Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex) SNP Detection • Oligonucleotide ligation – AM Alves and FJ Carr. 1988. Dot blot detection of point mutations with adjacently hybridising synthetic oligonucleotide probes. Nucl. Acids Res. 16: 8733 – NICKERSON DA, R KAISER, S LAPPIN, J STEWART, LEROY HOOD, AND ULF LANDEGREN 1990 Automated DNA diagnostics using an ELISA-based oligonucleotide ligation assay PNAS 87:8923-8927 • Primer extension – Syvanen AC, Aalto-Setala K, Harju L, Kontula K, Soderlund H. 1990 A primer-guided nucleotide incorporation assay in the genotyping of apolipoprotein E. Genomics. 8:684-92 – Kuppuswamy MN, Hoffmann JW, Kasper CK, Spitzer SG, Groce SL, Bajaj SP. 1991 Single nucleotide primer extension to detect genetic diseases: experimental application to hemophilia B (factor IX) and cystic fibrosis genes. Proc Natl Acad Sci U S A. Feb 88:1143-7. Oligonucleotide Ligation 3’ 5’ TCGAAACTCATATCT CAGCGGGAGTTAGAC …ACGAGCTTTGAGTATAGAGTCGCCCTCAATCTGCCAA… DNA Ligase T TCGAAACTCATATC CAGCGGGAGTTAGAC …ACGAGCTTTGAGTATAGTGTCGCCCTCAATCTGCCAA… DNA Ligase Oligonucleotide Ligation Assay (OLA) amplify target by PCR ligate oligos detect ligation product Primer extension 3’ TCGAAACTCATATCT C C …ACGAGCTTTGAGTATAGAGTCGCCCTCAATCTGCCAA… DNA Pol C TCGAAACTCATATC …ACGAGCTTTGAGTATAGTGTCGCCCTCAATCTGCCAA… One tube = one reaction = one assay? SNP1 C SNP2 C SNP3 SNP4 C C Bead types rosary beads “test tube” bead = 5 uM 1 cM Beads can be marked Luminex beads 5.6 um, polystyrene Illumina beads 3 um, silica 1500 colorcoded types 100 colorcoded types R. J. Fulton et al., Clin. Chem. 443, 1749 (1997) Lee M, Walt DR. 2000 Anal Biochem.282:142-6. Beads can be derivatized Each bead type can be coated with one specific probe type: e.g. oligonucleotide =aggctcgatc Luminex beads are analyzed by flow cytometry one well=100 different beads=100 reactions Luminex 100 Luminex, SBCE Luminex, critical factors ddA ddG Illumina beads are analyzed through fiberoptics-ducted fluorescence excitation 1 bundle of 50k fibers -> 50k beads 1 fiber > 1 bead 96-well plate -> 0.5M beads Illumina genotyping: Golden gate Illumina genotypes Reviewing the product-bead relationship home address AGTT TCAA snp1 TCAA GTCC CAGG GTCC snp2 snp1 snp2 Multiplexing I: basic options • 100 sphere types • run 100 rx in 100 tubes • pool them and load them as a single well • not impressive, we do something like that now with fluorescent primers and the ABI 3100 Multiplexing II: advanced • Run 100 genotyping rx in a single tube • Sort each to the assigned sphere color by a zip code Multiplexing III, more advanced • oops, the scheme below does not work because different fluors will label the same ball……. Factoids Luminex Illumina Sphere types 100 1,500 Cost per snp 0.3 0.03 to 0.4 Genotypes/8 hrs 10K ? Mx Th. Gen/day 120K 300K templ. amplif. locus PCR whole genome multiplex 12-50 50-1000