acquired alterations of IGH and TCR loci in

advertisement
Acquired alterations of
IGH and TCR loci in
lymphoproliferative
disorders
Sabine Franke, PhD
CHU Liège, Centre for Human Genetics
Interuniversity course - HUMAN GENETCIS
20/04/12 ULG
Overview

what are lymphoproliferative disorders?

what are IGH and TCR?

what are alterations and how to detect them?
Blood cell development
2 major types
of lymphocytes:
B and T cells
Lymphoproliferative disorders (LPDs)
LPDs refer to several conditions in which lymphocytes are
produced in excessive quantities.










Chronic lymphocytic leukemia
Acute lymphoblastic leukemia
Hairy cell leukemia
lymphomas
Multiple myeloma
Waldenstrom’s macroglobulinemia
Wiskott-Aldrich syndrome
Post-transplant lymphoproliferative disorder
Autoimmune lymphoproliferative syndrome (ALPS)
‘Lymphoid interstitial pneumonia’
B, T, and NK lineage of lymphoid
malignancies
Lymphoid malignancy
B lineage
T lineage
Acute lymphoblastic leukemia
– children
82 – 86%
– adults
75 – 80%
14 – 18%
20 – 25%
Chronic lymphocytic leukemias 95 – 97%
3 – 5%
Non-Hodgkin lymphomas
– nodal NHL
– extranodal NHL
– cutaneous NHL
Multiple myeloma
95 – 97%
90 – 95%
30 – 40%
100%
3 – 5%
5 – 10%
60 – 70%
0%
NK lineage
< 1%
< 1%
1 – 2%
< 2%
< 2%
< 2%
0%
Blood cell development
Gene rearrangements
of the antigen receptor
genes occur during the
lymphoid proliferation
The ability to produce billions of different antibodies in
humans results from the production of variable regions
of light and heavy antibody genes by DNA rearrangement.
The five major classes of heavy chain
are IgM, IgG, IgA, IgD, and IgE.
http://www.biology.arizona.edu
Schematic representation of an
immunoglobulin


Identify lymphocyte populations derived from
one single cell using the unique V-J gene
rearrangements present within these antigen
receptor loci.
These gene rearrangements generate products
that are unique in length and sequence
in each cell.
The production of variable regions of light and
heavy antibody genes by DNA rearrangement.
stepwise rearrangement of V, D, and J gene segments
(junctional region)
Genes encoding
antigen receptors are
unique:
-high diversity
-developing
lymphocytes through
V(D)J rearrangement.
T-cells
T-cells have receptor gene rearrangement.
T-cell receptor gene rearrangement
The variable domain of both the TCR α-chain and β-chain
have three hypervariable or complementary determining regions (CDRs)


Receptor for antigen on the majority
of mature T-cells consists of two
polypeptides alpha and beta that are
linked by disulphide bonds and are
associated with CD3
A small population of mature T-cells
express a different TCR heterodimer
in association with CD3. This is
composed of two polypeptides
designated gamma and delta
So how much variation is possible through
recombining gene fragments?
Over 15,000,000 combinations of variable, diversity and joining
gene segments are possible.
Imprecise recombination and mutation increase the variability
into billions of possible combinations.
Estimated diversity of human Ig and TCR
molecules
Number gene segments
V gene segments
D gene segments
J gene segments
IgH
Igα
Ig‫ג‬
molecules
~44
27
6
~43
Total diversity
4
>2x10 6
Combination diversity
Junctional diversity
5
~38
++
+
>10 12
TCR α
β
γ δ
molecules
~46 ~47
2
53 13
2x10 6
+
+
>10 12
++
~6 ~6
3
5 4
<5000
++ ++++
>10 12
Clinically relevant testing
• Reactive versus malignant
• B-cell versus T-cell malignancy
• New lymphoma versus recurrence
• Assessment of remission and relapse
• Clinically relevant: bone marrow involvement
(relation with prognosis)
• Evaluation of treatment effectiveness
detection of minimal residual disease - treatment
PCR
Discrimination between monoclonal and polyclonal
Ig/TCR gene PCR products


GeneScanning analysis
Fast, accurate, sensitive
non-quantitative monitoring of clonal
proliferations
Need sequence equipment
Heteroduplex analysis
Sensitivity ~5-10%
available to most laboratories
Design of novel primer sets for detection of
Ig/TCR rearrangements
BIOMED-2 study (multiplex PCR)
Ig genes:
IGH:
IGK:
IGL:
VH-JH and DH-JH
V-J and Kde rearrangements
V-J
TCR genes: TCRB: V-J and D-J
TCRG: V-J
TCRD: V-J, D-D, D-J, and V-D
BIOMED-2 clonality strategy
Suspected
B-cell lymphoma
IGH V(D)J FR1, FR2, FR3
IGH DJ(A)
IGK-VJ and DE
Suspected lymphoma
of unknown origin
Suspected
T-cell lymphoma
TCRGVJ (A and B)
TCRB V(D)J (A and B)
TCRB DJ
Van Dongen et al Leucemia 2003
PCR GeneScan analysis
BIOMED-2 Concerted Action BMH4-CT98-3936: PCR-based clonality studies
polyclonal
lymphocytes
IGH
tube C: VH-FR3
region
JH
monoclonal
leukemia
IGH
tube C: VH-FR3
region
JH
Example BIOMED-2 multiplex IGH
VH-FR2–JH
VH
DH
JH primer
Use of controls
tonsil
ES-6
GBN-10
FR-5
PB-MNC
VH-FR2 primers
MwM
JH
bp
100
150
100
50
0
PB-MNC
100
800 700 600 500 400 -
300
200
100
0
4500
3000
1500
0
IGH tube B VH-FR2–JH
4500
3000
1500
0
250-295 nt
200
300
400
200
300
400
200
300
400
200
300
400
GBN-10
100
200 -
400
ES-6
100
300 -
300
tonsil
100
3750
2500
1250
0
200
FR-5
BIOMED-2 report: Leukemia 2003; 17: 2257-2317
From the patient to the analysis




Selection of material
protocol
Check DNA quality
Clonality analysis
Examples of cases


Lymphoma?
Relapse?
Case 1






Female
63 years
Lymphoma in dec. 2004
FR1 polyclonal, FR3 monoclonal
Feb. 2009 biopsy
Relapse?
GeneScan analysis of controls
H2O
Case 1: Relapse?
FR3
2/2009
Biopsie
FR3: 152 bp
12/2004
12/2004
Biopsie
FR3: 152 bp
2000
600
Results
Controls ok
B-cell targets:
IGH(VDJ) FR3 clonal
Molecular conclusion:
Clonal rearrangement of the IGH gene
was detected in this specimen.
This gene rearrangement profile is identical to the
one detected in the biopsie of 12/2004 and
confirms the relapse of the disease.
Case 2




Female
81 years
Biopsie
Lymphoma?
Case 2
2700
100
3/2009
biopsie
FR1
327,11 bp
control
Results
Controls ok
B-cell targets:
IGH(VDJ) FR1 monoclonal
FR2 monoclonal
Molecular conclusion:
Clonal rearrangements of the IGH gene
were detected in this specimen.
This gene rearrangement profile fits to the presense of a
monoclonal B-cell population/B-NHL.
Analysis of TCRB gene rearrangements
V
J
D
V family primers
J primers
TCRB tubes A and B
V2
V4
V5/1
V6a/11
V6b/25
V6c
V7
V8a
V9
V10
V11
V12a/3/13a/15
V13b
V13c/12b/14
V16
V17
V18
V19
V20
V21
V22
V23/8b
V24
5'
3’
AACTATGTTTTGGTATCGTCA
(-204)
CACGATGTTCTGGTACCGTCAGCA
(-201)
CAGTGTGTCCTGGTACCAACAG
(-197)
AACCCTTTATTGGTACCGACA
(-201)
ATCCCTTTTTTGGTACCAACAG
(-201)
AACCCTTTATTGGTATCAACAG
(-201)
CGCTATGTATTGGTACAAGCA
(-198)
CTCCCGTTTTCTGGTACAGACAGAC
(-201)
CGCTATGTATTGGTATAAACAG
(-198)
TTATGTTTACTGGTATCGTAAGAAGC
(-201)
CAAAATGTACTGGTATCAACAA
(-198)
ATACATGTACTGGTATCGACAAGAC
(-198)
GGCCATGTACTGGTATAGACAAG
(-198)
GTATATGTCCTGGTATCGACAAGA
(-198)
TAACCTTTATTGGTATCGACGTGT
(-201)
GGCCATGTACTGGTACCGACA
(-198)
TCATGTTTACTGGTATCGGCAG
(-201)
TTATGTTTATTGGTATCAACAGAATCA
(-201)
(-193, inv) CAACCTATACTGGTACCGACA
TACCCTTTACTGGTACCGGCAG
(-201)
ATACTTCTATTGGTACAGACAAATCT
(-201)
CACGGTCTACTGGTACCAGCA
(-201)
CGTCATGTACTGGTACCAGCA
(-197)
D1 primer
TCRB tubes A and C: J A primers
3'
5'
GTGGTCTAAGTGTCAACATCCATTC
CTGGTCCAATTGGCAACATCCATTC
TTCAACCGAGTGACAACATCCATTC
CTTGGGTCGAGAGACAGAACCCATAC
CTGAGCTGAGAGGTAGGATCCATTC
GTCCGAGTGACACTGTCCATAC
TCCGACTGGCATGACCCATTC
TCCGACTGGCACGACCCGCTC
GTCCGAGTGCCAATGTCCATTC
(+53)
(+53)
(+55)
(+56)
(+55)
(+58)
(+56)
(+58)
(+52)
J1.1
J1.2
J1.3
J1.4
J1.5
J1.6
J2.2
J2.6
J2.7
TCRB tubes B and C: J B primers
3'
5'
AGTGGCACGATCCATTCTTCC
ACTGTCACGAGCCATTCGCCC
AGAGTCACGACCCATTCGACC
CACGAGCCACACGCGC
D
D2 primer
(+59)
(+58)
(+59)
(+57)
J2.1
J2.3
J2.4
J2.5
J
J primers
TCRB tube C
D1
(-252)
5'
3'
GCCAAACAGCCTTACAAAGAC
5'
3'
D2 (-137) TTTCCAAGCCCCACACAGTC
BIOMED-2 report: Leukemia 2003; 17: 2257-2317
BIOMED-2 multiplex TCRB tube B
V
D
J B primers
200
300
400
300
400
200
300
400
200
300
400
240-285 nt
ES-6
PB-MNC
ES-9
Cell line PEER
PB-MNC
thymus
MwM
V family primers
750
500
250
0
bp
200
800 -
ss
he
400 -
ho
200 -
TCRB tube B V-J
J
1350
900
450
0
2100
1400
700
0
2000
1600
1200
800
400
0
cell line PEER
ES-9
ES-6
BIOMED-2 report: Leukemia 2003; 17: 2257-2317
Use of clonality analysis
1. Making the diagnosis
Normal  reactive  malignant
2. Involvement (staging)
3. Assessment of remission and relapse
Normal  reactive  malignant
4. Evaluation of treatment effectiveness
- detection of minimal residual disease (MRD)
MRD-based risk-group stratification (treatment
reduction or treatment intensification)
Detection of abnormality at molecular level

PCR

Southern blot

FISH
Southern blot




Large region
Large quantity of high molecular weight DNA
Less sensitive
Labor intensive
FISH – Fluorescence in situ hybridization



Relative large region
Translocation partner has not te be known
On metaphases and nuclei
Split-signal FISH
Gene A
breakpoint
region
no translocation
translocation
Advantages:
- detection of aberrations is independent of partner genes
- minimisation of false positivity
- identification of partner gene (or chromosome region), if metaphases are present
Split-signal FISH for human Ig genes
IGH gene complex (#14q32.3)
VH1 VH2 VH3
VH66
JH iE s
DH
C
C
s
s
C 2
C 3
s
C1
C 4
s

s
C1
1 2 3 4 27 123456
IGH-U

s
C
(612 kb)
IGK gene complex (#2p11.2)
V1 V 2 V3
V76
J
intron RSS
IGH-D
(460 kb)
iE
C
3’E
Kde
1 23 4 5
IGK-U
IGK-D
IGL gene complex (#22q11.2)
V1 V2 V3
V56
J C1
J C2
J C3
J 4
J 5
J 6
IGL-U
IGL-U
IGL-D
(309 kb)
(520 kb)
(343 kb)
J C7
E
s
C 2
3’E
Split-signal FISH for human TCR genes
TCRA and TCRD gene complex (#14q11.2)
V1 V2 V3 V4 V5
Vn
V1
J
Rec
J
functional V : 46
C
functional J : 53
V2
D J C V3
TCRA/D-U
TCRA/D-D
1 2 3 1 42 3
TCRB gene complex (#7q34)
V1 V2 V3 V4 V5
Vn
D1 J1
C1
D2
1 2 34 5 6
functional V: 47
J2
C2
1 23 4 56 7
~20 kb
TCRB-U
TCRB-D
TCRG gene complex (#7p14)
V 2 V 3 V 4 V 5
V 7 V 8
V 9
V 10
V 11
J 1
1 2 3
functional V: 6
TCRG-U
C1
J 2
C 2
1 3
TCRG-D
Prognostic value of chromosomal aberrations
Chromosome
aberration
t(1;19)(q23;p13)
Genes
involved
E2A-PBX1
Effect
Occurrence
Prognosis
fusion
30% pre-B-ALL
intermediate
t(4;11)(q21;q23)
MLL-AF4
fusion
40% infant ALL
poor
t(9;22)(q34;q11)
BCR-ABL
fusion
35% adult ALL
poor
t(12;21)(p13;q22) TEL-AML1
fusion
25% childhood ALL
good
del(1p32)
SIL-TAL1
TAL1 
15% childhood T-ALL
intermediate
t(8;14)(q24;q32)
IGH-MYC
MYC 
90% Burkitt’s lymphoma good
t(11;14)(q13;q32) BCL1-IGH
poor
Cyclin D1 
t(14;18)(q32;q21) BCL2-IGH
BCL2 
>90% FCL
intermediate
t(2;5)(p23;q35)
fusion
50% ALCL
intermediate
NPM-ALK
>90% MCL
FISH
•
Excellent diagnostic tool for detection of well-defined
chromosome aberrations
•
Can also be used on tissue sections
•
Requires limited handlings
usage of directly labeled probes
•
Split-signal FISH has several major advantages
– detection of aberrations, independent of partner gene
– minimization of false-positive results
– identification of partner gene or affected chromosome
region, if metaphases are available
Summary
Gene rearrangements of the antigen receptor
genes occur
during the lymphoid proliferation
 These gene rearrangements generate products
that are
unique in length and sequence in each cell.
 Unique length allows by PCR discrimination of
monoclonality and polyclonality
 Standardized protocol (BIOMED-2)

Download
Related flashcards

Population genetics

22 cards

Mitochondrial diseases

16 cards

Epigenetics

15 cards

Medical genetics

20 cards

Create Flashcards