Protein
advertisement
In Vivo assay for RNA-protein interactions Dana M. Schneider Loren Williams lab Outline The Ribosome Yeast three hybrid assay for RNA-protein interactions Construct vectors PCR amplify insert Restriction digest plasmids and insert Ligate vector and insert Transform ligation into E. coli Colony PCR to screen for inserts Sequence confirmation of inserts Transform plasmids into yeast Colony lift assay (qualitative) Beta-galactosidase assay (quantitative) The Ribosome: Protein and RNA Small Subuntit (SSU) Large Subuntit (LSU) ~ 22 rProteins ~34 rProteins 16S rRNA 23S rRNA 5S rRNA Ban, N., Nissen, P., Hansen, J., Moore, P. B., and Steitz, T. A. (2000) Science 289, 905-920. Selmer, M., Dunham, C. M., Murphy, F. V. t., Weixlbaumer, A., Petry, S., Kelley, A. C., Weir, J. R., and Ramakrishnan, V. (2006) Science 313, 1935-1942. Harms, J., Schluenzen, F., Zarivach, R., Bashan, A., Gat, S., Agmon, I., Bartels, H., Franceschi, F., and Yonath, A. (2001) Cell 107, 679-688. Deconstruction of the Ribosome L2 L15 a-rRNA L4 L22 L3 Do rRNA fragments interact with rProteins as in the fully assembled ribosome? Methods to detect and characterize RNA-protein interactions Electrophoretic mobility shift assay – in vitro Pull-down assay – in vitro RNase protection assay – in vitro Yeast three-hybrid assay – in vivo in vitro methods pro: know all constituents con: may not have all necessary constituents in vivo methods pro: don’t know all constituents con: may have all necessary constituents “High-jacking” transcription regulation Yeast in vivo RNA-Protein interaction of interest Phenotype DNA Binding Protein chromosome Activation Domain DNA Binding Site Gene Yeast Three Hybrid System to identify RNA-protein interactions How do we get yeast to make the RNA and protein hybrids? Hybrid 2 Yeast in vivo Hybrid 1 Hybrid 3 RNA-X MS2 Protein Activation Domain MS2 RNABinding Protein DNA Binding Protein chromosome DNA Binding Site Reporter Gene LacZ How do we make recombinant plasmids? How do they work? Recombinant Plasmid MS2 aPTC Recombinant Plasmid Activation Domain Transform into yeast Hybrid 2 Yeast in vivo Hybrid 1 rProtein Hybrid 3 RNA-X MS2 Protein Activation Domain MS2 RNABinding Protein DNA Binding Protein chromosome DNA Binding Site Reporter Gene LacZ Hybrid gene expression vectors 1. Cloning site to insert gene of interest and create hybrid gene 2. Yeast promoter to express hybrid gene 3. Yeast selective marker 4. Yeast origin of replication 5. E. coli selective marker 6. E. coli origin of replication How do we clone in the gene of interest? Recombinant DNA technology 1. Digest plasmid and gene of interest with specific restriction enzymes - “sticky end” overhangs 2. Dephosphorylate linearized plasmid 3. Ligate vector and insert 4. Transform ligation into E. coli 5. Confirm insert with PCR and sequence analysis How do we get the gene of interest with the necessary restriction sites? http://163.16.28.248/bio/activelearner/14/ch14summary.html PCR amplify gene of interest restriction sequence forward primer target gene genomic DNA reverse primer PCR restriction sequence Primer Design restriction sequence forward primer • Primer sequence • complementary to beginning and end of target gene specifically • should have no or low sequence similarity to other DNA • approximately 20 nt long • Tm approximately 60-65°C • Restriction sequence • must be absent in target sequence • must match restriction sites used to digest plasmid reverse primer restriction sequence Recombinant DNA technology Digest plasmid and gene of interest with specific restriction enzymes - “sticky end” overhangs Dephosphorylate linearized plasmid Ligate vector and insert 4. Transform ligation into E. coli 5. Confirm insert with PCR and sequence analysis http://163.16.28.248/bio/activelearner/14/ch14summary.html Transformation into E. coli ampicillin http://www.odec.ca/projects/2006/sidh6h2/bg.html Colony PCR to confirm insert forward primer transformation plate reverse primer colony PCR Extract plasmids and send for sequencing “patch” plate Sequence analysis of insert chromatogram GOOD! BAD! Sequence analysis of insert alignment GOOD! AAGTTCAAACCCTACACCCCGAGCCGCCGCTTCATGACGGTGGCCGACTTCTC AAGTTCAAACCCTACACCCCGAGCCGCCGCTTCATGACGGTGGCCGACTTCTC maybe OK AAGTTCAAACCCTACACCCCGAGCCGCCGCTTCATGACGGTGGCCGACTTCTC C G AAGTTCAAACCCTACACCCCGAGCCGCCGCTTCATG - CGGTGGCCGACTTCTC BAD! AAGTTCAAACCCTACACCCCGAGCCGCCGCTTCATGACGGTGGCCGACTTCTC C CCGA ATGAC G GA - G TGACAAGTTCAAACCCTACACCCCGAGCCGCCGCTTCATG - CGGTGGCCGACTTCTC Recombinant plasmids for the yeast three- hybrid analysis Recombinant Plasmid MS2 Recombinant Plasmid aPTC Activation Domain rProtein Transform into yeast Hybrid 2 Yeast in vivo Hybrid 1 Hybrid 3 RNA-X MS2 Protein Activation Domain MS2 RNABinding Protein DNA Binding Protein chromosome DNA Binding Site Reporter Gene LacZ Co-transformation both plasmids into yeast Yeast strain is mutant: ΔLEU2, ΔADE2, ΔURA3, ΔTRP1, ΔHIS3 Selective plates lack leucine and adenine http://2011.igem.org/Team:WashU/Notebook/Transformation Yeast three hybrid assay for RNA-protein interactions Construct vectors PCR amplify insert Restriction digest plasmids and insert Ligate vector and insert Transform ligation into E. coli Colony PCR to screen for inserts Sequence confirmation of inserts Transform plasmids into yeast Colony lift assay (qualitative) Beta-galactosidase assay (quantitative) Yeast 3 Hybrid Experiment MS2 aPTC Activation Domain CM-AL = Media with all nutrients EXCEPT adenine and leucine aPTC MS2 L4 Yeast in vivo chromosome Activation Domain MS2 Coat Protein DNA Binding Protein DNA Binding Site LacZ L4 Colony lift assay “Lift” colonies onto sterile filter paper Add X-gal (5-bromo-4-chloro-indolyl-β-D-galactopyranoside) galactose linked to a substituted indole. turns blue when cleaved by β-galactosidase (LacZ) Blue spots = positive RNA-protein interaction Qualitative only Quantitative β-galactosidase Assay Grow replicates in 96-well plates Add ONPG (ortho-Nitrophenyl-β-galactoside) colorimetric and spectrophotometric galactose linked to ortho-nitrophenol Turns yellow and has O.D. at 420 nm wavelength when cleaved by β-galactosidase OD420nm = “strength” of RNA-protein interaction 0.041 0.041 0.042 0.042 0.042 0.042 0.042 0.04 0.041 0.041 0.049 0.042 0.043 0.042 0.044 0.043 0.351 0.362 0.348 0.348 0.315 0.299 0.297 0.27 0.558 0.553 0.55 0.512 0.52 0.491 0.48 0.476 0.633 0.641 0.647 0.65 0.63 0.621 0.638 0.621 0.341 0.36 0.353 0.343 0.329 0.353 0.353 0.308 0.656 0.669 0.665 0.663 0.655 0.651 0.647 0.631 0.293 0.294 0.286 0.293 0.298 0.266 0.243 0.17 0.15 0.152 0.142 0.154 0.149 0.142 0.125 0.097 0.609 0.617 0.595 0.601 0.594 0.561 0.51 0.403 0.042 0.043 0.043 0.043 0.043 0.042 0.044 0.042 0.042 0.041 0.042 0.043 0.042 0.042 0.041 0.041 In vivo interactions of a-rRNA γ and DIII with L2, L3, L4, L15, L22, L23, and L34 RNA Hybrid What are your conclusions from this graph? Thanks!
