequence.
E.g. His-Phe-Pro-Phe-Met-Lys can generate a
primer
CAU(CAC)-UUU(UUC)-CCU(CCC,CCA,CCG)- UUU(UUC)-AUG-AAA(AAG)
2x2x4x2x2 =64
J3 Polymerase of cloned genes —
Enzymes
• The most common is Taq polymerase from
Thermus aquaticus. It has no 3’ to 5’
proofreading exonuclease activity. Accuracy
is low, not good for cloning.
• Pfu (Pyrococcus furiosus, Promega &
Stratagene),
J3 Polymerase of cloned genes —
PCR optimization
• PCR cycle
• Enzymes
• Template DNA
• Mg++
J3 Polymerase of cloned genes —
PCR variations
1. Inverse PCR, IPCR
2. Anchored PCR, APCR
3. asym metric PCR
4. Reverse transcription RT-PCR
5. 修饰引物PCR
6. Nest PCR
7. multiplex PCR
8. 重组PCR
9. differential PCR, d-PCR
10. quantitative PCR, qPCR
11. in situ PCR
12. immuno-PCR
13. Thermal Asymmetric Interlaced PCR，TAIL-PCR
J4 Organization of cloned genes —
Organization
• The absent sequences are usually
introns and sequences upstream of the
transcription start site and down
stream of the 3’-processing site.
• Start and stop sites for transcription
• regulatory sequences.
J4 Organization of cloned genes —
Mapping cDNA on genomic DNA
•
The genomic clone is digested on a gel and then
subjected to Southern blot using all or part of the
cDNA as a probe. Show which genomic restriction
fragments contain cDNA sequences
Using a probe from one end of a cDNA can show the
polarity of the gene in the genomic clone.
Some of the restriction sites will be common in both
clones but may be different distances apart.
J4 Organization of cloned genes —
S1 nuclease mapping
• Determines the precise 5’- and 3’- ends of
RNA transcripts. Sequence ladder is required
to determine the precise position.
J4 Organization of cloned genes —
Primer extension
• A primer is extended by a polymerase until the end of the
template is reached and the polymerase dissociated.
• The length of the extended product indicates the 5’end of
temple.
J4 Organization of cloned genes —
Gel retardation
Mixing a protein extract with a labeled
DNA fragment and running the mixture
on a native gel will show the presence
of DNA-protein complex as retarded
bands on the gel.
J4 Organization of cloned genes —
DNaseⅠ footprinting
• The ‘footprint’ of a protein bound
specifically to a DNA sequence can be
visualized by treating the mixture of endlabeled DNA plus protein with small
amounts of DNase I prior to running the
mixture on a gel.
• The footprint is a region with few bands in
a ladder of cleavage products.
J4 Organization of cloned genes —
Reporter genes
• To study the function of a control
element of a gene like HSP70 (promoter
and regulatory elements). Reporter
genes such as β -galactosidase or
luciferase to “report” the promoter
action.
J5 Mutagenesis of cloned genes —
Deletion mutagenesis
• In the cDNA clones,it is common to
delete progressively from the ends of
the coding region to discover which
parts of the whole protein have
particular properties.
Exunuclease III：
Unidirectional
deletion using
exonuclease III.
J5 Mutagenesis of cloned genes —
Site-directed mutagenesis
Formerly, single-stranded templates
prepared using M13 were used：Primer
oligonucleotide with desired mutation,
extension by DNA polymerase, then
ligation.
• Now PCR techniques are now preferred
J5 Mutagenesis of cloned genes —
PCR mutagenesis
• By making forward and reverse mutagenic
primers and using other primers that anneal to
common vector sequence, two PCR reactions
are carried out to amplify 5’- and 3’- portions of
the DNA to be mutated.
• The tow PCR products are mixed and used for
another PCR using the outer primers only-Part
of this product is then subcloned to replace the
region to be mutated in the starting molecule.
J6 Applications of cloned genes —
•
•
•
•
•
Applications
Recombinant protein production
Genetically modified organisms
DNA fingerprinting
Diagnostic kits
Gene therapy
J6 Applications of cloned genes —
Recombinant protein
Recombinant proteins ：Growth
hormone, insulin for diabetes，
interferon in some immune disorders，
blood clotting factor VIII in for
hemophilia.
J6 Applications of cloned genes —
Genetically modified organisms
• Introducing a foreign gene into an
organism which can propagate creates
a genetically modified organism.
• Transgenic sheep have been crested ro
produce foreign proteins in their milk.
• Cloned genes are introduced into germ
cells.
J6 Applications of cloned genes —
DNA fingerprinting
•
Hybridizing southern blots of genomic DNA with
probes that recognize simple nucleotide repeats
gives a pattern that is unique to an individual and
can be used an a fingerprint.
• This has applications in forensic science, animal and
plant breeding and evolutionary studies.
• Simple nucleotide repeats vary in number between
individuals but are inherited.
J6 Applications of cloned genes —
Medical diagnosis
• The sequence information derived from
cloning medically important genes has
allowed the design of many diagnostic test
kit which can help predict and confirm a wide
range of disorders.
• By using sequence information to screen
patients.
J6 Applications of cloned genes —
Gene therapy
• Attempts to correct a genetic disorder
by delivering a gene to a patient are
described as gene therapy.
• To treat some genetic disorders by
delivering a normal copy of the
defective gene to patients. The gene
can be cloned into a virus that can
replicate but not cause infection.
Multiple choice questions
1. A linear DNA fragment is (100%) labeled at one end and has 3
restriction sites for EcoRI. If it is partially digested by EcoRI
so that all possible fragments are produced how many of
these fragments will be labeled and how many will not be
labeled?
A 4 labeled; 6 unlabeled.
B 4 labeled; 4 unlabeled.
C 3 labeled: 5 unlabeled.
D 3 labeled; 3 unlabeled.
2. Which of the following are valid methods of labeling duplex
DNA?
A 5'-end labeling with polynucleotide kinase.
B 3'-end labeling with polynucleotide kinase.
C 3'-end labeling with terminal transferase.
D 5'-end labeling with terminal transferase.
E nick translation.
3. Which one of the following statements about nucleic acid sequencing
is correct?
A. the Sanger method of DNA sequencing involves base specific
cleavages using piperidine.
B. the Maxam and Gilbert method of DNA sequencing uses a DNA
polymerase and chain terminating dideoxynucleotides.
C. enzymatic sequencing of RNA uses RNases A, T1, Phy M and B.
cereus RNase.
D enzymatic sequencing of DNA uses a primer which is extended by an
RNA polymerase.
E enzymatic sequencing of RNA uses RNases T1, U2, Phy M and B.
cereus RNase.
4 Which one of the following statements about peR is false?
A the PCR cycle involves denaturation of the template，annealing of the
primers and polymerization of nucleotides.
B PCR uses thermostable DNA polymerases.
C ideally PCR primers should be of similar length and G+C content.
D PCR optimization usually includes varying the magnesium
concentration and the polymerization temperature.
E if PCR was 100% efficient, one target molecule would amplify to 2n
after n cycles.
5. Which two of the following statements about gene mapping
techniques are true?
A. S1 nuclease mapping determines the nontranscribed regions of a gene.
B. primer extension determines the 3'-end of a transcript.
C. gel retardation can show whether proteins can bind to and retard the
migration of a DNA fragment through an agarose gel.
D. DNase I footprinting determines where on a DNA fragment a protein binds.
E the function of DNA sequences in the promoter of a gene can be determined
if they are ligated downstream of a reporter gene and then assayed for
expression.
6. Which one of these statements about mutagenesis techniques is false?
A. exonuclease III removes one strand of DNA in a 5' to 3' direction from a
recessed 5'-end.
B. exonuclease III removes one strand of DNA in a 3' to 5' direction from a
recessed 3'-end.
C. mutagenic primers can be used in PCR to introduce base changes.
D. mutagenic primers can be used with a single stranded template and DNA
polymerase to introduce base changes.
E. deletion mutants can be created using restriction enzymes.
7. Which one of these statements about the
applications of gene cloning is false?
A large amounts of recombinant protein can be produced
by gene cloning.
B DNA fingerprinting is used to detect proteins bound to
DNA.
C cloned genes can be used to detect carriers of diseasecausing genes.
D gene therapy attempts to correct a disorder by delivering
a good copy of a gene to a patient.
E genetically modified organisms have been used to
produce clinically important proteins.
THANK YOU !