Arabidopsis Gene
Project
GK-12 April Workshop
Karolyn Giang and Dr. Mulligan
Reverse genetics

An approach used to determine the
function of a gene from known DNA
sequence
BLAST: Basic Local Alignment Search Tool
Gene project
You are working on an Arabidopsis gene discovery project,
and your job is to sequence cDNAs and then learn all you
can about the genes from all types of databases: DNA
sequence, genome, and publication databases.
Query sequence:
TCCTGCATTCAATGTGATCAATGGAGGCAGTCATGCTGGGAATAGTTT
GGCTATGCAAGAGTTTATGATACTACCTGTAGGAGCTACCTCATTCTC
GGAGGCCTTCCAGATGGGAAGTGAAGTTTATCATACATTGAAGGGGA
TAATCAAAACTAAGTATGGTCAAGATGCTTGTAATGTCGGAGATGAAG
GAGGGTTTG
NCBI homepage
1. What is the name of the gene that the
unknown cDNA sequence is derived from?
1. What is the name of the gene that the
unknown cDNA sequence is derived from?
1. What is the name of the gene that the
unknown cDNA sequence is derived from?
2.
Identify
this
gene
bythe
1. What
is the
the location
name ofof
the
gene
that
Arabidopsis thaliana chromosome and
unknown cDNA sequence is derived from?
genome locus.
2. Identify the location of this gene by
Arabidopsis thaliana chromosome and
genome locus.
3. What is the function
of this gene?
4. How many nucleotides are in the
coding sequence of this gene?
4. How many nucleotides are in the
coding sequence of this gene?
1434 nucleotides
5. What sequence of amino acids is
encoded by your unknown cDNA sequence?
6.In the Arabidopsis genome, what other gene has
the most similar protein sequence to your gene?
6.In the Arabidopsis genome, what other gene has
the most similar protein sequence to your gene?
6.In the Arabidopsis genome, what other gene has
the most similar protein sequence to your gene?
7. In the human genome, what is the most
closely related gene to your Arabidopsis gene?
7. In the human genome, what is the most closely
related gene to your Arabidopsis gene?
8. What T-DNA insertion for this gene
would be likely to knock out gene function?
8. What T-DNA insertion for this gene
would be likely to knock out gene function?
8. What T-DNA insertion for this gene
would be likely to knock out gene function?
8. What T-DNA insertion for this gene
would be likely to knock out gene function?
9.Give a literature citation to a research article that
studied a knock out of this gene in Arabidopsis.
9.Give a literature citation to a research article that
studied a knock out of this gene in Arabidopsis.