Environmental DNA
‘eDNA’
Karen Mock & Torrey Rodgers
Utah State University
Noninvasive Genetic
Sampling
Species Identification
•
•
•
•
•
e.g.
Not individual ID
Presence/Absence Data
Assay designed to ID a particular species or
group of species
Requires comparison with known reference
sequences
Often a mitochondrial genome target sequence
CTATACGGGTCNGCCCTATTAGTCATTTTATCAT
CATATTTCCAAGGTATTCTATTCCCTTCACCCAA
CCGACTAATTAATAACCGCCTAGTCTCACTACAC
AATGACTAGTACAACTAAATCAAAACAAATACG
GAA
eDNA
is DNA that can be extracted from
environmental samples without capturing or
even seeing the target organism.
DNA may be cellular or extracellular
Substrate may be water, snow, soil, vegetation…
Target may be single species, a small number of
species, or everything present (meta-barcoding).
How it Works
Field
Lab
Uses quantitative PCR (qPCR) to detect certain species;
can be more sensitive and more specific than
conventional PCR
Taxon-specific PCR primers and probe to detect a particular DNA
sequence in a mixture of DNA molecules from different sources.
http://bebol.myspecies.info/node/80
eDNA applications
• Species distribution
especially for rare, endangered, or cryptic species
• Early detection of invasive species
• Relative density
Species distributions
• Especially useful for rare, endangered, or cryptic species
Species
Location
Citation
Rocky Mountain tailed frog
Idaho giant salamanders
Idaho
Goldberg et al. 2011
Pilliod et al. 2013
Eastern Hellbender
Indiana, Missouri, Ohio,
Kentucky, North Carolina
Olsen et al. 2012
Santas et al. 2013
Spear et al. 2015
Bull Trout
Montana
Wilcox et al. 2013
Brook Trout
Massachusetts
Jane et al. 2014
Great Crested Newt
United Kingdom
Biggs et al. 2015
Weather Loach
Denmark
Sigsgaard et al. 2015
Cetaceans
Denmark
Foote et al. 2014
Spadefoot Toad, Great Crested Newt,
Weather Loach, White-faced darter,
Eurasian otter
Throughout Europe
Thomsen et al. 2002
Chinook Salmon
Upper Columbia River Basin
Laramie et al. 2015
Invasive Species Detection
• Early detection of invasive species before they become established
• eDNA may be able to detect invasive species prior to traditional
methods
Species
Location
Citation
Bighead Carp (Asian carp)
Great lakes region
Jerde et al. 2011, 2013
Mahon et al. 2013
Burmese Python
Florida
Piaggio et al. 2014
American Bull Frog
France
Dejean et al. 2012
New Zealand Mud Snail
Idaho
Goldberg et al. 2013
Zebra Mussel
Michigan
Egan et al. 2013
Bluegill
Japan
Takahara et al. 2013
Red Swamp Crayfish
France
Treguier et al. 2014
Didymo (Rock Snot)
New Zealand,
Western US
Cary et al. 2007
Mock, Rodgers, Olsen
Unpublished
Relative Density
• The quantity of eDNA (from qPCR) in a sample should
correlate with species biomass and thus density
Fig. 2 Combined scatter plots of
eDNA shedding rate against
biomass of fish in tanks.
Klymus et al. 2015
Relative Density
eDNA vs. traditional kicknet surveys
Pilliod et al. 2013
Relative Density
• In fish, eDNA shedding rates may vary with diet
(Klymus et al. 2015)
• More research needed to determine eDNA shedding
rates, across species and environmental conditions
• Such factors may bias the link between biomass and
relative density
• More empirical lab and field studies needed
compare eDNA quantities and relative density
Sampling Considerations
• eDNA persistence/degradation
• Movement of eDNA in lotic systems
• Cross contamination and false positives
eDNA persistence/degradation
• In fresh water, eDNA degrades, and is no-longer detectable, in
days or weeks (at longest 58 days, Strickler et al. 2015)
Fig.1. Time-dependant changes in eDNA concentration after
fish removal . Maruyama et al 2014
• Thus eDNA detection should be indicative of contemporary
species presence
eDNA persistence/degradation
• eDNA degradation is influenced by temperature, UV and pH
• Environments favorable for microbe activity increase rate of
eDNA degradation (Strickler et al. 2015)
• eDNA may persist much longer, (from months to hundreds of
years) in aquatic sediments (Turner at al. 2015).
Movement of eDNA in lotic systems
• In lotic systems, is eDNA detection indicative of local
presence, or presence upstream instead?
Controlled experiment with caged trout
eDNA still detectable at 239m from cage site
Low flow 4-7 L/s
High flows >10 L/s
Jane et al. 2014
Movement of eDNA in lotic systems
In two invertebrate species, eDNA was detectable up to nearly 12 kilometers
from the source
Cross contamination
• It is very important to avoid cross contamination in the field
and lab to avoid false positives
• Careful handling of samples (changing gloves between
samples)
• Bleach decontamination of collection equipment between
sites
• Inclusion of field negative controls to monitor for
contamination
Novel eDNA applications
• Moving eDNA beyond aquatic environments to terrestrial
environments
•
•
•
•
•
eDNA from browsed vegetation
eDNA from drinking water
eDNA from snow tracks
eDNA from invertebrate “samplers”
eDNA from salt licks?
• Any other ideas?
• Used eDNA from saliva on browsed twigs to
identify ungulate species (moose, roe deer, fallow
deer and red deer)
• Found the DNA could be amplified up to 12 weeks
later
• Could be used to study browsing habits of
different species without direct observation
• Could be used to detect rare ungulates
eDNA from drinking water
• eDNA sampling of watering holes could be used to detect
species that drank there
• We were able to recover and sequence coyote eDNA from
drinking water at the Coyote research facility
• Could be especially useful to survey desert species
e.g. kit foxes in S. Utah
eDNA from Snow Tracks
• eDNA extracted from snow tracks of Polar
bear
•
http://www.worldwildlife.org/stories/polar-bear-research-in-arctic-pioneers-new-technique-to-extract-dna--3
2012
• Used mammalian DNA in blood collected from leeches
• 21 of 25 leeches collected in Vietnam contained
mammal DNA from 6 different species
• This included the recently discovered (in 1997) and
extremely rare Truong Son munjtac
• Used DNA from carrion flies, flies which feed on
dead animals and wounds on live animals and
scat
• Of 115 flies collected in Africa and Madagascar,
46 contained mammal DNA from 20 different
species
• Included small and large mammals, canopy
living mammals and bats
• Carrion flies exist world-wide, and are easy to trap
• This tool could greatly improve upon surveys of
mammal diversity
Advantages of eDNA
• Does not require sighting or handling of target species
• Does not require taxonomic expertise or animal handling skills
• Generally has higher detection probabilities and greater sensitivity than
traditional sampling techniques
• Is often (but not always) more economical than traditional sampling
techniques
• Once an assay is established, samples are very inexpensive to run (e.g.
~$20 per sample for multiples of 48 samples)
• Multiple assays (different species queries) can be run on the same
samples
Limitations of eDNA
• No detection of individuals
• Primer/probe designs are species-specific and
require considerable up-front investment
• Pilot work is necessary to understand variance
in detectability for different species and systems
Recent Publications
The journal Biological Conservation has an upcoming
special issue dedicated to eDNA:
http://dna-barcoding.blogspot.com/2015/01/allabout-edna.html
Labs
USU Molecular Ecology Lab
assay development, pilot testing
service lab billing
linkage to graduate/ undergrad projects
Karen Mock (karen.mock@usu.edu)
Pisces Molecular
private company in Boulder, CO
excellent choice for high throughput work for
established assays
http://www.pisces-molecular.com/