Transcription and Translation Practice
TACGCTGACGAGAAATTAATTTCCTTGACT
Write the mRNA
Translate the mRNA
into a protein.
Chapter 18
Your mama is a llama…
Well, she actually just shares many genes
with a llama. So do you. No spitting, please.
I.
Bacteria, Environment, & Gene Expression
A. Operons
1. A group of genes involved in the same process
controlled by one promoter.
a) Called a transcription unit
2. One long mRNA is produced for all the genes.
a) Proteins are translated separately…not one big
protein.
3. Operator – control module for transcription
a) Contained within the promoter or between
promoter and start site
b) Controls access of RNA pol to genes
4. Benefit: One on/off switch controls all genes in
pathway
a) Called coordinate control
B.
The Tryptophan Operon (Repressible Operon –
usually anabolic)
1. Five genes encode enzymes for tryptophan
synthesis.
2. Default setting in “on” for transcription
a) trp repressor binds operator to turn
transcription off.
Trp repressor is a
1) trp repressor is allosteric protein
regulatory gene. It
2) in absence of tryptophan, trp repressor is
is expressed
continuously but not off
necessarily in its
3) when tryp is present, it binds repressor,
active form
activating it so it turns off operon
4) Tryp is a corepressor in this instance
C.
Lac Operon (Inducible Operon – usually catabolic)
1. Three genes involved in lactose digestion
a) Default setting is off
2. lacI is a repressor protein. (regulatory gene)
a) Synthesized in an active form
b) An inducer protein (allolactose) binds to lacI
protein and inactivates it.
1) Allolactose is a form of lactose so when
you eat dairy it is there.
Both of these operons are under negative control. Negative because the
object that binds the operator of the operon is a repressor.
D.
Positive Regulation of the Lac Operon
1. The Battle between Good (glucose) and Not-asgood (lactose)
a) Meaning the cell will use glucose as food
source if it is available.
2. Catabolite Activator Protein (CAP) is a gene
activator
a) Default state is inactive
b) When glucose is scarce, cAMP is produced.
c) cAMP binds CAP and activates it, which goes
and activates the lac operon.
3. If glucose is present, then CAP is inactive and
operon is much less active, even if lactose is
present.
II. Eukaryotic Gene Regulation
A. Differential Gene Expression
1.The expression of different genes by cells with the
same genome.
2. Differentiated cells express a low percentage of
the total # of genes
3.Many different control points for control of gene
expression
B. Control via Chromatin Structure
1. location of promoter relative to histones.
2. location in heterochromatin or euchromatin
3. Chemical modification of histones
a) N terminus of histones is accesible for
modification
b) acetylation – prevents binding to neighboring
nucleosomes.
1) makes DNA more accessible
c) methyl groups – makes DNA less accesible
d) phosphate next to methyl – makes DNA more
accessible.
e) histone code hypotesis – modification of
histones determines chromatin structure and
therefore gene regulation
4. DNA methylation
a) inactive DNA is highly methylated
1) inactive X-chromosomes
b) removal of methylation activate histone
acetylation…gene expression
c) seems to be more permanent
d) genomic imprinting – methylation of either
paternal or maternal allele for expression
from one chromosome only.
5.
Epigenetic Inheritance
a) changes in phenotype (appearance) or gene
expression caused by mechanisms other
than changes in the
underlying DNA sequence
b) passed on from one cell to another in DNA
replication and cell division
c) often involves modifications to chromatin
d) often a factor in development and
differentiation of cells.
C. Regulation of Transcription Initiation
1. Control elements play a key role
a) sequences of DNA where other proteins bind
to control transcription.
2. Transcription Factors
a) general transcription factors required for all
transcription
b)
Enhancers and specific transcription factors
1) proximal control elements – located close
to promoter
2) distal control elements – located farther
away…called enhancers
a} may be upstream or downstream
b} other proteins may bend DNA bringing
enhancer closer to promoter
c} proteins binding at enhancer interact
with RNA pol to initiate transcription.
d} repressors may block RNA pol or
prevent other transcription factors from
interacting with RNA pol.
e} repressors may affect chromatin
structure via recruitment of histone
modifiers
f} seems to be a common method for
silencing genes
c) Combinatorial control of expression
1) enhancers have binding sites for multiple
proteins (control elements)
2) however only one or two proteins may
bind enhancer
3) combination of control elements controls
transcription.
d)
coordinately controlled genes
1) some genes that work on the same
process are located near each other in
genome.
2) changes in chromatin structure affect all
those genes at one time
3) some related genes share a promoter but
create multiple mRNAs (bacteria operon
only one mRNA)
4) more often, combination of control
elements controls all genes in the group
(like metabolic pathway genes) even if
on different chromosomes.
5) sometimes an extracellular signal enters
the cell and binds a transcription factor
activating it and allowing for the
expression of multiple related genes
(steroid production)
6) signalling molecules can do the same
thing via signalling pathways.
D. Post transcriptional control of expression
1. RNA processing
a) alternative RNA splicing
1) different RNA from same mRNA due to
splicing differences
2) controlled by regulatory proteins
b) mRNA degradation
1) specific sequences in the untranslated
region (UTR) dictate how long an mRNA
exists
2. Initiation of Translation
a) regulatory proteins may bind mRNA
and prevent translation
b) some stored mRNA in eggs (not
chicken) have no poly-A tail…no
translation.
1) poly A tail added later in
development.
c) global control of general translation
factors
1) in eggs translation factors are
inactive until fertilization occurs.
2) light and darkness can also control
translation factor activity
3. protein processing and degradation
a) proteins are often modified after translation
b) modification proteins controlled by phosphate
addition and removal
c) regulation could also occur at the
transportation level.
d) protein lifespan is also controlled
1) tagging of proteins with ubiquinone
signals their degradation by proteasomes.
2) mutations in proteasomes can cause
cancer
III. Non-protein coding RNAs and Gene Expression
A. Effect of miRNAs
1. microRNAs (miRNA) bind to sequences in mRNA
2. Production of miRNA
a) Once transcribed, fold back upon themselves
creating multiple hairpins
b) Hairpins are cut from one another by the
Dicer and one of the hairpin strands is
removed
c) miRNA binds and protein and whole complex
binds mRNA
d) Binding of miRNA complex either blocks
translation or signals for degradation
B.
RNA interference and small interfering RNA
1. Experimentally: injection of double stranded
RNA blocked gene expression of mRNA with
same sequence
2. siRNA do the same thing
a) siRNA differ from miRNA is that they come
from much longer double stranded RNA
b) Many siRNAs come from one double
stranded RNA
c) siRNAs identified in fruit flies and c. elegans
C.
Chromatin Remodeling and Silencing by small RNAs
1. Important for formation of heterochromatin in
yeast
2. Bind to DNA and recruit enzymes that modify
DNA making it heterochromatin
3. Evidence: inactivation of Dicer results in no
heterochromatin formation in chicken and
mouse cells
IV. Differential gene expression and cell differentiation
Embryonic Development
Cell differentiation – the process by which cells
become specialized in structure and function.
Morphogenesis – physical processes that give an
organism its shape.
Big Question: How do different sets of activators
come to be present in two cells?
A.
Cytoplasmic Determinants and Inductive Signals
1. Proteins and mRNA are present in the
unfertilized egg (cytoplasmic determinants)
a) Not evenly distributed throughout the egg
b) First cell divisions result in unequal
distribution of the proteins and RNA in new
cells
c) Different proteins = different genes
activated
2. Cell-cell interactions also play a role (induction)
a) Binding of cell surface receptors (signalling
pathways) results in activating of different
genes
B.
Sequential regulation of gene expressions
Determination – the events that lead to the
observable differentiation of a cell
•
Once determination occurs, it is irreversible
1. Determination caused by the expression of
genes which encode of tissue specific proteins
2. Master Regulatory Genes
a) Key genes involved in the determination of a
cell
b) Often these are transcription factors that
activate other tissue specific proteins
C.
Pattern formation: setting up the body plan
1. Begins very early
a) Establishment of the major axes of the
embryo
b) This positional information is provided by
cytoplasmic determinants and inductive
signals
2. Drosophila
a) Fed drosophila mutagens and then looked at
dead larvae with pattern formation
mutations.
1) Identified 1200 genes involved in pattern
formation
2) 120 genes involved in segmentation
b)
Axis establishment in drosophila
1) Maternal effect genes are genes that encode for
proteins or mRNA that are put into the egg
during oogenesis
a} often called egg polarity genes
2) Example: bicoid
a} bicoid mutants have no anterior end…two
posterior ends form
b} there must be a morphogen gradient meaning
a gradient of proteins involved in anterior
posterior identity
c} found experimentally that bicoid mRNA is
concentrated at one end of egg.
d} if inject bicoid protein into different places of
the embryo get anterior formation occuring in
multiple places.
V.
Cancer mutations and the cell cycle
A. Types of Genes associated with Cancer
1. Growth factors, growth factor receptors,
intracellular molecules of signalling pathways
2. Viruses can also cause cancer
a) HPV (Papillomaviruses) – cervical cancer
1) Sexually transmitted disease
2) Debate to vaccinate young girls (11-12)
3) Will it encourage them to be sexually
active if they are protected from a STD?
3.
Oncogenes and proto-oncogenes
– Proto-oncogene is a gene involved in the cell
cycle. It is called an oncogene when a
mutation in it causes cancer
a) Usually mutation causes and increase in the
amount of protein produced or the proteins
activity
b) Causes:
1) movement of DNA – cancer cells often
have broken chromosomes (one piece
translocated onto another) and gene is
placed near an enhancer that expresses
it more than normally.
2) amplification of DNA – increase in the
number of copies in the cell
3) mutation in control element or gene
4.
Tumor-supressor genes
a) Normal versions of these genes inhibit cell
division
b) Functions
1) Repair damaged DNA
2) Cell adhesion to other cells or ECM
3) Components of cell-signaling pathways
B. Interference with Cell-signaling pathways
1. ras proto-oncogene
a) G-protein involved in a growth factor
receptor. Activates a kinase
1) Normal end result is increase in cell
division
2) Mutation in ras results in hyperactive
protein that is always activating kinase.
2.
p53
a) Transcription factor that stimulates proteins
that inhibit cell cycle when there is DNA
damage
1) p53 also controls DNA repair genes.
2) p53 can also activate apoptosis genes if
DNA damage is too significant
C.
Multi-step model for cancer development
1. Multiple mutations are necessary for cancer to
develop.
2. Since there are two copies of almost every
gene, both copies must often be mutated.
3. Cancers usually involve one oncogene mutation
or mutations in multiple tumor supressor genes
4. Hence, cancer more likely to develop later in life
D. Genetic Predisposition to Cancer (Inheritance)
1. If you inherit one bad gene, you are closer to
developing cancer than someone who hasn’t.