Plant Biotechnology Journal (2023) 21, pp. 2019–2032
doi: 10.1111/pbi.14109
A promoter trap in transgenic citrus mediates recognition
of a broad spectrum of Xanthomonas citri pv. citri TALEs,
including in planta-evolved derivatives
Deepak Shantharaj1, Gerald V. Minsavage1, Vladimir Orbovic2, Gloria A. Moore3, Danalyn R. Holmes4,
€mer5,a, Diana M. Horvath6, Thomas Lahaye4,5,*
Patrick Ro
and Jeffrey B. Jones1,*
1
Plant Pathology Department, University of Florida, Gainesville, FL, USA
2
Citrus Research and Education Center, University of Florida, Lake Alfred, FL, USA
3
Department of Horticultural Sciences, University of Florida, Gainesville, FL, USA
Zentrum fu€r Molekularbiologie der Pflanzen (ZMBP), Eberhard-Karls-Universita€t Tu€bingen, Tu€bingen, Germany
4
5
Genetics, Department of Biology, Ludwig-Maximilians-University Munich, Martinsried, Germany
6
2Blades Foundation, Evanston, IL, USA
Received 5 March 2023;
revised 9 June 2023;
accepted 12 June 2023.
*Correspondence (Tel +49 7071 2978745;
fax +49 7071 29 3287; email
thomas.lahaye@zmbp.uni-tuebingen.de; Tel
+1 352 273 4673; fax +1 352 392 6532;
email jbjones@ufl.edu)
a
€then,
Present address: Avicare+, Ko
Germany
Keywords: Xanthomonas citri subsp.
citri (Xcc), transcriptional activator-like
effector (TALE) protein, executor-type
resistance (R) gene, AvrBs3, AvrGf1,
AvrGf2.
Summary
Citrus bacterial canker (CBC), caused by Xanthomonas citri subsp. citri (Xcc), causes dramatic
losses to the citrus industry worldwide. Transcription activator-like effectors (TALEs), which bind
to effector binding elements (EBEs) in host promoters and activate transcription of downstream
host genes, contribute significantly to Xcc virulence. The discovery of the biochemical context for
the binding of TALEs to matching EBE motifs, an interaction commonly referred to as the TALE
code, enabled the in silico prediction of EBEs for each TALE protein. Using the TALE code, we
engineered a synthetic resistance (R) gene, called the Xcc-TALE-trap, in which 14 tandemly
arranged EBEs, each capable of autonomously recognizing a particular Xcc TALE, drive the
expression of Xanthomonas avrGf2, which encodes a bacterial effector that induces plant cell
death. Analysis of a corresponding transgenic Duncan grapefruit showed that transcription of
the cell death-inducing executor gene, avrGf2, was strictly TALE-dependent and could be
activated by several different Xcc TALE proteins. Evaluation of Xcc strains from different
continents showed that the Xcc-TALE-trap mediates resistance to this global panel of Xcc
isolates. We also studied in planta-evolved TALEs (eTALEs) with novel DNA-binding domains and
found that these eTALEs also activate the Xcc-TALE-trap, suggesting that the Xcc-TALE-trap is
likely to confer durable resistance to Xcc. Finally, we show that the Xcc-TALE-trap confers
resistance not only in laboratory infection assays but also in more agriculturally relevant field
studies. In conclusion, transgenic plants containing the Xcc-TALE-trap offer a promising
sustainable approach to control CBC.
Introduction
The bacterial pathogen Xanthomonas citri pv. citri (Xcc) is the
causal agent of citrus bacterial canker (CBC), a disease associated
with defoliation, blemished fruit, premature fruit drop, twig
dieback, and general tree decline, thereby causing severe
economic losses to the citrus industry worldwide (Naqvi
et al., 2022). The movement of Xcc-infected propagating
material, such as budwood, rootstock seedlings, or budding trees
has repeatedly led to outbreaks of CBC in citrus growing areas
previously unaffected by CBC. Given the known long-distance
routes of Xcc dissemination, it is evident that genetic resistance is
the only option for sustainable control of CBC and that
bactericides are not a sustainable means of preventing future
CBC outbreaks.
Research on plant pathogenic xanthomonads that infect
various host species has provided insights into the molecular
basis of how this pathogen manipulates susceptible hosts to
promote disease and how pathogen-resistant plant genotypes
either avoid manipulation by the pathogen or use immune
receptors to recognize and combat the pathogen. Many
xanthomonads inject transcriptional activator-like effector (TALE)
proteins into plant host cells to increase their virulence towards
the host. TALE proteins bind to effector-binding elements (EBEs)
in host promoters and transcriptionally activate downstream host
susceptibility (S) genes to favour in planta growth and/or spread
of the pathogen (Teper et al., 2023). TALEs bind to matching EBEs
through a variable number of nearly identical, tandemly arranged
33–34 amino acid long peptide modules commonly referred to as
repeats, with each TALE-repeat aligning with one nucleotide of a
matching EBE. Repeat variable diresidues (RVDs) located at
positions 12 and 13 of each TALE repeat determine the base
preference of the repeat. These base preferences have been
decoded for all possible RVDs, and these RVD-nucleotide
correlations, commonly referred to as the TALE code, now allow
in silico prediction of DNA target sites for any given TALE protein
(Teper et al., 2023).
The mechanistic basis of how TALEs recruit the host’s RNA
polymerase II (pol II) complex has also been elucidated in recent
studies. For the initiation of transcription, pol II assembles with
[Correction added on 31 October 2023, after first online publication: The copyright line was changed.]
ª 2023 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
This is an open access article under the terms of the Creative Commons Attribution License, which permits use,
distribution and reproduction in any medium, provided the original work is properly cited.
2019
several general transcription factors, including TFIIA, at the
promoter DNA to form the pre-initiation complex (PIC; Girbig
et al., 2022). TALEs bind to this pol II PIC with their transcription
factor binding domain (TFB), which is located C-terminal to the
DNA binding domain of the TALE (Yuan et al., 2016). The TFB
domain interacts with TFIIAc, which is a subunit of the general
transcription factor TFIIA. Examination of the three-dimensional
architecture of the Saccharomyces cerevisiae pol II PIC reveals that
TFIIA is located close to the upstream promoter DNA (Plaschka
et al., 2016), consistent with a model in which the TALE protein
physically bridges the distance between a given EBE and the pol II
PIC. The model in which TALEs physically link pol II PICs and EBEs
is consistent with the observation that TALE-induced transcripts
are generally initiated ~50 nucleotides downstream of a given EBE
€mer et al., 2009a,b;
(Antony et al., 2010; Hummel et al., 2012; Ro
Strauß et al., 2012; Tian et al., 2014; Tran et al., 2018; Wang
et al., 2015).
Virulence of the CBC-causing pathogen Xcc largely depends on
the TALE protein PthA4. PthA4 binds to a compatible EBE
upstream of the Citrus sinensis lateral organ boundaries 1
(CsLOB1) gene and induces transcription of the downstream
host S gene, which encodes a LOB-transcription factor (Hu
et al., 2014; Li et al., 2014). How CsLOB1 expression benefits the
bacterial pathogen remains unclear. However, since PthA4dependent activation of the virulence-promoting CsLOB1 gene
depends on PthA4-compatible EBEs upstream of CsLOB1, CRISPRbased mutagenesis of the PthA4-EBE is expected to reduce the
virulence of PthA4-dependent Xcc strains. Recent studies using
CRISPR mutagenesis to mutate PthA4-binding EBEs in the CsLOB1
promoter have indeed shown corresponding citrus plants to have
increased resistance to Xcc (Huang et al., 2021, 2022; Jia
et al., 2016, 2017, 2022a,b; Peng et al., 2017). Given that
optimal Xcc growth in citrus depends on TALE-mediated
activation of CsLOB1, one would expect strong evolutionary
pressure on Xcc to maintain the ability to activate CsLOB1
through TALEs. Indeed, recent studies have shown that Xcc
strains harbouring PthA4 derivatives that are no longer able to
activate CsLOB1 due to mutations in their DNA-binding domains
can alter their DNA-binding domains after prolonged incubation
in host plants to regain the ability to activate CsLOB1 (Teper and
Wang, 2021). Given the high evolvability of the TALE DNAbinding domain, it is therefore likely that CRISPR-induced
mutations in the PthA4-EBEs of the CsLOB1 promoter would
exert evolutionary pressure on Xcc. This would likely lead to the
selection of in planta-evolved TALEs (eTALEs) with altered DNAbinding specificity capable of transcriptionally activating CRISPRinduced CsLOB1 mutant alleles. In conclusion, CRISPR-induced
mutagenesis of PthA4-EBEs in the CsLOB1 promoter is unlikely to
confer durable resistance to Xcc.
While CRISPR-induced EBE mutations suppress the virulencepromoting function of TALEs, TALE-triggered immune responses
offer an alternative way to suppress in planta growth of TALEcarrying xanthomonads. Molecular analysis of dominantly inherited TALE-triggered plant-immune reactions revealed two functionally distinct classes of R genes: (i) constitutively expressed R
genes encoding nucleotide-binding leucine rich repeat (NLR)
proteins and (ii) transcriptionally regulated executor R genes.
Tomato (Lycopersicum esculentum) Bs4 and rice (Oryza sativa)
Xa1/Xo1 are representatives of such TALE-recognizing NLRs,
which achieve specific recognition of TALEs presumably through
direct interaction (Ji et al., 2020; Read et al., 2020a,b; Schornack
et al., 2004; Triplett et al., 2016). While the molecular basis of
NLR-dependent TALE recognition remains to be elucidated, the
molecular processes by which executor type R genes recognize
microbial TALE proteins are well understood. The EBEs in the
promoters of the executor R genes act as TALE traps that
misdirect the virulence activity of the TALEs to induce the
transcription of resistance-mediating executor transcripts that
induce cell death and stop the spread of the biotrophic parasite.
Accordingly, such executor R genes are also often referred to as
promoter traps. Previous studies have shown that the recognition
capacity of executor R genes can be expanded by incorporating
multiple back-to-back EBEs into the R gene promoter, resulting in
executor R genes that can mediate the recognition of multiple
€mer et al., 2009a; Zeng
TALEs (Hummel et al., 2012; Ro
et al., 2015). These may be EBEs that recognize TALEs from
different strains of Xanthomonas, resulting in broad-spectrum
resistance, or EBEs that detect several or all the numerous TALEs
from a particular strain of Xanthomonas. The latter configuration,
in which multiple TALEs of a Xanthomonas strain each
independently activate the R promoter, should confer durable
resistance because all TALE genes encoding promoter-activating
proteins must mutate simultaneously to evade recognition by this
enhanced executor R gene. Given that recent studies have shown
the high evolutionary capacity of TALEs under conditions of high
evolutionary selection pressure, such designed executor R genes
that are preceded with an arsenal of TALE-trapping EBEs will
possibly confer durable resistance to Xcc (Teper and Wang,
2021).
Previously, we engineered an enhanced executor R gene to
confer broad spectrum and durable resistance to CBC
(Shantharaj et al., 2017). To establish this promoter trap, we
used a repertoire of 14 different TALEs from citrus-infecting
xanthomonads, derived matching EBEs using the TALE code,
and inserted a corresponding EBE array into the promoter of
the pepper executor R gene Bs3. This R gene promoter controls
the expression of avrGf1, which encodes a Xanthomonas
effector protein that triggers the hypersensitive response (HR)
in grapefruit (Citrus paradisi; Rybak et al., 2009). Using
transient, Agrobacterium-mediated expression in citrus, we
confirmed that this designed executor R gene, termed
ProBs314EBE:avrGf1, indeed mediated recognition of a broad
spectrum of Xcc strains. However, in these previous studies, we
were unable to identify a stable transgenic line containing
ProBs314EBE:avrGf1.
We present here the establishment and molecular characterization of a stable-transgenic grapefruit line containing a
derivative of ProBs314EBE:avrGf1, which we have termed XccTALE-trap. While the TALE-sensing promoter is identical in both
executor R genes, the Xcc-TALE-trap now contains avrGf2 instead
of avrGf1, a Xanthomonas effector that, based on previous
studies, induces a stronger HR in grapefruit than avrGf1 (Gochez
et al., 2015) and is therefore potentially a better executor of cell
death.
To gain insight into the recognition specificity of tandemly
arranged EBEs in our designed promoter trap, we performed
rapid amplification of cDNA ends (RACE), an approach that allows
us to determine which EBEs have been chosen for transcription of
a given TALE-induced transcript. These findings showed that in
addition to their designated high-affinity EBEs, TALEs often bind
to sequence-related EBEs. We also studied the Xcc-TALE-trap in
conjunction with in planta-evolved derivatives of the Xcc TALE
protein PthA4. These studies suggest that the Xcc-TALE-trap
recognizes not only current but also newly evolved eTALE
ª 2023 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 21, 2019–2032
14677652, 2023, 10, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pbi.14109 by Zhejiang Normal University, Wiley Online Library on [02/05/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2020 Deepak Shantharaj et al.
proteins. Finally, we show that the Xcc-TALE-trap confers Xcc
resistance not only in laboratory assays but also in more
agronomically relevant field studies.
Results
Construction of a synthetic plant R gene confers citrus
canker resistance
To generate a synthetic plant R gene that triggers HR upon the
perception of TALEs from Xcc, here referred to as the Xcc-TALEtrap, we placed the Xanthomonas avrGf2 gene, which triggers
HR in citrus, downstream of 14 tandem-arranged EBEs that were
designed using the TALE-code to have high affinity to known X.
citri TALEs (Figure 1). Eight of the 14 EBEs were designed to
mediate the recognition of different Xcc TALEs, each of which
can autonomously activate the disease-promoting CsLOB1 gene
(Figure 1; red arrows). The remaining six EBEs were designed to
trap distinct Xcc TALEs for which the plant target genes are
currently unknown but for which matching EBEs can be predicted
by the TALE code (black arrows). In addition to these 14 EBEs
matching to Xcc TALEs, we incorporated an EBE matching to
AvrBs3 (grey arrow), a well-studied TALE protein from the pepper
pathogen Xanthomonas euvesicatoria (Xeu; Bonas et al., 1989).
Generally, Xcc strains contain several TALEs (Teper et al., 2023),
with one or more TALEs likely being compatible with EBEs in the
Xcc-TALE-trap promoter and each individually capable of
activating transcription of the HR-inducing executor gene avrGf2.
For example, strain Xcc306 contains next to the CsLOB1activating TALE protein PthA4 three additional trap-activating
TALEs (PthA1, PthA2, and PthA3). Given that in our Xcc-TALEtrap promoter we incorporated for each of these four Xcc306
TALEs a corresponding TALE-code predicted EBE, each of these
four TALEs is expected to trigger the trap independently (Figure 1).
Since mutations in all four Xcc306 TALEs would be required to
evade recognition by this Xcc-TALE-trap, it seems plausible that
the Xcc-TALE-trap will provide durable resistance to Xcc306 and
presumably other Xcc strains containing more than one XccTALE-trap compatible TALE. Seeing as the Xcc-TALE-trap contains
TALE code predicted EBEs with high affinity for numerous
currently known Xcc TALEs, this trap is also expected to provide
broad-spectrum Xcc resistance.
The Xcc-TALE-trap inhibits development of Xcc-related
disease phenotypes
The Xanthomonas effector protein AvrGf2, which we integrated
as a TALE-inducible executor gene in the Xcc-TALE-trap, is known
to trigger HR in citrus (Gochez et al., 2017). Accordingly, it was
important to show that in the absence of the pathogen, there is
no executor expression and that AvrGf2-triggered HR is strictly
TALE dependent. To test stringent transcriptional regulation of
avrGf2, we inoculated Agrobacterium tumefaciens containing the
Xcc-TALE-trap T-DNA with or without Xcc306 into grapefruit
leaves. In these transient assays, the Xcc-TALE-trap induced HR
only when inoculated together with Xcc306, and not when coinoculated with XccD4 (Figure S1), an Xcc306 derivative from
which all four TALE genes were removed by mutagenesis (Hu
et al., 2014). This observation suggests that the Xcc-TALE-trap
triggers HR in a strictly TALE-dependent fashion and therefore this
T-DNA construct seemed suitable for application in stably
transformed citrus plants.
We initiated the transformation of Duncan grapefruit plants
and identified within five putative transgenic lines one plant that
indeed contains the Xcc-TALE-trap as a stable transgene
(Figure S2). To test for citrus canker resistance, we inoculated
this transgenic line and a corresponding Duncan grapefruit wildtype control plant with Xcc306, an Xcc strain that is expected to
activate the Xcc-TALE-trap with four distinct TALEs: PthA1,
PthA2, PthA3, and the CsLOB1-activating PthA4 protein (Figure 1). When spray inoculated, only wild-type (WT) Duncan
plants, but not the derived transgenic line, showed typical citrus
canker pustules, a disease-associated infection phenotype characteristic of susceptible plant genotypes (Figure 2). Similarly,
infection of Xcc306 via pinprick inoculation triggered canker-like
lesions only on leaves of Duncan WT plants but not on leaves of
the derived transgenic line carrying the Xcc-TALE-trap. In
summary, transgenic lines containing the Xcc-TALE-trap showed
no disease phenotypes.
The Xcc-TALE-trap inhibits in planta growth of Xcc306
Given that disease phenotypes of Xcc were suppressed in the
transgenic line, we wondered if the Xcc-TALE-trap would also
inhibit in planta growth of Xcc306. To clarify if in planta growth
of Xcc306 differs in the context of leaves from Duncan WT and
leaves from the transgenic line, we inoculated both plant
genotypes and quantified bacterial multiplication over a period
of eight days. This time course analysis showed that until four
days post inoculation (dpi), in planta growth of Xcc306 was
almost indistinguishable in Duncan WT and the transgenic line
(Figure 3). Yet, at six and eight dpi, the number of colonyforming units that could be recovered from leaves declined in
the context of the transgenic line and the inoculated leaf tissue
generally showed HR at a later timepoint. By contrast,
multiplication of strain Xcc306 continued at six and eight dpi
in Duncan WT plants. Notably, the number of colony-forming
units recovered at eight dpi from Duncan WT and the
transgenic line differed by almost four logs, demonstrating
the highly efficient bacterial resistance conferred by the XccTALE-trap.
Next, we tested whether the reduced in planta growth of strain
Xcc306 in the context of the transgenic line is TALE dependent.
To clarify TALE dependence, we used strain Xcc306 and XccD4,
an isogenic Xcc306 derivative lacking TALE genes (Hu
et al., 2014). Inoculation studies of Duncan WT and the
transgenic line with XccD4 revealed that this TALE-depleted Xcc
strain multiplied in both plant genotypes to almost identical levels
(Figure 3). This observation suggests that the reduction of in
planta growth of Xcc306 in the context of the transgenic line is
indeed TALE-dependent. We also noted that in Duncan WT
plants, growth of XccD4 was reduced relative to growth of
Xcc306. The reduced in planta growth of the TALE-depleted
mutant XccD4 is in accordance with previous studies where
PthA4 and other Xcc TALEs were shown to promote in planta
growth of Xcc (Hu et al., 2014).
Based on the design of the Xcc-TALE-trap, the observed HR
should generally correlate with transcriptional activation of the
avrGf2 executor transgene by Xcc-delivered TALE proteins
(Figure 1). To test TALE-dependent transcriptional activation of
the avrGf2 transgene, we inoculated leaves of the transgenic
citrus line with Xcc306, its TALE gene-depleted derivative XccD4
or with inoculation medium. Next, we harvested inoculated leaf
tissue at 0, 24, and 48 hours post inoculation (hpi) and
determined avrGf2 transcript levels by quantitative reversetranscription PCR (qRT-PCR). qRT-PCR studies showed elevated
avrGf2 transcript levels in the transgenic line at 24 and 48 hpi
ª 2023 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 21, 2019–2032
14677652, 2023, 10, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pbi.14109 by Zhejiang Normal University, Wiley Online Library on [02/05/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
A TALE-trapping promoter confers canker resistance 2021
(a)
Xcc-TALE-trap
Apl2
Apl3
PthB
PthA*
PthA*2
PthAw
PthA1
PthA2
PthA3
B3.7
HssB3
PthA 3213
PthC
AvrBs3
executor
PthA4
promoter trap
15
14
13
12
11
10
9
8
7
6
5
4
3
2
1
100 bp
avrGf2
PthA4
4
1
PthA1
2
PthA2
PthA3
Xcc 306
PthA1
PthA2
PthA3
3
5’UTR
PthA4
(b)
CDS
(c)
CsLOB1
PthB
PthC
PthA4
PthAw
PthA*2
PthA*
Apl2
PthA 3213
TCTCTATATAAACCCCTTTTGCCTT
TCTCTATCTCAACCCCTTT
TCTCTATATAACTCCCTTT
TATAAACCTCTTTTACCTT
TATTTACCACTCTTACCTT
TATACACCTCTTTACATTT
TATAAATCTCTCTTACCTT
TATACACCTCTCTTACT
TATAAATCTCTCTTACCTT
HssB3
Apl3
PthA1
PthA2
PthA3
B3.7
TACACATTATACCACT
TACACACCTCCTACCACCTCTACTT
TATATACCTACACTACCT
TACACACCTCTTTTAAT
TATATACCTACACCCT
TATATACCTACACTACACTACCT
Figure 1 A promoter trap designed to perceive various X. citri TALE proteins controls transcription of Xanthomonas avrGf2, encoding an effector protein
that triggers cell death in grapefruit. (a) Each of the four different Xcc306 TALEs can independently activate the Xcc-TALE-trap. White framed arrows show
EBEs along with TALEs which were used to derive these EBEs. To make it easier to address individual EBEs, they are also identified by a simple one-digit code
(white font in black circle). Red arrows represent EBEs of CsLOB1-targeting TALEs. Black arrows indicate TALE EBEs whose host target gene is unknown.
The yellow oval represents strain Xcc306, which delivers the four TALE proteins shown. Each Xcc306 TALE protein is expected to bind to a complementary
high-affinity EBE and induce a transcript ~50 base pairs downstream encoding the cell death inducing AvrGf2 protein (wavy line). The binding of Xcc306
TALEs to complementary EBEs is indicated by a blue background colour. The start sites of TALE-induced transcripts, located ~50 nucleotides downstream of
the respective TALE EBEs, are indicated by numbered asterisks. (b) Nucleotide sequences of EBEs designed to capture matching, CsLOB1-targeting TALE
proteins. The CsLOB1 promoter (uppermost sequence) and EBEs along with matching TALEs have been incorporated in the promoter trap. (c) Nucleotide
sequences of TALE EBEs in the promoter trap whose host target genes are unknown.
spray inoculation
transgenic
wildtype
pinprick inoculation
transgenic
with Xcc306 (Figure 4). By contrast, inoculation of XccD4 or
inoculation medium did not induce elevated avrGf2 transcript
levels in the transgenic line. In summary, these studies show that
the Xcc-TALE-trap is transcriptionally activated by Xcc306 TALE
proteins.
To determine if in the transgenic line AvrGf2-triggered HR
interferes with PthA4-dependent activation of CsLOB1, transgenic and non-transgenic grapefruit were inoculated with Xcc306
or the TALE gene-deleted strain XccD4. Quantification of
wildtype
Figure 2 Transgenic grapefruit containing a
promoter trap driving AvrGf2 expression show
resistance to strain Xcc306 when being inoculated
by either pinprick inoculation or spray inoculation.
Leaves of the transgenic line and wild-type
Duncan grapefruit were inoculated with Xcc306
(5 9 108 cfu/mL) containing the TALE proteins
PthA1, PthA2, PthA3, and PthA4. Pictures were
taken at 12 days post-inoculation (dpi).
transcripts at 48 hpi revealed that Xcc306 but not XccD4 induced
elevated CsLOB1 levels in both, transgenic and non-transgenic
grapefruit (Figure S3). However, the increase in CsLOB1 was
lower in the transgenic grapefruit than in the non-transgenic
grapefruit, probably as a result of initiation of the HR in the
transgenic plant, which is likely to have an inhibitory effect on all
biochemical processes, including transcription. In conclusion, we
show that both the Xcc-TALE-trap and CsLOB1 are transcriptionally activated by Xcc306 TALE proteins.
ª 2023 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 21, 2019–2032
14677652, 2023, 10, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pbi.14109 by Zhejiang Normal University, Wiley Online Library on [02/05/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2022 Deepak Shantharaj et al.
9
Xcc306 - WT
8
Log 10 cfu/cm 2 leaf
***
7
n.s.
TALE virulence
(CsLOB1 activation)
XccΔ4 - WT
XccΔ4 - transgenic
***
TALE avirulence
(Xcc-TALE-trap)
6
**
5
Xcc306 - transgenic
4
3
0 dpi
2 dpi
4 dpi
6 dpi
8 dpi
Figure 3 In planta growth of Xcc is inhibited in transgenic Duncan grapefruit plants containing the Xcc-TALE-trap. Bacterial suspensions were adjusted to
105 cfu/mL prior to blunt-end syringe infiltration of wild-type (WT) and transgenic Duncan grapefruit leaves (transgenic). Leaf discs of inoculated tissue
were assayed for bacterial populations of depicted Xcc strains at the depicted days post-infiltration (dpi). Values are presented in a line graph with the mean
value of three biological replicates (n = 3) and the error bars displaying the calculated standard deviation. Statistical significance on day 8 was determined
between the indicated plant and bacterial genotype combinations using a Student’s t-test, ***P < 0.001, **P < 0.01, n.s.P > 0.05, no significance.
Differences of in planta growth observed for the two studied Xcc strains are caused either by differences TALE-dependent virulence activity (Xcc306 vs.
XccD4 in WT host) or TALE-dependent avirulence activity (Xcc306 in WT vs. Xcc306 in transgenic).
relative avrGf2 expression / mock
60
50
40
30
20
a
a
a
a
a
a
a
b
a
10
0
Mock
Xcc
306
Xcc
Δ4
Mock
0 hpi
X cc
306
24 hpi
Xcc
Δ4
Mock
Xcc
306
Xcc
Δ4
48 hpi
Figure 4 Analysis of the transgenic grapefruit line shows that the executor gene avrGf2 is transcriptionally activated by the Xcc306 wild-type strain but
not by a derived mutant strain (XccD4) lacking pthA14. avrGf2 transcript levels were quantified by quantitative reverse-transcription real-time PCR. avrGf2
expression was quantified at 0, 24, and 48 hours post-inoculation (hpi) with either Xcc306 (5 9 108 cfu/ml), its mutant derivative XccD4 (5 9 108 cfu/mL)
or inoculation medium (mock). avrGf2 transcript levels were normalized to Ef1a expression and relative to mock treatment. Data are presented in a bar
graph with the mean value of two biological replicates (n = 2) and error bars displaying the calculated standard deviation. Statistically significant groups
(P < 0.01) are indicated with lower case letters calculated according to one-way ANOVA followed by a Tukey HSD post hoc test.
The Xcc-TALE-trap is triggered by Xcc- but not by
Xoo-TALE proteins
To clarify whether each of the four Xcc306 TALE proteins can
trigger the Xcc-TALE-trap, we studied the TALE-depleted Xcc306
derivative XccD4 and corresponding transconjugants containing
the TALE genes pthA1, pthA2, pthA3, pthA4, or avrBs3. As
anticipated, inoculation of the TALE-depleted strain XccD4 did
not trigger HR in Duncan WT leaves nor in leaves of the
transgenic line, demonstrating that Xcc-TALE-trap activation is
TALE-dependent (Figure S4). By contrast, each of the XccD4
transconjugants carrying the individual TALE genes pthA1, pthA2,
pthA3, pthA4, or avrBs3, triggered HR in the transgenic line
containing the Xcc-TALE-trap but not in leaves of Duncan WT
plants. These findings demonstrate that each of the Xcc306
TALEs as well as the Xeu TALE AvrBs3 is sensed by and activates
transcription of the Xcc-TALE-trap. Given that all tested Xcc306
TALEs and AvrBs3 were recognized by the Xcc-TALE-trap, we
wondered if other TALEs, for which matching EBEs were not
incorporated in the trap promoter, would also activate the XccTALE-trap. To study recognition specificity of the Xcc-TALE-trap,
we used XccD4 transconjugants carrying the TALE genes pthXo1,
pthXo6, or avrXa7 that were originally identified in the rice
pathogen X. oryzae pv. oryzae (Xoo). Notably, these three Xoo
ª 2023 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 21, 2019–2032
14677652, 2023, 10, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pbi.14109 by Zhejiang Normal University, Wiley Online Library on [02/05/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
A TALE-trapping promoter confers canker resistance 2023
TALEs differ in their DNA binding preference from Xcc TALEs and
therefore are not expected to trigger the Xcc-TALE-trap. Indeed,
inoculation of the XccD4 transconjugants carrying the TALE genes
pthXo1, pthXo6, or avrXa7 did not trigger HR in the transgenic
line containing the Xcc-TALE-trap (Figure S5), suggesting that our
promoter trap recognizes TALE proteins specifically from Xcc.
The Xcc-TALE-trap mediates broad-spectrum resistance
to Xcc strains
The Xcc-TALE-trap was engineered using a spectrum of 14
sequenced Xcc TALE proteins for which corresponding EBEs
were deduced by the TALE code and integrated into the
promoter trap (Figure 1). Given that characterized Xcc strains
typically contain several TALEs, we speculated that the XccTALE-trap would possibly mediate resistance to a broad range of
Xcc strains. To test the recognition spectrum of the Xcc-TALEtrap, we studied a panel of 10 distinct Xcc strains that originate
from countries across four different continents (South America,
North America, Asia, and Oceania) and that likely cover at least
some genetic diversity observed within Xcc (Table S1). While the
TALE gene repertoire of these strains is unknown, Southern
analysis using the Xcc306 PthA4 gene as a probe showed that
all strains in this collection contain TALE genes (Figure S6) and
should therefore activate the Xcc-TALE-trap. In our infectionbased studies of the Xcc collection, we included the wellcharacterized strain Xcc306, and the derived TALE-depleted
strain XccD4 as positive and negative controls respectively. The
panel of Xcc strains was inoculated into Duncan WT plants, as
well as the transgenic line containing the Xcc-TALE-trap, using
syringe infiltration as well as pinprick inoculation (Figure 5).
When using syringe infiltration, all Xcc strains except XccD4
triggered HR in the transgenic line, but not in Duncan WT
plants. When using pinprick inoculation, the severity of diseaseassociated pustules on Duncan WT showed some variation
across the strains and was not evident in the transgenic line.
Overall, our findings suggest that the Xcc-TALE-trap mediates
broad-spectrum resistance to CBC.
50 RACE studies suggest that TALE proteins bind
preferentially to TALE-code predicted EBEs
The promoter of the Xcc-TALE-trap contains 14 tandemarranged EBEs designed to capture Xcc TALEs with distinct
DNA-binding specificity (Figure 1). However, it remains unclear
whether or not the different Xcc-delivered TALEs in a native
infection scenario exclusively or at least preferentially target the
TALE code predicted EBEs. This raises the question of how to
determine which of the tandem-arranged EBEs in the Xcc-TALEtrap in fact captures a given TALE protein. Numerous studies
have shown that the transcriptional start site (TSS) of TALEinduced transcripts is generally ~50 nucleotides downstream of
€ mer
the targeted EBE (Antony et al., 2010; Kay et al., 2007; Ro
et al., 2007, 2009a,b; Streubel et al., 2017). Accordingly, the
TSS of a TALE-induced transcript can be used to identify a
corresponding TALE-binding EBE in the promoter trap. To clarify
which of the 14 tandem-arranged EBEs in fact interacts with
matching TALEs, we studied five TALEs for which TALE-code
predicted, perfect-match EBEs (pEBEs) had been incorporated
into the promoter trap: AvrBs3 a TALE from the tomato and
pepper pathogen Xeu, as well as PthA1, PthA2, PthA3, and
PthA4, four TALEs from the citrus-infecting strain Xcc306. To
study TALE-EBEs interactions for the Xcc-TALE-trap, XccD4
transconjugants containing either avrBs3, pthA1, pthA2, pthA3,
or pthA4 were inoculated into the transgenic Duncan grapefruit
line. Two dpi, RNA was extracted from inoculated leaf tissues
and rapid amplification of cDNA ends (RACE) was carried out.
PCR-amplified avrGf2 transcripts were cloned and sequenced to
determine TSSs for each of the five Xcc-delivered TALEs.
Inspection of the executor transcript 50 ends induced by the
five studied TALEs uncovered for all TALEs corresponding
transcripts starting sites ~50 nucleotides downstream of their
pEBEs (Figure 6; Figure S7). For two of the five TALEs that were
studied, AvrBs3 and PthA3, the majority of TSSs were ~50
nucleotides downstream of their designated pEBEs, which
corroborates TALE-code predictions. Since the TSSs for most of
the PthA1-, PthA2-, and PthA4-induced transcripts were not ~50
nucleotides downstream of their designated pEBE, we assumed
that some TSSs could be explained by sequences in the
promoter that are highly sequence related to the designated
pEBEs. To test this hypothesis, we scanned the promoter
sequences located ~50 bp upstream of the observed TSSs using
the TARGET FINDER algorithm (Doyle et al., 2012) to identify
‘second best’ EBEs (sEBEs) for the given TALEs. Indeed, TARGET
FINDER uncovered for both PthA1 and PthA4 such sEBEs that
are in accordance with the observed TSSs. For example, 15 of
the 19 PthA1-induced transcripts start ~50 bp downstream of
the B3.7-EBE (EBE5) which differs from the PthA1-pEBE (EBE8) in
only two out of 18 nucleotides. Similarly, the TSSs of six of the
eight PthA4-induced transcripts starts ~50 bp downstream of
the PthA3213-EBE (EBE3), which differs from the PthA4-pEBE
(EBE15) in only two out of 18 nucleotides. While for four out of
five TALEs, the majority of observed TSSs could be explained by
the TALE code, the situation was different for PthA2. With
PthA2, only five of 17 TSSs were ~50 nucleotides downstream
of its pEBE (EBE7), and the remaining 12 TSSs could not be
explained by TALE-code predictions. In summary, most observed
TALE-induced executor transcripts can be explained by interaction of the TALEs with code predicted pEBEs or sequence-related
sEBEs.
Newly evolved Xcc TALEs transcriptionally activate the
Xcc-TALE-trap
The Xcc-TALE-trap contains pEBEs corresponding to eight Xcc
TALEs that are known to transcriptionally activate the diseasepromoting CsLOB1 gene, including PthA4 from strain Xcc306
(Figure 1). Recent studies uncovered that PthA4 derivatives with
mutated DNA binding domains that are incapable of activating
CsLOB1, rapidly evolve to regain the capability to transcriptionally activate CsLOB1 (Teper and Wang, 2021). While the DNAbinding domain of these PthA4-derived eTALEs and the wildtype PthA4 protein differ, the eTALEs indeed share high similarity
in the RVD composition of their DNA binding repeat arrays with
PthA4 (Figure S8). To clarify if the PthA4-derived eTALEs
dTALELB2A1, dTALELB2A2, dTALELB3A, dTALELB5A, and their
progenitor dTALEWTLOB1 would be captured by EBEs in the
Xcc-TALE-trap that were designed to trap wild-type PthA4
protein (EBE15), we delivered the TALEs into transgenic Duncan
grapefruit via Xcc and carried out RACE as previously described.
Analysis of TSSs showed that three out of four eTALEs
(dTALELB2A1, dTALELB3A, and dTALELB5A) and their progenitor
dTALEWTLOB1 bound to the PthA4 pEBE (EBE15) of the XccTALE-trap. dTALELB2A1, dTALELB5A, and dTALEWTLOB1
induced additional transcripts that indicated interaction of these
PthA4 derivatives with the PthA3213-EBE (EBE3) (Figure 7), as
was the case for the wild-type PthA4 protein (Figure 6). By
ª 2023 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 21, 2019–2032
14677652, 2023, 10, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pbi.14109 by Zhejiang Normal University, Wiley Online Library on [02/05/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2024 Deepak Shantharaj et al.
(a)
1
2
3
4
5
5
4
6
6
3
7
Xcc
Δ4
Xcc
306
Xcc
A44
Xcc 2004-00059
(Florida)
Xcc 46
(India)
Xcc 82
(Japan)
2
1
Tr ans ge nic
8
WT
9
7
8
10
9
11
12
10
11
Xcc101
(Guam)
Xcc106
(Australia)
Xcc 111
(China)
Xcc126
(Korea)
Xcc131
(Maldive)
Xcc257-2
(Thailand)
12
(b)
WT
1 2
Xcc
Δ4
Xcc
306
1 2
3 4
Xcc
A44
Xcc
2004-00059
(Florida)
3 4
5 6
Xcc 46
(India)
7 8
Xcc 82
(Japan)
5 6
Xcc101
(Guam)
Xcc106
(Australia)
7 8
9 10
Xcc 111
(China)
Xcc131
(Maldive)
9 10
11 12
Xcc126
(Korea)
Xcc257-2
(Thailand)
11 12
Tr ans genic
Figure 5 A transgenic Duncan line containing the Xcc-TALE-trap mediates recognition to a broad panel of Xcc strains. Leaves of either Duncan wild-type
(WT) or a transgenic line containing the Xcc-TALE-trap (transgenic) were infected with a panel of depicted Xcc strains (5 9 108 cfu/mL) using infiltration
(a) or pinprick inoculation (b). Pictures were taken at 4 (a) or 12 (b) dpi.
contrast, the TSSs of dTALELB2A2-initiated transcripts could not
be associated with Target Finder-predicted upstream EBEs. In
summary, three out of four of the PthA4-derived eTALEs
(dTALELB2A1, dTALELB3A and dTALELB5A) showed interactions
with EBEs of the Xcc-TALE-trap that were similar to the
progenitor TALE PthA4.
ª 2023 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 21, 2019–2032
14677652, 2023, 10, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pbi.14109 by Zhejiang Normal University, Wiley Online Library on [02/05/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
A TALE-trapping promoter confers canker resistance 2025
3
2
1
P1
AvrBs3
HssB3
4
6
PthA 3213
B3.7
5
7
PthC
PthA1
PthA2
PthA3
PthAw
PthA*2
PthB
PthA*
Apl3
PthA4
Apl2
8
15 14 13 12 11 10 9
avrGf2
5’ upstream sequence
900
800
700
600
best
possible
score
score
10.88 [bps:4.86]
PthA1 - B3.7
7
TALE EBE
executor gene
500
400
300
distance
EBE 3’ - TSS
200
100
1
3
5
7
50
9
11
13
PthA1
B3.7
15
17
4.86 [bps:4.86]
PthA1 - PthA1
19
50
1
3
5
7
9
3.30 [bps:3.30]
PthA2 - PthA2
3.22 [bps:3.22]
PthA3 - PthA3
11
50
13
15
17
1
50
5
7
PthA4
PthA 3213
4.95 [bps:4.53]
PthA4 - PthA4
3
10.20 [bps:4.53]
PthA4 - PthA 3213
50
1
3
5
7
50
11.05 [bps:4.39]
AvrBs3 - AvrBs3
50
1
3
2
4
6
8
10
PthA1
12
14
16
18
2
4
6
8
10
PthA2
12
14
16
2
4
6
PthA3
8
2
4
PthA4
6
8
2
4
AvrBs3
Figure 6 50 RACE studies suggest that TALEs do not bind exclusively to the highest affinity target site of the Xcc-TALE-trap. The grey horizontal bar on top
depicts the promoter trap consisting of the avrGf2 executor gene (far right) and the 50 upstream sequence with distinct tandem-arranged EBEs (arrows).
Each EBE is labelled with the TALE that was used to deduce this EBE and for simplicity with a number (white font on black background). Horizontal grey and
blue lines with numbering on the far right (30 end) represent 50 RACE products with the variable 50 end on the far left. Transcript-inducing TALEs are
indicated next to the square brackets on the far right. Vertical grey bars originating from the EBEs indicate the location of the EBEs relative to the 50
transcript ends. Transcripts for which an EBE could be predicted ~50 nucleotides downstream of the 50 transcript end by Target Finder (https://tale-nt.cac.
cornell.edu/node/add/talef-off) are depicted in blue colour along with the corresponding predicted EBE shown as blue vertical boxes. The score of predicted
TALE-EBE combinations is given along with the best possible score (bps) for a given TALE in blue font next to the given EBE. Detailed representative
descriptions on TALE-EBE combinations are also given in purple-font text on the uppermost TALE-EBE combination. Yellow boxes show sequence
alignments of TALE-code-predicted EBEs and chosen EBEs for PthA1 and PthA4. P1; anchor primer used in 50 RACE studies. Xcc strains (5 9 108 cfu/ml)
were inoculated blunt-end syringe infiltration; inoculated tissue for transcript studies was harvested at 48 hpi.
The Xcc-TALE-trap mediates resistance to citrus canker in
a field study
While our laboratory infection studies suggested that the XccTALE-trap would confer resistance to Xcc (Figures 2, 3, and 5),
such experiments conducted under laboratory conditions lack the
complexity of the situation observed in the field. Therefore, we
initiated studies to determine whether the transgenic line
outperformed Duncan grapefruit, the progenitor of the transgenic line, under field conditions. Following planting in March
2019, a visual inspection 3 months later in June 2019 revealed no
canker symptoms in the transgenic line and very few in the
Duncan grapefruit (Table S2). However, inspections after six and
nine months in September and December of 2019 revealed
moderate to severe disease symptoms on Duncan grapefruit, but
not on any of the derived transgenic lines carrying the Xcc-TALEtrap (Table S2). Therefore, our field studies show that transgenic
lines carrying the Xcc-TALE-trap provide CBC resistance not only
in controlled laboratory infection assays but also under agronomically relevant field conditions.
Discussion
Towards cisgenic canker-resistant citrus plants
We established and characterized a transgenic citrus plant
containing the Xcc-TALE-trap, a synthetic executor type R gene
designed to trigger HR in host cells upon perception of Xcc TALE
proteins. The transgenic citrus line established in this study is
based on previously published work in which a promoter trap for
Xcc TALE proteins was analysed by transient expression rather
ª 2023 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 21, 2019–2032
14677652, 2023, 10, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pbi.14109 by Zhejiang Normal University, Wiley Online Library on [02/05/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2026 Deepak Shantharaj et al.
B3.7
HssB3
PthA 3213
PthC
AvrBs3
6
5
4
3
2
1
8
7
P2
PthA1
PthA2
PthA3
PthAw
PthA*
PthA*2
Apl3
PthB
PthA4
Apl2
15 14 13 12 11 10 9
avrGf2
executor gene
5’ UTR
600
7.65 [bps:5.45]
dTALELB2A1 - PthA4
500
200
100
14.94 [bps:5.45]
dTALELB2A1 - PthA 3213
50
400
300
dTALELB2A1
50
dTALELB2A2
50
7.20 [bps:5.00]
dTALELB3A - PthA4
8.95 [bps:5.24]
dTALELB5A - PthA4
5.54 [bps:5.34]
dTALEWTLOB1 - PthA4
dTALELB3A
50
12.49 [bps:5.24]
dTALELB5E - PthA 3213
50
50
12.83 [bps:5.34]
dTALEWTLOB1 - PthA 3213
50
dTALELB5A
dTALEWTLOB1
Figure 7 50 RACE studies suggest that the Xcc-TALE-trap is capable of detecting evolved TALE proteins. For explanations of the graphics, please refer to
Figure 6.
than in stable transgenic lines (Shantharaj et al., 2017). In this
work, the same engineered promoter was used, but a different
cell death inducing effector, AvrGf2, was used instead of the
previously used AvrGf1 protein. AvrGf1 and AvrGf2 share 45%
sequence similarity and both effectors trigger HR in most citrus
species, except key lime (C. aurantifolia; Gochez et al., 2015).
Quantitative studies revealed that AvrGf2 triggers a stronger HR
and mediates a stronger inhibition of in planta growth of Xcc as
AvrGf1 (Gochez et al., 2015), possibly suggesting that AvrGf2 is
the more potent executor protein. Agrobacterium-mediated
transient delivery of ProBs314EBE:avrGf1 and the Xcc-TALE-trap
showed that both constructs execute HR in a strictly TALEdependent fashion (Figure S1) (Shantharaj et al., 2017), suggesting that the AvrGf1- and AvrGf2-based executor type R genes are
both equally suitable for application in stable transgenic lines.
However, we failed to observe transgenic citrus lines for
ProBs314EBE:avrGf1 (Shantharaj et al., 2017) while we eventually
identified one line containing the AvrGf2-based Xcc-TALE-trap
(Figure S2). The low overall transformation success rate might
reflect the fact that the transformation of citrus is still challenging
(Conti et al., 2021). However, recent studies have shown that
transgenic application of the rice executor gene Xa23 leads
reduced bacterial growth, probably due to upstream promoters at
the specific transgene integration site (Ji et al., 2022). Therefore,
the low number of citrus transformants may also be related to the
cellular toxicity of executor genes, which are likely to eliminate all
transgenic lines with leaky executor transgene expression.
Since no executor genes have been identified in citrus plants,
we used the bacterial effector gene avrGf2 as a TALE-inducible
executor gene in our transgenic citrus lines. While the integration
of foreign DNA into plant genomes suffers from low public
acceptance (Sharma et al., 2022), it is important to note that
transcription of this bacterial transgene was found in planta
exclusively after infection with TALE gene carrying Xcc strains
(Figure 4). Given the superb resistance of our transgenic line to
Xcc infection, it is foreseeable that in plantations containing only
transgenic trees, the bacterial avrGf2 gene would not actually be
transcribed, which should potentially eliminate or reduce public
concerns. Since the rejection of gene editing (GE) approaches in
plants by a large part of the public is probably the consequence of
a lack of knowledge about the causal relationships between RNA,
DNA, and protein, the concept of TALE-activated immunity opens
up an opportunity to improve the public’s understanding and
appreciation of the nuances of GE technology.
If executor genes were available from citrus, they could be used
to generate cisgenic, rather than less accepted transgenic,
executor type R genes. While a citrus executor has not been
cloned as of yet, recent studies resulted in the identification of
PthA4AT, a derivative of the Xcc TALE protein PthA4 that triggers
HR in citrus (Roeschlin et al., 2019). Notably, PthA4AT derivatives,
which due to mutations in their nuclear localization signals do not
translocate to the host nucleus, do not trigger HR, ultimately
suggesting that PthA4AT transcriptionally activates a to-beidentified citrus executor gene. In summary, these observations
suggest that the citrus genome contains executor genes which,
once cloned, could serve as modules for the construction of
cisgenic executor genes for the transformation of citrus.
Mechanistic insights into NLR proteins point to another source
of executor genes that have not yet been exploited for executor R
gene construction. Upon recognition of microbial effectors, NLR
proteins change their conformation from a quiescent to an
activated state, which in turn executes immune programmes that
typically result in HR. Mutational studies have led to the
identification of conserved amino acids that can be manipulated
ª 2023 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 21, 2019–2032
14677652, 2023, 10, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pbi.14109 by Zhejiang Normal University, Wiley Online Library on [02/05/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
A TALE-trapping promoter confers canker resistance 2027
to generate autoactive NLR variants that induce immune
responses upon translation in the absence of an NLR-activating
effector (Maruta et al., 2022). Genes encoding autoactive NLRs
are functionally equivalent to the executor genes and could be
used for the construction of TALE-inducible R genes. Notably, the
recently published citrus genomes (Wu et al., 2022) provide easy
access to numerous genes encoding NLRs that could be used as
starting materials to deduce autoactive citrus NLRs.
We also anticipate that research on cell death in the context of
developmental biology will lead to the discovery of previously
unknown executors, particularly in plant model species (Nowack
et al., 2022). Subsequent identification of orthologous executor
genes from crop species will allow us to establish TALE-inducible
executor type R genes through a cisgenic rather than transgenic
approach in citrus and other crop species that hopefully will no
longer raise public concern.
Analysis of executor transcript TSSs provides insights
into TALE-targeted EBEs in the Xcc-TALE-trap
The promoter of our Xcc-TALE-trap is equipped with an arsenal
of 14 tandem-arranged EBEs that were designed to have high
affinity to one of 14 distinct Xcc-TALEs (Figure 1). Similarly, five
and six tandem-arranged EBEs were previously integrated into
the promoters of the rice executor R genes Xa10 and Xa27,
respectively, in order to extend their recognition capacity for
TALE proteins (Hummel et al., 2012; Zeng et al., 2015). A unique
feature of the Xcc-TALE-trap is its EBE array and how it addresses
functionally related TALEs that target identical or overlapping
sequences in the host plant as, for example, PthA4, PthAw,
PthA*2, PthA*, Apl2, and PthA 3213 (Figure 1b). Notably, for
each of these functionally related TALEs, the EBE array of the
Xcc-TALE-trap contains a TALE code-predicted perfect match
EBE, rather than a ‘broad spectrum’ EBE that is likely less efficient
in detecting all of these functionally related TALEs (Table S3). We
reasoned that this arrangement would improve the chances that
TALEs with related but distinct DNA-binding preferences would
be matched with high-affinity EBEs, potentially improving the
sensitivity of the Xcc-TALE-trap. To clarify if Xcc TALEs would
bind exclusively to their designated high-affinity pEBE or also to
sequence-related EBEs with presumably lower affinity, we
studied five distinct TALEs for which matching pEBEs were
incorporated in the promoter of the Xcc-TALE-trap. 50 RACE
studies indicated that some but not all executor transcripts are
initiated by TALEs at their designated pEBE (Figure 6). For
example, two out of eight PthA4-induced executor transcripts
were initiated ~50 nucleotides downstream of the destined
PthA4-EBE (EBE3), while five out of eight executor transcripts
were initiated ~50 nucleotides downstream of the PthA3213-EBE
(EBE15). Given that these two EBEs differ in only two of 19
nucleotides, it seems plausible that PthA4 can interact with both
EBEs. Yet, TALE-code based in silico predictions suggested that
PthA4 has a higher affinity to the PthA4-EBE (EBE15; score 4.95)
when compared to the PthA3213-EBE (EBE3; score: 10.20)
(Figure 6). Therefore, it was counterintuitive that most of the
PthA4-induced executor transcripts are initiated from the
PthA3213-EBE rather than the PthA4-EBE (Figure 5). The
unexpected transcript ratios may be due to technical peculiarities
of the RACE approach, where reverse transcription of mRNAs
followed by PCR amplification favours the identification of
shorter transcripts. For example, PthA3213-EBE- and PthA4-EBEderived RACE products are 539 and 945 nucleotides long,
respectively, potentially favouring amplification of short
PthA3213-EBE-derived transcripts versus the longer PthA4-EBEderived transcripts.
Previously, similar RACE studies have been conducted for a
derivative of the rice executor gene Xa27, where the promoter
was equipped with six EBEs matching to Xoo and Xoc TALE
proteins (Hummel et al., 2012). These RACE studies suggested
that six different TALEs, for which designated pEBEs had been
integrated into the Xa27 promoter, induced transcripts with
mostly identical TSS rather than executor transcripts initiated by
each TALE at its designated high-affinity pEBE (Hummel
et al., 2012). Similarly, RACE studies for a set of six distinct TALEs,
designed to activate the rice OsSULTR3; 6 gene identified only for
two of six TALEs transcripts that were initiated ~50 nucleotides
downstream of corresponding EBEs (Wang et al., 2017).
The discrepancies between our results and those of previously
published studies may be explained, at least in part, by the
different promoter contexts in which the EBEs were embedded.
Alternatively, the studied rice genes might have TALE-dependent
next to TALE-independent (leaky) transcription, which could
possibly explain why some of the observed transcripts are not
initiated from TALE-predicted EBEs.
In summary, our RACE-based studies of our Xcc-TALE-trap
suggest that TALEs target preferentially code-predicted EBEs to
initiate executor transcripts. However, it also seems that RACEbased analysis of TALE-induced executor transcripts with distinct
50 UTRs may not provide a perfect reflection, but rather an
approximation of the EBE preferences of a given TALE.
The Xcc-TALE-trap provides broad spectrum and
potentially durable resistance to CBC
When we conceptually designed the Xcc-TALE-trap, the aim was
to create an R gene that would mediate both broad spectrum and
durable resistance to citrus canker. Indeed, our studies suggest
that the Xcc-TALE-trap mediates broad-spectrum resistance since
inoculation of a collection of Xcc strains originating from four
different continents showed that all strains trigger HR in the
transgenic line containing the Xcc-TALE-trap, but not in the
progenitor cultivar Duncan grapefruit (Figure 5). We also have
reason to believe that the Xcc-TALE-trap will be durable based on
the observation that most Xcc strains have multiple TALE genes
each independently triggering HR (Figures 1 and 3). Therefore, a
given Xcc strain must mutate several TALE genes simultaneously
to escape detection by the Xcc-TALE-trap. This is in contrast to
previously generated EBE-depleted pathogen-resistant plants,
where transcriptional activation of a particular S gene via one
newly evolved TALE that binds an alternative upstream EBE is
likely to be sufficient to regain host compatibility (Nowack
et al., 2022). We therefore assume that promoter traps mediating
recognition of multiple different TALEs are more likely to confer
durable resistance than host S gene derivatives in which the EBEs
for single TALEs have been mutated.
Given that the TALE DNA-binding domain is known to evolve
rapidly (Nowack et al., 2022), we wondered to what extent newly
evolved eTALEs from Xcc would be sensed by our Xcc-TALE-trap.
Four recently identified eTALEs that evolved in planta from the
CsLOB1-activating progenitor PthA4 enabled us to address this
question (Teper and Wang, 2021). The DNA binding domains of
these eTALEs and their precursor PthA4 are similar but distinct
(Figure S8). In this context, it is noteworthy that the Xcc-TALEtrap contains not only a high-affinity pEBE for the PthA4 protein,
but also seven additional pEBEs designed to recognize seven
native Xcc TALEs (PthB, PthC, PthAw, PthA*, PthA, Apl2 and PthA
ª 2023 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 21, 2019–2032
14677652, 2023, 10, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pbi.14109 by Zhejiang Normal University, Wiley Online Library on [02/05/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2028 Deepak Shantharaj et al.
3213; Figure 1b) that are predicted to bind the same target
region in the CsLOB1 promoter as PthA4 by similar but distinct
TALE repeat arrays. We therefore hypothesized that the
functional collective of eight sequence-related EBEs in the XccTALE-trap would have a high probability to sense PthA4-derived
eTALEs. Indeed, our RACE studies somewhat support this
hypothesis since in three out of four cases the eTALE-induced
executor transcripts are the consequence of interaction with
either the PthA4 pEBE (EBE15) or the sequence-related PthA 3213
pEBE (EBE3; Figure 7; Figures S7 and S8). In summary, our data
suggest that TALE traps containing multiple sequence-related
EBEs have the potential to sense in planta evolving eTALEs with
novel DNA binding domains, thereby conferring more durable
resistance to Xcc. We anticipate that future studies will improve
our understanding of the evolution of TALE DNA-binding
domains and may inspire improved trap designs that better
anticipate changes in the TALE DNA-binding domain. In
summary, our results suggest that the availability of the TALE
code, combined with the mechanistic understanding of the
evolution of the TALE DNA-binding domain, makes it possible to
construct TALE-specific R genes that confer effective protection
not only against currently existing Xcc TALEs, but presumably also
against newly evolving TALE proteins.
Experimental procedures
Construction of the binary vector for citrus
transformation
Binary vector pTLAB21 containing the Xcc-TALE-trap was modified
as follows: avrGf2 gene (Gochez et al., 2015) with SacI site was
amplified and ligated into vector pK7Bs314EBE:avrGf1-35Sterminator replacing avrGf1. The Bs3 promoter carrying 14 EBEs
was published previously (Shantharaj et al., 2017). The Bs314EBE:
avrGf1-35S-terminator was amplified with primers ATCCGG
AATTCATATGACATGTTC-TAATAAACGCTCTTTTCT containing
EcoRI, NdeI, and reverse primer having EcoRI, ATCCGGAATTCCCAT-GGCATGCTGGCTCCTTCAACGTTGCGG. The amplicon was
ligated into pCRTM/GW/TOPO (Life technologies, Carlsbad, California) with EcoRI site. The 35S terminator was amplified with primers
GGAATTCCATATGAGTCCGCAAAAATCACCA and GGAATTCCATATGTCACTGGATTTTGGTTT with NdeI site and ligated in front
of Bs314EBE. Cloned amplicons were amplified using Advantage
HD Polymerase (Clontech, Palo Alto, California). Orientation and
sequence was verified by Sanger sequencing. The 35S terminatorProBs314EBE:avrGf2-35S terminator sequence from pCRTM/GW/
TOPO was moved into pTLAB21 with EcoRI site. For plant
transformation, Agrobacterium strain EHA101 (C58, rif;
pTiBo542DT-DNA, kan) was transformed with plasmid pTLAB21
by electroporation. EHA101 transconjugants were selected on
streptomycin 50 mg/mL, kanamycin 50 mg/mL, and rifamycin
25 mg/mL.
Transient avrGf2 expression
The engineered binary construct with Xcc-TALE-trap was assayed
for HR induction transiently by Agrobacterium on intact
grapefruit leaves. A suspension of the A. tumefaciens EHA101
harbouring the binary construct was adjusted to OD600 = 0.3 and
infiltrated into citrus leaves. Five hours later the infiltrated areas
were infiltrated with Xcc306 suspensions adjusted to 5 9 108
cfu/mL. Plants were kept in the growth room at 28 °C, 12 h day/
12 h night photoperiod and RH of 60% and inspected for HR
symptoms.
Production of transgenic citrus plants
Agrobacterium-mediated transformation of Duncan grapefruit
was carried out as previously described (Orbovic and
Grosser, 2007). Transgenic shoots that sprouted from explants
co-incubated with Agrobacterium were selected based on the
GFP fluorescence. They were micrografted in vitro onto ‘Carrizo’
citrange [Citrus sinensis (L.) Osb. x Poncirus trifoliata (L.) Raf.]
rootstock and later acclimatized by transferring to sterile soil.
Once they reached the height of 25–30 cm, they were moved to
the greenhouse and transferred to 15 cm diameter pots to obtain
larger shoots. Genomic DNA was isolated from leaves and tested
for ProBs314EBE:avrGf2 by PCR. Transgenic plant material that
tested positive was multiplied by grafting. Grafted plants were
acclimatized in the greenhouse and tested for canker resistance.
Plant pathogenicity assays
The experiments were conducted in the greenhouse environmental conditions at ambient air temperature at 25 °C day/21 °C
night with humidity 60% day/night. Pathogenicity towards
Xcc306 was determined by inoculating leaves of transgenic and
wild-type Duncan grapefruit by bacterial suspension using four
methods: (i) Infiltration assay in which leaves were infiltrated with
bacterial suspensions adjusted to 108 cfu/mL and the leaves were
observed for HR daily for 4 days. (ii) Population growth assay
where bacterial suspension was adjusted to 105 cfu/mL and
infiltrated using a hypodermic needle and syringe. Leaf discs of 1
cm2 were harvested at 0, 2, 4, 6, and 8 days after infiltration with
a cork borer and then ground in 1 mL sterile tap water. The
homogenate was serially diluted and plated on NA plates.
Colonies were counted 48 h after plating. (iii) A leaf pin prick
assay was done by placing a drop of bacterial suspension
(108 cfu/mL) on the adaxial leaf surface and then the leaf was
pinpricked through the drop with a syringe and hypodermic
needle. Leaves were inspected for canker lesions at a regular time
interval. (iv) A spray inoculation test in which the plants were
misted with a bacterial suspension adjusted to 108 cfu/mL and
bagged for 48 h. Plants were monitored for a regular period for
canker lesion appearance.
Quantitative real-time PCR
Leaves of transgenic grapefruit carrying the Xcc-TALE-trap were
infiltrated with either sterile tap water (mock), or bacterial
suspensions (Xcc306 or Xcc306D4) prepared in sterile tap water.
Suspensions were adjusted to an OD600 = 0.3 (~5 9 108 cfu/mL).
The experiment consisted of two replicates consisting of two leaf
discs (1 cm2 leaf tissue), which were collected and flash-frozen in
liquid nitrogen at 0, 24, and 48 h post-inoculation (h p.i.).
Samples were powdered using a 1600 MiniGTM SPEX sample prep
machine and RNA was extracted using TRI Reagent (Sigma
Chemical Company, St. Louis, Missouri) according to the
manufacturer’s protocol. Following extraction, RNA samples were
treated with DNase (TURBO DNA-freeTM kit; Invitrogen by Thermo
Fisher Scientific, Waltham, Massachusetts). A total quantity of
600 ng of RNA was used per sample to synthesize cDNA by
reverse transcription using the ProtoScript II First Strand cDNA
Synthesis Kit (New England Biolabs, Ipswich, Massachusetts) with
the anchored oligo-d(T) primer [d(T)23VN]. Real-time PCR was
carried out on a CFX96TM Real-Time System (Bio-Rad Laboratories,
Berkeley, California) using SsoFastTM EvaGreen Supermix and 2 lL
of 1:10 diluted cDNA template. Each experimental sample was
replicated three times. Amplicons were subjected to melting
ª 2023 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 21, 2019–2032
14677652, 2023, 10, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pbi.14109 by Zhejiang Normal University, Wiley Online Library on [02/05/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
A TALE-trapping promoter confers canker resistance 2029
curve analysis (65–95 °C in 0.5 °C increments). PCR for avrGf2
was accomplished using the primer set qavrGf2F (Table S4). PCR
of citrus Ef1a was used as constitutive standard (Table S4). The
expression data were analysed by relative quantification normalized to a reference gene using 2DDCT.
Rapid amplification of cDNA ends
50 RACE was carried out on transgenic grapefruit inoculated with
transconjugants containing individual TALEs or eTALEs. Suspensions were adjusted to an OD600 of 0.3 (5 9 108 cfu/mL). Plants
were kept in the greenhouse. For each sample, 2 cm2 leaf discs
were collected and flash-frozen in liquid nitrogen 48 h after
infiltration. Samples were powdered using a 1600 MiniGTM SPEX
sample prep machine and total RNA was extracted using TRI
Reagent (Sigma Chemical Company) according to manufacturer’s
protocol. Following extraction, RNA samples were treated with
DNase (TURBO DNA-freeTM kit, Invitrogen by Thermo Fisher
Scientific). A total quantity of 1000 ng of RNA was used per
sample to synthesis 50 -RACE-ready cDNA using the SMARTer
RACE 50 /30 kit (Takara Bio USA, Inc., Mountain View, CA)
following the kit protocol. Primary 50 -RACE PCR reactions and
nested PCR were accomplished following kit guidelines using
avrGf2 gene-specific primers (GSPs) GSP-150, GSP249, and
GSP589 (Table S4). RACE products were cloned into the pRACE
vector and sequenced using the M13F universal primer.
Comparing Xcc-TALE-trap transgenic and nontransgenic Duncan grapefruit under field conditions
Nine Xcc-TALE-trap transgenic citrus trees and seven wild-type
Duncan grapefruit trees were planted at a USDA facility in Fort
Pierce, Florida on 28 March 2019 in a randomized design. Plants
were spaced 76 cm apart. Following transplanting of these trees
into the field, trees were typically sprayed every 2 weeks for insect
control only. Trees were exposed to natural inoculum from citrus
canker-infected trees. Trees were rated for disease severity on 5
June, 27 September, and 3 December 2019. The disease severity
ratings were based on a scale from 1 to 4 (1: no visible canker
symptoms, 2: a few lesions, 3: prevalent lesions on multiple leaves
and 4: many lesions on individual leaves and widely distributed on
the tree). Statistical analysis of disease ratings at each time point
was conducted using the nonparametric Wilcoxon rank-sum test in
PROC NPAR1WAY of SAS (SAS Institute, Cary, NC).
Accession numbers
The nucleotide sequence of pTLab21, a T-DNA plasmid containing the Xcc-TALE-trap has been deposited at GenBank under the
accession number: OQ601558.
Acknowledgements
We thank the 2Blades Foundation and Citrus Research and
Development Foundation for funding this project. The authors
thank the Division of Plant Industry, Florida Department of
Agriculture and Consumer Services for providing X. citri strains for
this study. ICBR-UF DNA sequencing facility for Sanger sequencing all the engineered clones. We thank all staff of the Core Citrus
Transformation Facility at UF-Citrus transformation centre, lake
Alfred, Florida. We also thank Prof. Nian Wang (University of
Florida) for kindly providing us with in planta developed PthA4
derivatives. DFG grant LA 1338/9-1 has supported the citrus
research in the Lahaye laboratory. Open Access funding enabled
and organized by Projekt DEAL.
Conflicts of interest
The authors declare no conflict of interest.
Author contributions
D.S. carried out all experimental work, unless otherwise stated,
and prepared the first draft of the article. G.V.M. carried out
RACE studies. V.O. carried out the transformation of grapefruit
plants. D.H. and P.R. designed the EBE assembly of the Xcc-TALEtrap. D.R.H carried out data and statistical analysis related to
Figures 3 and 4; Figure S3 and edited the article. T.L. was involved
in the conceptual design of the Xcc-TALE-trap and prepared a
revised version of the article figures and text. J.J. conceived the
idea, supervised the experimental studies, coordinated the
project, and assisted in drafting and finalizing the manuscript.
All authors read the article and approved the final version.
References
Antony, G., Zhou, J., Huang, S., Li, T., Liu, B., White, F. and Yang, B. (2010) Rice
xa13 recessive resistance to bacterial blight is defeated by induction of the
disease susceptibility gene Os-11N3. Plant Cell, 22, 3864–3876.
Bonas, U., Stall, R.E. and Staskawicz, B. (1989) Genetic and structural
characterization of the avirulence gene avrBs3 from Xanthomonas
campestris pv. vesicatoria. Mol. Gen. Genet. 218, 127–136.
Conti, G., Xoconostle-Cazares, B., Marcelino-Perez, G., Hopp, H.E. and Reyes,
C.A. (2021) Citrus genetic transformation: an overview of the current
strategies and insights on the new emerging technologies. Front. Plant Sci.
12, 768197.
Doyle, E.L., Booher, N.J., Standage, D.S., Voytas, D.F., Brendel, V.P., Vandyk,
J.K. and Bogdanove, A.J. (2012) TAL effector-nucleotide targeter (TALE-NT)
2.0: tools for TAL effector design and target prediction. Nucleic Acids Res. 40,
W117–W122.
€ller, C.W. (2022) Structural insights into
Girbig, M., Misiaszek, A.D. and Mu
nuclear transcription by eukaryotic DNA-dependent RNA polymerases. Nat.
Rev. Mol. Cell Biol. 23, 603–622.
Gochez, A.M., Minsavage, G.V., Potnis, N., Canteros, B.I., Stall, R.E. and Jones,
J.B. (2015) A functional XopAG homologue in Xanthomonas fuscans pv.
aurantifolii strain C limits host range. Plant Pathol. 64, 1207–1214.
Gochez, A.M., Shantharaj, D., Potnis, N., Zhou, X., Minsavage, G.V., White,
F.F., Wang, N. et al. (2017) Molecular characterization of XopAG effector
AvrGf2 from Xanthomonas fuscans ssp. aurantifolii in grapefruit. Mol. Plant
Pathol. 18, 405–419.
Hu, Y., Zhang, J., Jia, H., Sosso, D., Li, T., Frommer, W.B., Yang, B. et al. (2014)
Lateral organ boundaries 1 is a disease susceptibility gene for citrus bacterial
canker disease. Proc. Natl Acad. Sci. USA, 111, E521–E529.
Huang, X., Wang, Y. and Wang, N. (2021) Highly efficient generation of
canker-resistant sweet orange enabled by an improved CRISPR/Cas9 system.
Front. Plant Sci. 12, 769907.
Huang, X., Wang, Y. and Wang, N. (2022) Base editors for citrus gene editing.
Front. Genome Ed. 4, 852867.
Hummel, A.W., Doyle, E.L. and Bogdanove, A.J. (2012) Addition of transcription
activator-like effector binding sites to a pathogen strain-specific rice bacterial
blight resistance gene makes it effective against additional strains and against
bacterial leaf streak. New Phytol. 195, 883–893.
Ji, C., Ji, Z., Liu, B., Cheng, H., Liu, H., Liu, S., Yang, B. et al. (2020) Xa1 allelic R
genes activate rice blight resistance suppressed by interfering TAL effectors.
Plant Commun. 1, 100087.
Ji, Z., Sun, H., Wei, Y., Li, M., Wang, H., Xu, J., Lei, C. et al. (2022) Ectopic
expression of executor gene Xa23 enhances resistance to both bacterial and
fungal diseases in rice. Int. J. Mol. Sci. 23, 6545.
Jia, H., Orbovic, V., Jones, J.B. and Wang, N. (2016) Modification of the PthA4
effector binding elements in Type I CsLOB1 promoter using Cas9/sgRNA to
produce transgenic Duncan grapefruit alleviating XccDpthA4:dCsLOB1.3
infection. Plant Biotechnol. J. 14, 1291–1301.
ª 2023 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 21, 2019–2032
14677652, 2023, 10, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pbi.14109 by Zhejiang Normal University, Wiley Online Library on [02/05/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2030 Deepak Shantharaj et al.
Jia, H.G., Zhang, Y.Z., Orbovic, V., Xu, J., White, F.F., Jones, J.B. and Wang, N.
(2017) Genome editing of the disease susceptibility gene CsLOB1 in citrus
confers resistance to citrus canker. Plant Biotechnol. J. 15, 817–823.
Jia, H., Omar, A.A., Orbovic, V. and Wang, N. (2022a) Biallelic editing of the
LOB1 Promoter via CRISPR/Cas9 creates canker-resistant ‘Duncan’ grapefruit.
Phytopathology, 112, 308–314.
Jia, H., Wang, Y., Su, H., Huang, X. and Wang, N. (2022b) LbCas12a-D156R
efficiently edits LOB1 effector binding elements to generate canker-resistant
citrus plants. Cell, 11, 315.
Kay, S., Hahn, S., Marois, E., Hause, G. and Bonas, U. (2007) A bacterial
effector acts as a plant transcription factor and induces a cell size regulator.
Science, 318, 648–651.
Li, Z., Lifang, Z., Gang, Y., Li, X., Zhiyuan, J., Muhammad, Z., Ni, H. et al. (2014)
A potential disease susceptible gene CsLOB of citrus is targeted by a major
virulence effector PthA of Xanthomonas citri subsp. citri. Mol. Plant, 7, 912–
915.
Maruta, N., Burdett, H., Lim, B.Y.J., Hu, X., Desa, S., Manik, M.K. and Kobe, B.
(2022) Structural basis of NLR activation and innate immune signalling in
plants. Immunogenetics, 74, 5–26.
Naqvi, S.A.H., Wang, J., Malik, M.T., Umar, U.-U.-D., Ateeq Ur, R., Hasnain, A.,
Sohail, M.A. et al. (2022) Citrus canker - distribution, taxonomy,
epidemiology, disease cycle, pathogen biology, detection, and
management: a critical review and future research agenda. Agronomy, 12,
1075.
Nowack, M.K., Holmes, D.R. and Lahaye, T. (2022) TALE-induced cell death
executors: an origin outside immunity? Trends Plant Sci. 27, 536–548.
Orbovic, V. and Grosser, J.W. (2007) Citrus. In Agrobacterium Protocols, Vol. 2
(Wang, K., ed), pp. 177–189. Totowa, NJ: Humana Press.
Peng, A.H., Chen, S.C., Lei, T.G., Xu, L.Z., He, Y.R., Wu, L., Yao, L.X. et al.
(2017) Engineering canker-resistant plants through CRISPR/Cas9-targeted
editing of the susceptibility gene CsLOB1 promoter in citrus. Plant Biotechnol.
J. 15, 1509–1519.
Plaschka, C., Hantsche, M., Dienemann, C., Burzinski, C., Plitzko, J. and
Cramer, P. (2016) Transcription initiation complex structures elucidate DNA
opening. Nature, 533, 353–358.
Read, A.C., Hutin, M., Moscou, M.J., Rinaldi, F.C. and Bogdanove, A.J. (2020a)
Cloning of the rice Xo1 resistance gene and interaction of the Xo1 protein
with the defense-suppressing Xanthomonas effector Tal2h. Mol. Plant
Microbe Interact. 33, 1189–1195.
Read, A.C., Moscou, M.J., Zimin, A.V., Pertea, G., Meyer, R.S., Purugganan,
M.D., Leach, J.E. et al. (2020b) Genome assembly and characterization of a
complex zfBED-NLR gene-containing disease resistance locus in carolina gold
select rice with nanopore sequencing. PLoS Genet. 16, e1008571.
Roeschlin, R.A., Uviedo, F., Garcia, L., Molina, M.C., Favaro, M.A., Chiesa,
M.A., Tasselli, S. et al. (2019) PthA4(AT), a 7.5-repeats transcription activatorlike (TAL) effector from Xanthomonas citri ssp. citri, triggers citrus canker
resistance. Mol. Plant Pathol. 20, 1394–1407.
€mer, P., Hahn, S., Jordan, T., Strauß, T., Bonas, U. and Lahaye, T. (2007)
Ro
Plant-pathogen recognition mediated by promoter activation of the pepper
Bs3 resistance gene. Science, 318, 645–648.
€mer, P., Recht, S. and Lahaye, T. (2009a) A single plant resistance gene
Ro
promoter engineered to recognize multiple TAL effectors from disparate
pathogens. Proc. Natl Acad. Sci. USA, 106, 20526–20531.
€mer, P., Strauss, T., Hahn, S., Scholze, H., Morbitzer, R., Grau, J., Bonas, U.
Ro
et al. (2009b) Recognition of AvrBs3-like proteins is mediated by specific
binding to promoters of matching pepper Bs3 alleles. Plant Physiol. 150,
1697–1712.
Rybak, M., Minsavage, G.V., Stall, R.E. and Jones, J.B. (2009) Identification of
Xanthomonas citri ssp. citri host specificity genes in a heterologous
expression host. Mol. Plant Pathol. 10, 249–262.
€rlebeck, D., Peart, J., Baulcombe, D., Baker, B.,
Schornack, S., Ballvora, A., Gu
Ganal, M. et al. (2004) The tomato resistance protein Bs4 is a predicted
non-nuclear TIR-NB-LRR protein that mediates defense responses to
severely truncated derivatives of AvrBs4 and overexpressed AvrBs3. Plant
J. 37, 46–60.
€mer, P., Figueiredo, J.F.L., Minsavage, G.V., Kro
€nauer, C.,
Shantharaj, D., Ro
Stall, R.E., Moore, G.A. et al. (2017) An engineered promoter driving
expression of a microbial avirulence gene confers recognition of TAL effectors
and reduces growth of diverse Xanthomonas strains in citrus. Mol. Plant
Pathol. 18, 976–989.
Sharma, A., Abrahamian, P., Carvalho, R., Choudhary, M., Paret, M.L., Vallad,
G.E. and Jones, J.B. (2022) Future of bacterial disease management in crop
production. Annu. Rev. Phytopathol. 60, 259–282.
€mer, P., Minsavage, G.V., Singh, S.,
Strauß, T., Van Poecke, R., Strauß, A., Ro
Wolf, C. et al. (2012) RNA-seq pinpoints a Xanthomonas TAL-effector
activated resistance gene in a large crop genome. Proc. Natl Acad. Sci. USA,
109, 19480–19485.
Streubel, J., Baum, H., Grau, J., Stuttmann, J. and Boch, J. (2017)
Dissection of TALE-dependent gene activation reveals that they induce
transcription cooperatively and in both orientations. PLoS One, 12,
e0173580.
Teper, D. and Wang, N. (2021) Consequences of adaptation of TAL
effectors on host susceptibility to Xanthomonas. PLoS Genet. 17,
e1009310.
Teper, D., White, F.F. and Wang, N. (2023) The dynamic transcription activatorlike effector family of Xanthomonas. Phytopathology, 113, 651–666.
Tian, D., Wang, J., Zeng, X., Gu, K., Qiu, C., Yang, X., Zhou, Z. et al.
(2014) The rice TAL effector-dependent resistance protein XA10 triggers
cell death and calcium depletion in the endoplasmic reticulum. Plant
Cell, 26, 497–515.
Tran, T.T., Perez-Quintero, A.L., Wonni, I., Carpenter, S.C.D., Yu, Y., Wang, L.,
Leach, J.E. et al. (2018) Functional analysis of African Xanthomonas oryzae
pv. oryzae TALomes reveals a new susceptibility gene in bacterial leaf blight
of rice. PLoS Pathog. 14, e1007092.
Triplett, L.R., Cohen, S.P., Heffelfinger, C., Schmidt, C.L., Huerta, A., Tekete, C.,
Verdier, V. et al. (2016) A resistance locus in the American heirloom rice
variety carolina gold select is triggered by TAL effectors with diverse predicted
targets and is effective against African strains of Xanthomonas oryzae pv.
oryzicola. Plant J. 87, 472–483.
Wang, C., Zhang, X., Fan, Y., Gao, Y., Zhu, Q., Zheng, C., Qin, T. et al. (2015)
XA23 is an executor R protein and confers broad-spectrum disease resistance
in rice. Mol. Plant, 8, 290–302.
Wang, L., Rinaldi, F.C., Singh, P., Doyle, E.L., Dubrow, Z.E., Tran, T.T., PerezQuintero, A.L. et al. (2017) TAL effectors drive transcription bidirectionally in
plants. Mol. Plant, 10, 285–296.
Wu, B., Yu, Q., Deng, Z., Duan, Y., Luo, F. and Gmitter, F., Jr. (2022) A
chromosome-level phased genome enabling allele-level studies in sweet
orange: a case study on citrus Huanglongbing tolerance. Hortic. Res. 10,
uhac247.
Yuan, M., Ke, Y., Huang, R., Ma, L., Yang, Z., Chu, Z., Xiao, J. et al. (2016) A
host basal transcription factor is a key component for infection of rice by
TALE-carrying bacteria. Elife, 5, e19605.
Zeng, X., Tian, D., Gu, K., Zhou, Z., Yang, X., Luo, Y., White, F.F. et al. (2015)
Genetic engineering of the Xa10 promoter for broad-spectrum and durable
resistance to Xanthomonas oryzae pv. oryzae. Plant Biotechnol. J. 13,
993–1001.
Supporting information
Additional supporting information may be found online in the
Supporting Information section at the end of the article.
Figure S1 An avrGf2-based promoter trap triggers cell death in
grapefruit only when being inoculated together with Xcc306, a
Xanthomonas strain containing TALEs matching to the promoter
trap.
Figure S2 A diagnostic PCR shows an avrGf2-specific amplification product on template DNA from one plant of several putative
transgenic grapefruit plants.
Figure S3 In transgenic grapefruit lines containing the Xcc-TALEtrap, Xcc306 TALE proteins transcriptionally activate both the
avrGf2 executor transgene as well as the CsLOB1 endogene.
Figure S4 A promoter trap with tandem-arranged EBEs mediates
recognition of four distinct TALE proteins from Xcc306.
ª 2023 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 21, 2019–2032
14677652, 2023, 10, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pbi.14109 by Zhejiang Normal University, Wiley Online Library on [02/05/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
A TALE-trapping promoter confers canker resistance 2031
Figure S5 A transgenic grapefruit line, with a promoter trap,
designed to recognize Xcc TAL effectors, does not show HR
upon delivery of TAL effectors from X. oryzae pv. oryzae.
Figure S6 Xcc strains from different continents all have TALE
genes.
Figure S7 Location of transcriptional start sites (TSS) of avrGf2
executor transcripts within the Xcc-TALE-trap.
Figure S8 Evolved PthA4-derived TALEs transcriptionally activating the CsLOB1 promoter and the Xcc-TALE-trap.
Table S1 Collection of Xcc strains of distinct geographical origin
that were inoculated into leaves of Duncan grapefruit and a
derived transgenic line containing the Xcc-TALE-trap.
Table S2 The Xcc-TALE-trap confers resistance to citrus canker in
a field study.
Table S3 Features of engineered executor R genes.
Table S4 List of primers used in this study.
ª 2023 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd., 21, 2019–2032
14677652, 2023, 10, Downloaded from https://onlinelibrary.wiley.com/doi/10.1111/pbi.14109 by Zhejiang Normal University, Wiley Online Library on [02/05/2024]. See the Terms and Conditions (https://onlinelibrary.wiley.com/terms-and-conditions) on Wiley Online Library for rules of use; OA articles are governed by the applicable Creative Commons License
2032 Deepak Shantharaj et al.