Functional analysis of the cell cycle
control gene cdc18 in
Schizosaccharomyces pombe
Emma Jane Greenwood
A thesis submitted for the degree of Doctor of Philosophy
University of London
Cell Cycle Laboratory
Imperial Cancer Research Fund
44 Lincoln's Inn Fields
London WC2A 3PX
September 2000
ProQuest Number: 10042731
All rights reserved
INFORMATION TO ALL USERS
The quality of this reproduction is dependent upon the quality of the copy submitted.
In the unlikely event that the author did not send a complete manuscript
and there are missing pages, these will be noted. Also, if material had to be removed,
a note will indicate the deletion.
uest.
ProQuest 10042731
Published by ProQuest LLC(2016). Copyright of the Dissertation is held by the Author.
All rights reserved.
This work is protected against unauthorized copying under Title 17, United States Code.
Microform Edition © ProQuest LLC.
ProQuest LLC
789 East Eisenhower Parkway
P.O. Box 1346
Ann Arbor, Ml 48106-1346
Acknowledgments
So m any people to thank, so little space!! My tim e at ICRF has been tough but
extremely rew arding. The Cell Cycle Laboratory continues to be an interesting,
stim ulating and friendly place, despite the constant changeover in co-workers. For
that I w ould like to thank all members of the laboratory, past and present.
I would especially like to thank Paul Nurse for his supervision and encouragement
and for always showing me the light at the end of the tunnel.
I would also like to thank:
Chris Lehane and Nigel Peat for running the lab so well and m aking m y life so
m uch easier. Nigel has been incredibly helpful and has show n immense patience
w ith m y com puter illiteracy.
Fhdeo N ishitani for initiating me into the ways of fission yeast and w orking in
collaboration w ith me on the work shown in Figures 2.3 A and 2.4.
Zoi Lygerou for showing me the right way and José Ay té for showing me the quick
way, both of you have given me great advice.
Stephanie Yanow for being a great friend, for the DNA replication discussions and
for reading m y thesis.
To my friends and family for being there.
Finally I w ould like to thank Jacky H ayles, for her constant su p p o rt and
encouragem ent and for m aking me laugh. I couldn't have got through it without
you.
I w ould like to dedicate this thesis to Stéphane, who has p u t up w ith me for the
last three years. I hope you continue to do so!
This PhD was funded by the Imperial Cancer Research Fund
Abstract
The Schizosaccharomyces pombe gene cdclS has a role both in prom oting D N A replication and
initiating the checkpoint that acts to prevent m itosis until D N A replication has been successfully
com pleted. It therefore plays an essential role in coordinating the cell cycle, thus m aintaining
genom e integrity. I perform ed a functional analysis of cdclS in order to u n d ersta n d its role
throughout the cell cycle.
1 used different cdclS p constructs to discover w hich dom ains of the protein are required to carry
out its functions. 1 exam ined this by assaying the ability of cells to re-replicate and block m itosis
when the constructs w ere overexpressed. 1 discovered that the C -term inus of cdcISp is required
for the re-replication phenotype and that this does not require a decrease in the activity of the
mitotic kinase. The C -term inus is also required for the checkpoint function of cdclSp. The Nterm inus of cdclS p can also block m itosis indirectly by binding to cdc2p.
1 then exam ined the Saccharomyces cerevisiae {ScCDCô), Xenopus laevis {X1CDC6) and Homo sapiens
(HsCDC6) cdclS hom ologues to determ ine their ability to com plem ent the cdcl8-K46 m utant. I
also investigated w hether they, like cdcl8, are able to induce re-replication w h en overexpressed.
N one of the hom ologues w as able to com plem ent cdcl8-K46, b u t overexpression of ScCDCô was
able to induce re-replication.
Finally, 1 constructed a strain in w hich cdcl8 was un d er the control of a repressible prom oter. I
m ade several site specific m utants of c d c l 8 - t h e nucleotide triphosphate (NTP) binding and
hydrolysis m otif m utants, know n as the W alker A (WA) and W alker B (WB) m utants,
respectively, the putative nuclear localization signal m utants (NLSl, NLS2 an d NLS1+NLS2) and
the cdc2p pho sp h o rylation site m u tan t (Pl-6) - and introduced these at a different locus, w here
they were expressed u n d e r control of the cdcl8 prom oter. I investigated w hether the m utants
could proliferate in the absence of w ild type cdcl8. O nly the cdcl8 WA and WB m utants failed to
proliferate u n d er these conditions. The WA m utant cannot initiate replication b u t is unable to
inhibit mitosis, so undergoes an aberrant m itosis. The WB m u tan t is able to initiate, b u t not
complete, replication and initiates a checkpoint signal. H ow ever, the checkpoint cannot be
m aintained and cells also enter an aberrant mitosis.
Contents
Chapter 1
Introduction
1.1 The Cell Cycle
12
1.2 Cyclin Dependent Kinases-master regulators of the cell cycle
15
1.2.1 Cyclins
16
1.2.2 Phosphorylation
17
1.2.3 CDK inhibitors
19
1.3 Initiation of mitosis
21
1.4 Initiation of DNA replication
23
1.4.1 Origins
25
1.4.2 ORC
26
1.4.3 CdclS
28
1.4.4 MCMs
30
1.4.5 Additional pre-replicative complex proteins
32
1.4.6 Cdc2p / cyclin activity
34
1.4.7 H s k lp /d fp lp kinase
35
1.5 Alternation problem
36
1.6 Completion problem
39
Chapter 2
Characterization of odd 8 domains and their ability to perform
essential odd Bp functions
Introduction
47
Results
48
2.1 The C-terminus of cdclSp is sufficient for cdclSp induced re-replication
4S
2.2 CdclSp induced re-replication is not caused by inhibition of the
50
cdc2p/cdclSp mitotic kinase
2.3 Requirement of checkpoint genes for the mitotic block
52
2.4 The NTP binding motif is required both for re-replication
54
and initiation of the checkpoint signal
2.5 Requirement for cut5
54
2.6 Requirement for cell cycle core machinery
55
Discussion
57
Chapter 3
A functional analysis of the cdc18 homologues in
Schizosaccharomyces pombe
Introduction
77
Results
7S
3.1 CdclS has homologues in Saccharomyces cerevisiae, Xenopus laevis and
7S
Homo sapiens
3.2 ScCDCô and XlCdcô initially appeared to complement cdcl8-K46
79
3.3 Ability of RepSl-ScCDC6 and Rep41-XlCDC6+Rep42-cdtl to form
SI
colonies at 36°C
3.4 Ability of RepSl-ScCDC6 and Rep41-XlCDC6+Rep42-cdtl to grow in
S3
liquid media at 36°C
3.5 Overexpression of ScCDCô induces re-replication to a similar level
S4
as cdclS
3.6 ScCdc6p induced re-replication requires cdclSp function but does
S5
not increase its endogenous protein levels
Discussion
S6
Chapter 4
A mutational analysis of cdc18
Introduction
99
Results
100
4.1 Characterization of the 81-cdcl8 S /0 strain
100
4.2 A 5.2kb genomic fragment of cdcl8 complements the 81-cdcl8 S /0 strain 101
4.3 M utant construction
103
4.4 Complementation of m utants
106
4.5 Quantitative analysis of the NTP binding (WA) and hydrolysis (WB)
111
m utants
4.6 The 81-cdcl8 S/O-VJB and cdcl8-K46 m utants arrest w ith the same
113
kinetics b ut different terminal phenotypes
4.7 The 81-cdcl8 S/O-WB strain exhibits a delay over S phase initiation
115
after release from a HU block
4.8 Does cdclSp interact directly w ith the MCM proteins
117
Discussion
121
Chapter 5
General Discussion
Introduction
158
5.1 Regulation of cdclSp
159
5.2 Function of cdclSp
163
Summary
172
Chapter 6
Materials and Methods
6.1 Fission yeast physiology and genetics
6
173
6.1.1 Nomenclature
173
6.1.2 Strain growth and maintenance
174
6.1.3 Strain construction
175
6.1.4 Transformation and integration of plasmids
176
6.1.5 Induction and repression of gene expression from the nm t
176
prom oter
6.1.6 Physiological experiments with Hydroxyurea
176
6.1.7 Flow cytometric analysis
177
6.1.8 Cell num ber determination
177
6.2 Molecular Biology Techniques
177
6.2.1 General techniques
177
6.2.2 DNA preparation
178
6.2.3 Southern blotting
178
6.2.4 DNA probes
178
6.2.5 Construction of plasmids
178
6.2.6 DNA sequencing
180
6.2.7 Cell Extract Preparation
180
6.2.8 Western Blotting
182
6.2.9 Suclp bead precipitation
182
6.2.10 Immunoprécipitations
183
6.2.11 Histone kinase assays
183
6.2.12 Visualisation of nuclei by DAPI staining
183
6.2.13 Visualisation of septa by calcofluor staining
183
Bibliography
is4
Appendix
Published work
218
Contents
Tables and figures
Chapter 1
Introduction
Table 1.1 Comparison of gene names between Schizosaccharomyces pombe
24
and Saccharomyces cerevisiae of genes required for DNA replication
Table 1.2 Com parison of gene names between Schizosaccharomyces pombe
40
and Saccharomyces cerevisiae of genes involved in the checkpoint pathw ay
Figure 1.1 The fission yeast life cycle
42
Figure 1.2 Principles of CDK regulation
43
Figure 1.3 B-type cyclins control S phase and mitosis in fission yeast
44
Figure 1.4 Model for the initiation of DNA replication
45
Figure 1.5 Model showing how checkpoint signals could be transm itted
46
to the cell cycle machinery
Chapter 2
Characterization of odd 8 domains and their ability to perform
essential functions
Figure 2.1 cdclS constructs
63
Figure 2.2 Overproduction of the C-terminus of cdclSp is required and
64
sufficient for DNA re-replication
Figure 2.2 C and D
65
Figure 2.3 cdclSp induced re-replication does not require depression of
66
the cdc2p/cdcl3p mitotic kinase
Figure 2.4 cdcl8-150-577p does not interact w ith cdc2p directly
67
Figure 2.5 The C-terminus of cdcl8p does not induce increased levels of
68
ru m lp w hen overproduced
Figure 2.6 cdcl8p induced re-replication can occur in the absence of ru m lp
69
Figure 2.7 The cdcl8p C-terminus is unable to block mitosis w hen
70
overproduced in a checkpoint deficient background
Figure 2.7 C and D
71
Figure 2.8 An intact NTP site is required both to induce re-replication and
72
to initiate the checkpoint
Figure 2.9 The C-terminus of cdcl8p also requires cut5p to prevent mitosis
73
Figure 2.10 The checkpoint induced by cdcl8p overproduction does not act
74
solely through the cdc25p phosphatase
Figure 2.11 The w e e lp /m ik lp tyrosine kinases are required for the
75
DNA replication checkpoint that acts through cdcl8p
Figure 2.12 Model for the role of cdcl8p in the DNA replication checkpoint
76
Chapter 3
A functional analysis of cdc18 homologues in
Schizosaccharomyces pombe
Table 3.1 Rep81-ScCDC6 and Rep41-XlCDC6+Rep42-cdtl appeared to
82
complement cdcl8-K46 w hen the ability to form colonies was assayed
Figure 3.1 Sequence alignment of cdcl8p and homologues
90
Figure 3.2 Strategy used to investigate whether the cdcl8 homologues
91
complement the cdcl8-K46 tem perature sensitive m utant
Figure 3.3 Rep81-ScCDC6 and Rep41-XlCDC6+Rep42-cdtl appeared
92
to complement cdcl8-K46 w hen the ability to form colonies at 36°C was
assayed
Figure 3.4 Rep81-ScCDC6 did not appear to complement w hen the
93
ability to grow in liquid media at 36°C was assayed
Figure 3.5 Rep41-XlCDC6+Rep42-cdtl did not appear to complement
w hen the ability to grow in liquid media at 36°C was assayed
94
Figure 3.6 ScCdc6p can induce re-replication to similar levels as cdclSp
95
w hen co-overproduced w ith cdtlp
Figure 3.7 ScCdc6p can prom ote re-replication w ithout the increase of
96
endogenous cdclSp levels
Figure 3.7 B
97
Figure 3.7 C
9S
Chapter 4
A mutational analysis of cdc18
Table 4.1 Construction of m utants
105
Figure 4.1 Characterization of the 81-cdcl8 S /0 strain
127
Figure 4.2 A 5.2kb genomic fragment of cdclS (gcdclS) complements the
12S
81-cdcl8 S /0 strain both w hen integrated and w hen expressed from a
multicopy plasmid
Figure 4.2 B and C
129
Figure 4.3 cdclS DNA and protein sequences and motifs
130
Figure 4.4 pJK14S and pJK14S-gcdclS-3HA and m utants are all integrated
131
at the leul locus in the 81-cdcl8 S/O strain
Figure 4.4 B
132
Figure 4.5 The vector pJK14S does not complement the 81-cdcl8 S /0 strain
133
w hen integrated at the leul locus
Figure 4.5 C and D
134
Figure 4.6 pJK14S-gcdclS-3HA does complement the 81-cdcl8 S /0 strain
135
w hen integrated at the leul locus
Figure 4.6 C and D
136
Figure 4.7 pJK14S-gcdclS-3HA WA does not complement the 81-cdcl8 S /0
137
strain when integrated at the leul locus
Figure 4.7 C and D
138
Figure 4.8 pJK148-gcdcl8-3HA WB does not complement the 81-cdcl8 S /0
139
strain w hen integrated at the leul locus
Figure 4.8 C and D
140
Figure 4.9 pJK148-gcdcl8-3FIA NLSl does complement the 81-cdcl8 S /0
141
strain when integrated at the leul locus
10
Figure 4.9 C and D
142
Figure 4.10 pJK148-gcdcl8-3FIA NLS2 does complem ent the 81-cdcl8 S /0
143
strain w hen integrated at the leul locus
Figure 4.10 C and D
144
Figure 4.11 pJK148-gcdcl8-3HA N1+N2 does complem ent the 81-cdcl8 S /0 145
strain w hen integrated at the leul locus
Figure 4.11 C and D
146
Figure 4.12 pJKl48-gcdc 18-3HA Pl-6 does complement the 81-cdcl8 S /0
147
strain w hen integrated at the leul locus
Figure 4.12 C and D
148
Figure 4.13 Comparison of the kinetics of 81-cdcl8 S/O-JK, 81-cdcl8 S/O-V/A 149
and 81-cdcl8 S/O-WB
Figure 4.14 The cdcl8-K46 m utant arrests with similar kinetics as
150
81-cdcl8 S/O-WB but w ith a different terminal phenotype
Figure 4.14 C and D
151
Figure 4.15 The 81-cdcl8 S/O-WB strain completes S phase after release
152
from an HU block then initiates a second round of replication after a 60
m inute delay
Figure 4.15 B and C
153
Figure 4.16 An interaction between cdcl8p and cdc21p can not be detected
154
in exponentially growing cells
Figure 4.17 An interaction between cdcl8p and cdc21p can not be detected
155
in an HU block, or 80 and 100 minutes after release
Figure 4.17 D
156
Figure 4.17 E
157
Chapter 6
Materials and Methods
Table 6.1 Fission yeast strains previously constructed
174
Table 6.2 Fission yeast strains newly constructed
175
Table 6.2 Antibodies used for W estern blotting and im m unoprécipitation
182
11
Chapter 1
Introduction
1.1 The Cell Cycle
The cell cycle is the ordered sequence of events by which one cell grow s and
divides to produce two viable daughter cells. A complex regulation system has
evolved to ensure th at a cell first duplicates, then segregates its cellular
com ponents. It is particularly im portant that the chrom osom es are segregated
equally to both daughter cells. A cell m ust also be responsive to environm ental
cues which provide nutrition and differentiation factors to ensure that it does not
attem pt to grow and divide inappropriately.
Most organelles are amassed throughout the cell cycle during general grow th so
are present in m ultiple copies. M itochondria, the endoplasm ic reticulum , the
nuclear envelope and the Golgi apparatus all fall into this category. These
organelles are segregated random ly w hich is m ost effective w ith high copy
num ber organelles. Organelles are positioned random ly throughout the mitotic cell
cytoplasm and nearly equal partitioning occurs as the cytokinetic m echanism
ensures that the cell is divided into two equal daughter cells. In the fission yeast
Schizosaccharomyces pombe this occurs due to septum placem ent in the m iddle of the
cell. The Golgi a p p aratu s has a low copy num ber b u t undergoes extensive
fragm entation p rio r to m itosis allow ing it to be disp ersed thro u g h o u t the
cytoplasm (Warren and Wickner, 1996). Other low copy num ber organelles such as
the chromosomes and the centrosome are present in single or low copy and need
to be duplicated precisely once during the cell cycle. Centrosomes, or the spindle
pole body in yeast, are responsible for organising interphase m icrotubules and the
mitotic spindle and are duplicated in a conserved m anner (Adams and Kilmartin,
2000; Byers and Goetsch, 1974; Ding et al., 1997; W iney et al., 1991). Their function
in the mitotic spindle is such that they are always placed at opposite cell poles
d u rin g cell division so each is segregated to a different d au g h ter cell.
Chapter 1 Introduction
Chrom osom es are replicated semi-conservatively during S phase (defined as the
period d u ring w hich DNA replication occurs) and are then partitioned during
mitosis as the sister chromatids separate. S phase and mitosis are separated by two
gap phases, G1 before S phase and G2 following S phase and prior to mitosis (Fig.
1.1 A).
As survival of all organism s depends on the accurate transm ission of genetic
inform ation from one cell to its daughters, cells have evolved complex regulatory
systems to find the solution to two problems:
C om pletion problem
the initiation of later events is d ep en d en t on the
completion of earlier events
A lternation problem
that DNA replication is followed by mitosis, not another
round of replication (Murray and Hunt, 1993).
The com pletion problem can be solved in two ways. Fertilized frog eggs use a
relative tim ing m echanism in which the events that lead to mitosis are triggered by
an event that occurs on completion of the preceding mitosis. As long as it takes less
time to complete DNA replication than it does to initiate mitosis, cells do not enter
mitosis before the completion of DNA replication (Murray, 1992). However, this
m echanism is not very sophisticated and does not make allowances for mistakes.
M any organism s therefore use feedback controls to m onitor cell cycle events and
arrest the cell cycle at checkpoints until a process is com pleted (Hartwell and
W einert, 1989). C heckpoints exist to inhibit m itosis if DNA is dam aged or
replication is incomplete which ensures that chromosome breakage does not occur
during anaphase. The m etaphase to anaphase transition is also inhibited if the
mitotic spindle is defective or chrom osomes are incorrectly aligned. Again this
protects cells from m is-segregating their chrom osom es (Clarke and GiminezAbian, 2000; M urakami and Nurse, 2000).
The alternation problem concerns the inhibition of either two successive rounds of
mitosis, or DNA replication. The former w ould result in chromosome loss and cell
death, the latter in polyploid cells. However, there are situations in which both of
these events occur w ithout loss of viability to the cell. The meiotic cell cycle can be
thought of as a m odified mitotic cell cycle in which DNA replication is followed by
13
C h a p te r 1 Introduction
two rounds of nuclear division (Yamamoto et al., 1997). The first is a reductional
division as hom ologues are segregated, the second is equational and results in
sister chrom atid separation. Endoreduplication occurs in Drosophila embryos as
m any rounds of DNA replication occur w ithout an intervening mitosis (Spradling,
1993). The existence of these m odified cell cycles dem onstrates that specific
controls are required in a m itotic cycle to ensure alternation of chromosome
replication and segregation. The nature of these controls will be discussed later.
The environm ental signals that govern entry into the m itotic cell cycle are
som ew hat different in yeast and m ulticellular organism s. The availability of
nutrients tends to be the limiting factor for entry into the yeast cell cycle (Fig. 1.1).
Cells m ust attain a critical size prior to entry into the cell cycle which ensures a
tight coupling betw een cell proliferation and grow th (Fantes and Nurse, 1977;
Johnston et al., 1977). The only differentiation factors so far identified in yeast are
the m ating pherom ones which initiate a sequence of events culm inating in zygote
form ation (Fig. 1.1 B) (Kurjan, 1993; Nielsen and Davey, 1995). N utrients are rarely
lim iting in m ulticellular organism s so cells rely on extracellular signals such as
grow th and differentiation factors (Norbury and N urse, 1992; Planas-Silva and
W einberg, 1997). Inability to respond correctly to these signals can occur after
genetic alteration and can result in uncontrolled cell grow th and cancer (Sherr,
1996).
In discussing the cell cycle in more detail I will m ainly refer to work perform ed in
fission yeast. How ever, I will also m ention results achieved from both budding
yeast and higher eukaryotes w here relevant. Progress through the cell cycle in all
organism s is regulated at two major points. Start (in fission yeast) or the Restriction
Point (in m am m alian cells) and mitosis. Start refers to the point at which fission
yeast cells choose w hether to enter the mitotic or meiotic cycle. Once the decision
has been taken cells become com m itted to complete the chosen developm ental
program m e. Start has not been molecularly characterized but it can be a useful
physiological term. Mitosis is the sequence of events that leads to the equal
segregation of chrom osom es to two daughter cells. As m entioned previously,
checkpoints exist to m onitor cell cycle progression. I will refer particularly to the S
14
Chapter 1 Introduction
phase checkpoint that ensures DNA replication is com pleted before m itosis is
initiated.
The key com ponents required for regulating the cell cycle, initiating both DNA
replication and mitosis and ensuring that the completion and alternation problems
are solved, are the Cyclin D ependent Kinases (CDKs).
1.2 Cyclin Dependent Kinases-master regulators of the cell
cycle
Two approaches have been used to identify the components that control the major
cell cycle transitions, a genetical approach and a biochemical approach. The cdc2
gene was originally identified in a screen for cdc m utants (m utants which grow but
are unable to complete the cell division cycle) in fission yeast (Nurse et al., 1976).
Cdc2 was originally thought to be required solely for nuclear division but a second
function was later identified w hen it was shown that two m utants, cdc2 and cdclO,
were able to conjugate from their block points (Nurse and Bissett, 1981). As cells
only conjugate from G1 (Fig. 1.1) cdc2 was show n to be required in G1 for
com m itm ent to the m itotic cell cycle and in G2 for initiation of mitosis. The
universal n a tu re of CDKs w as first d em onstrated w hen a b u d d in g yeast
hom ologue, CD C28, was show n to functionally substitute for cdc2p in a cdc2
tem perature sensitive m utant (Beach et aL, 1982) and later a hum an hom ologue
was cloned by its ability to complement a cdc2 tem perature sensitive m utant at the
restrictive tem perature (Lee and Nurse, 1987). Further analysis of the fission yeast
cdc2p show ed it to be a phosphoprotein with protein kinase activity against two
substrates, histone H I and casein (Simanis and N urse, 1986). Cdc2p was therefore
thought to act by phosphorylating key substrates to induce DNA replication and
mitosis.
The biochem ical approach w as instigated w hen an activity w as identified in
Xenopus laevis that could induce entry into mitosis and m aturation into an egg
(Masui and M arkert, 1971). This activity, know n as M -phase or M aturation
Promoting Factor (MPF), was purified from both Xenopus and starfish oocytes and
shown to contain two proteins (Labbe et al., 1989a; Labbe et al., 1988; Labbe et al.,
15
Chapter 1 Introduction
1989b; Lohka et al., 1988). The first was a 32kDa (Xenopus) or 34kDa (starfish)
protein that was recognised by fission yeast cdc2p antibodies (Gautier et al., 1988;
Labbe et al., 1988) and bound to a suclp column, resulting in the depletion of MPF
activity from the extract (D unphy et ah, 1988). One com ponent of MPF was
therefore show n to be cdc2p. The second protein was show n to m igrate with the
same m obility as starfish cyclin (Labbe et al., 1989b). Cyclins w ere originally
identified in sea urchins as proteins which are required for the 8 rapid divisions
occurring during embryo cleavage which are destroyed at the end of each mitosis
(Evans et ah, 1983). Both sequencing and im m unoprécipitation experim ents
confirmed that the cdc2p partner was a cyclin (Draetta et al., 1989; Labbe et al.,
1989a). Cdc2p was hence known as a cyclin dependent kinase (CDK).
Cdc2p activity is controlled by three factors in fission yeast; availability of a cyclin
partner, phosphorylation and CDK inhibitors (Fig. 1.2). These factors will be
discussed in turn w ith reference to the cell cycle stage at which they are employed.
1.2.1 Cyclins
In fission yeast, unlike in higher eukaryotes, only one CDK, cdc2p is required
during the cell cycle. However, several cyclins have been identified (Fig. 1.2 A).
C d cl3 p is the m itotic cyclin, first show n to act closely w ith cdc2p as
overexpression of cdc2 suppressed a cdcl3 tem perature sensitive m utant (Booher
and Beach, 1987). C dcl3p was cloned by its ability to rescue the cdcl3-117 m utant
and sequence analysis showed it to be related to cyclins (Booher and Beach, 1988;
H agan et al., 1988). The null m utant was unable to undergo mitosis, indicating that
it was required along w ith cdc2p for entry into mitosis (Booher and Beach, 1988;
H agan et al., 1988). Cdc2p was show n to form a stable complex w ith cdcl3p, the
binding of which was required for the kinase activity of cdc2p (Booher et al., 1989;
Moreno et al., 1989). This kinase activity oscillates throughout the cell cycle and
decreases after m etaphase which occurs concom itantly w ith cdcl3p destruction
(Fig. 1.3), providing further proof that cdcl3p is a cyclin (Booher et al., 1989).
C dcl3p is required only for mitotic entry indicating that other cyclins present in
fission yeast could act as the cyclin partner for DNA replication. Two B-type
cyclins and one C l type cyclin have thus far been identified in fission yeast. Cigl
16
Chapter 1 Introduction
w as cloned using degenerate PCR in an attem p t to identify other cyclin B
hom ologues (Bueno et ah, 1991; Bueno et ah, 1993). C ig2fcycl7 is also a B-type
cyclin which was isolated independently by three groups (Bueno and Russell, 1993;
Connolly and Beach, 1994; Obara-Ishihara and Okayama, 1994).
The ciglp associated kinase activity is activated at mitosis w ith similar kinetics to
the c d c2 p /cd cl3 p kinase (Basi and Draetta, 1995). A clear role has yet to be
provided for the cdc2p/ciglp kinase. The cig2p transcript (Connolly and Beach,
1994), protein and associated kinase activity (M ondesert et al., 1996) have all been
show n to peak at the G l/S transition, indicating that cig2p is the major S phase
cyclin (Fig. 1.3). However, both cdcl3p and ciglp are able to substitute for cig2p in
its absence (Fisher and Nurse, 1996; Martin-Castellanos et al., 1996; M ondesert et
al., 1996) indicative of functional redundancy am ongst the fission yeast B-type
cyclins. This has led to the proposal of the quantitative model, in which the level of
kinase activity, not the cyclin partner, regulates cell cycle progression (reviewed in
Stern and N urse, 1996). This will be discussed in relation to the alternation
problem later in the chapter.
The C l type cyclin, p u d , was originally identified as a cDNA that conferred alpha
factor resistance to Saccharomyces cerevisiae cells deficient in a single G1 cyclin,
CLN3 (Forsburg and Nurse, 1991). P uclp does not play a role in norm al S phase
progression but appears to affect the timing of sexual developm ent (Forsburg and
N urse, 1994a), a m echanism for w hich has recently been proposed. The
c d c 2 p /p u clp kinase is able to phosphorylate the CDK inhibitor ru m lp (MartinCastellanos et al., 2000) resulting in its degradation (Benito et al., 1998; Jallepalli et
al., 1998; Kominami and Toda, 1997). This role had previously been proposed for
the ciglp associated kinase (Benito et al., 1998; Correa-Bordes and Nurse, 1995).
The p u c lp cyclin therefore affects the length of G1 via its regulation of ru m lp
levels and is involved in sexual developm ent as ru m lp accum ulation is essential
for the G1 arrest prior to meiotic entry.
1.2.2 Phosphorylation
Cdc2p is a phosphoprotein (Simanis and N urse, 1986), phosphorylated on two
residues, Tyrosine-15 (Y15) and Threonine-167 (T167) (Gould et al., 1991; Gould
17
Chapter 1 Introduction
and N urse, 1989). T167 phosphorylation requires the activity of a CAK (CDK
activating kinase) (Lee et aL, 1999) early in the cell cycle. Phosphorylation of this
residue precedes cyclin binding in both fission and budding yeasts and is therefore
required for activation of cdc2p (Fig. 1.2) (Gould et al., 1991; Ross et al., 2000).
The Y15 residue is located w ithin the ATP b in d in g dom ain of cdc2p and
phosphorylation prevents activation of the kinase and entry into mitosis (Gould
and N urse, 1989). The phosphorylation state of Y15, and hence the activity of
cdc2p, is therefore determ ined by the balance betw een inhibitory kinases and
activatory phosphatases (Fig. 1.2 B).
Weel was cloned by its ability to rescue the lethal phenotype of prem ature mitotic
entry that occurred w hen a mitotic inducer, cdc25, was overproduced in a weel-50
tem perature sensitive m utant. It was show n to be a dose-dependent inhibitor of
mitosis w ith hom ology to protein kinases (Russell and N urse, 1987b). W eelp is a
dual specificity kinase which phosphorylates both tyrosine and serine residues
(Featherstone and Russell, 1991; Parker et al., 1992). The w eelp kinase was found
to phosphorylate the Y15 residue of cdc2p only w hen com plexed w ith cyclin.
Furtherm ore this phosphorylation was show n to directly inhibit the histone H I
kinase activity of cdc2p (Parker et al., 1992). The inhibitory phosphorylation of
cdc2p by w eelp occurs only after the cdclO m utant block point in G l, before which
a different m echanism operates to maintain the cdc2p/cdclS p mitotic kinase in an
inactive state (Hayles and Nurse, 1995). The w e e lp kinase activity is regulated
later in the cell cycle by a complex netw ork of proteins. N iflp negatively regulates
the onset of m itosis by inhibiting n im lp /c d r lp (Wu and Russell, 1997). The
n im lp /c d r lp and cdr2p protein kinases act to inhibit w e e lp kinase activity,
probably via direct phosphorylation (Fig. 1.2 B) (Breeding et al., 1998; Coleman et
al., 1993; Kanoh and Russell, 1998; Parker et al., 1993; Russell and Nurse, 1987a;
Wu and Russell, 1993; Young and Fantes, 1987). Deletion of either gene causes a
cell cycle delay in G2 as w eelp is not inhibited, however, cells eventually divide
indicating that accumulation of the activatory cdc25p phosphatase is sufficient to
drive cells into mitosis.
18
Chapter 1 Introduction
Another tyrosine kinase, m iklp, has also been shown to contribute to the inhibition
of cdc2p (Lee et aL, 1994). It was identified by its ability to suppress the mitotic
catastrophe phenotype of the cdc2-3w weel-50 strain at 36°C w hen overexpressed
(Lundgren et aL, 1991). A null m utant does not affect cell cycle progression unless
w eelp function is also com prom ised (Lundgren et aL, 1991). M iklp is therefore
thought to play a m inor role in cdc2p inhibition (Fig. 1.2 B).
The activatory phosphatase in fission yeast is know n as cdc25p (Fig. 1.2 B). It was
cloned by com plem entation of the cdc25-22 tem perature sensitive m utant (Russell
and N urse, 1986). Initial results indicated that cdc25p acted as an inducer of
mitosis and that it com peted with w eelp to control cdc2p activation (Russell and
N urse, 1986; Russell and N urse, 1987b). H ow ever, it w as not initially know n
w hether cdc25p acted directly on cdc2p or further upstream in the activatory
pathway. Tyrosine dephosphorylation of cdc2p was show n to trigger mitosis when
a h u m an pro tein tyrosine phosphatase w as expressed in fission yeast. This
phosphatase could also substitute for cdc25p function, thereby closely linking
tyrosine dephosphorylation to cdc25p activity (Gould et aL, 1990). Cdc25p was
eventually show n to be the activatory phosphatase using two different systems.
Purified hum an Cdc25p was used to dephosphorylate and activate a cdc2p/cyclin
B complex from G2-arrested starfish oocytes (Strausfeld et aL, 1991) and Drosophila
cdc25p w as show n to activate Xenopus MPF and induce prem ature entry into
mitosis after dephosphorylation of cdc2p (Kumagai and D unphy, 1991). Cdc25p
activity does not appear to be regulated during the cell cycle. Instead, both the
message and the protein accumulate throughout interphase until a critical level is
reached (Moreno et aL, 1990). At this stage the activating signals outweigh the
inhibitory signals and cells proceed into mitosis.
1.2.3 CDK inhibitors
A ctivity of CDKs are also controlled by a class of proteins know n as CDK
inhibitors (CKIs) (Fig. 1.2 C). Only one, ru m lp , has thus far been identified in
fission yeast. R u m l was identified as a gene that induced m ultiple rounds of
replication in the absence of mitosis w hen overexpressed (Moreno and Nurse,
1994). Deletion of the gene elim inated the pre-Start interval norm ally present to
allow cells to grow to achieve the critical size for Start. R u m l is also required for
19
Chapter 1 Introduction
cell cycle arrest prior to Start so a cdclO-129 rum l A double m utant is unable to
m aintain a G l arrest w hen placed at the restrictive tem perature and cells proceed
into a prem ature mitosis (Moreno and Nurse, 1994). R um lp is therefore im portant
in G l for the regulation of Start.
As cdclO-129 ru m lA cells are unable to arrest properly or inhibit mitosis, the
indication was that ru m lp was required for the pre-Start checkpoint that acts prior
to the inhibitory phosphorylation of cdc2p by w e elp (Hayles and Nurse, 1995).
This was dem onstrated by the fact that early G l cells accum ulate ru m lp which
leads to a decrease in the histone H I kinase activity of cdc2p. This was visualised
by m easuring the histone H I kinase activity of cells entering a cdclO-129 G l block
either in the presence of ru m lp or in a rum lA background. The decrease in kinase
activity is not due to Y15 phosphorylation of cdc2p as it also occurs in a weel-50
m iklA strain at 36°C when rum l is overexpressed (Correa-Bordes and Nurse, 1995).
Bacterially purified ru m lp has been shown to act as a specific in vitro inhibitor of
the cdc2p/cdcl3p mitotic kinase. R um lp associates w ith both cdc2p and cdcl3p in
G l and appears to target cdcl3p for degradation in G l, possibly by acting as an
ad ap to r protein, prom oting transfer of cdcl3p to the proteolytic m achinery
(Correa-Bordes and Nurse, 1995; Correa-Bordes and N urse, 1997). R um lp has also
been shown to partially inhibit cdc2p/cig2p kinase activity in vitro. This complex
could be inhibited transiently in vivo until the critical cell size for Start is achieved
(Correa-Bordes and Nurse, 1995; Martin-Castellanos et al., 1996).
R u m lp levels are sharply periodic, accum ulating at anaphase and decreasing as
cells exit G l. The mRNA levels also oscillate throughout the cell cycle but not to
the extent suggested by the change in protein, indicating that post-translational
controls are also involved (Benito et al., 1998). R u m lp is stabilized w hen the
threonine residues of two cdc2p consensus phosphorylation sites, T58 and T62, are
m u tated to alanine and poly-ubiquitinated r u m lp also accum ulates in a
proteasom e m utant (Benito et al., 1998). Phosphorylation therefore appears to
target ru m lp for degradation via the 26S proteasom e (Jallepalli et al., 1998;
Kominami and Toda, 1997). There is some debate as to w hich cdc2p/cyclin
complex phosphorylates ru m lp . Early reports suggested that the CDK could be
20
Chapter 1 Introduction
c d c 2 p /c ig lp as it w as insensitive to ru m lp inhibition and w as show n to
phosphorylate ru m lp in vitro (Benito et aL, 1998; Correa-Bordes and Nurse, 1995).
H ow ever a m ore recent report proposes p u c lp as the cdc2p cyclin partner for
ru m lp phosphorylation (Martin-Castellanos et aL, 2000). W hether p u c lp alone is
required for ru m lp degradation, or whether different cyclin partners contribute to
the phosphorylation of ru m lp remains to be conclusively determined.
Siclp has been show n to play an analagous role in m aintaining a low level of
Cdc28/cyclinB kinase activity in G l in S. cerevisiae (Schwob et aL, 1994). Siclp and
ru m lp can functionally substitute for each other, confirm ing that they are
functionally hom ologous (Sanchez-Diaz et aL, 1998). Interestingly, Siclp is posttran slatio n ally controlled by proteolysis follow ing p h o sp h o ry latio n by a
C dc28/C ln complex, Clns being the G l cyclins hom ologous to p u c lp (Feldman et
aL, 1997; Schwob et aL, 1994; Skowyra et aL, 1997; Verma et aL, 1997a; Verma et aL,
1997b).
H aving described CDKs and their regulation throughout the cell cycle, I will now
discuss how they, in combination w ith other proteins, initiate the major cell cycle
events of mitosis and DNA replication.
1.3 Initiation of mitosis
The major mitotic cyclin in Schizosaccharomyces pombe is cdclSp (Booher and Beach,
1988; Hagan et aL, 1988). It accumulates following ru m lp degradation at the end of
G l (Benito et aL, 1998) and forms a stoichiometric complex w ith cdc2p (Moreno et
aL, 1989). The cdc2p kinase activity is m aintained at a low level throughout S phase
and G2 due to the inhibitory phosphorylation of the Y15 residue of cdc2p, located
in the ATP binding cleft (Gould and Nurse, 1989). Mitosis is therefore triggered
w hen the balance between the inhibitory kinase and activatory phosphatase shifts
in favour of the phosphatase which occurs due to inhibition of the w eelp kinase
and accumulation of the cdc25p phosphatase (Breeding et aL, 1998; Coleman et aL,
1993; Kanoh and Russell, 1998; Moreno et aL, 1990; Parker et aL, 1993; Russell and
Nurse, 1987a; W u and Russell, 1993; Young and Fantes, 1987).
21
Chapter 1 Introduction
The events of mitosis are visually dramatic, chromosomes condense and a mitotic
spindle is generated. Chromosomes line up along the spindle, attaching via the
kinetochore. Sister chromatids are then separated and segregate to opposite poles
at anaphase. Formation of a septum and cytokinesis proceed w ith a short time lag
(Fig. 1.1). The substrates for the m itotic kinase have not yet been identified
although potential substrates include histone H I w hich could be required for
chrom osom e condensation and Lamin B w hich could be involved in nuclear
envelope breakdow n in higher organisms (reviewed in Moreno and Nurse, 1990).
Fission yeast cells undergo a closed mitosis so the nuclear m em brane remains
intact.
Cyclins were first identified in sea urchin embryos as proteins that were destroyed
at the end of each mitosis (Evans et al., 1983). The same is true for cdclSp which is
degraded at the m etaphase to anaphase transition. Program m ed proteolysis of the
cyclin su b u n it is an im portant regulatory feature of CDKs. This was first
dem onstrated in Xenopus egg extracts w hen a proteolysis- resistant cyclin m utant
w as show n to prevent inactivation of MPF and exit from mitosis (Murray et al.,
1989). This was confirmed by work in fission yeast using an indestructible cdclS
m utant, m utated in its destruction box, as it was show n to be unable to exit mitosis
and proceed into the next G l (Yamano et al., 1996).
Cyclin proteolysis requires the APC (anaphase prom oting complex), a ubiquitin
ligase w hich collaborates w ith a ubiquitin activating and ubiquitin conjugating
enzyme to catalyse the transfer of ubiquitin molecules to target proteins (reviewed
in M organ, 1999). APC activity oscillates throughout the cell cycle and is thought
to be responsible for targeting proteolysis. The vertebrate APC consists of an 8
subunit core structure that associates w ith one of another two proteins. These may
regulate either the timing of APC activation or the substrate specificity (Morgan,
1999). H om ologues of several of these su b u n its have been identified in
Schizosaccharomyces pombe, including cwf4, cut9, nuc2, apclO, hcnl, cut20, cut23, slpl
and srwl/ste9 (Hirano et al., 1988; Kim et al., 1998; Kitamura et al., 1998; Kominami
et al., 1998b; Samejima and Yanagida, 1994; Yamada et al., 1997; Yamaguchi et al.,
1997; Yamashita et al., 1996; Yamashita et al., 1999). The securin, cut2p m ust also be
22
Chapter 1 Introduction
destroyed by the APC prior to sister chrom atid separation (Funabiki et al., 1996;
Funabiki et al., 1997; Yanagida, 2000).
1.4 Initiation of DNA replication
Passage through Start and into S phase requires the function of two genes in fission
yeast; cdc2 and cdclO. The mitotic partner for cdc2p, cdcl3p, is kept low during G l
due to the function of two proteins, srw lp and ru m lp (Correa-Bordes and Nurse,
1995; Kitam ura et al., 1998; Yamaguchi et al., 1997). How ever, the B-type cyclin,
cig2p, accumulates in G l to allow a cdc2p/cig2p complex to prom ote entry into S
phase (Fisher and Nurse, 1996; M artin-Castellanos et al., 1996; M ondesert et al.,
1996). The activatory S phase targets for cdc2p/cig2p have yet to be identified,
how ever several proteins have been show n to be phosphorylated after the
initiation of DNA replication to inhibit re-replication. These, along w ith potential
activatory substrates, will be discussed later.
CdclO is a transcription factor that acts w ith resl, res2 and rep2 to allow the periodic
transcription of several S phase genes (Aves et al., 1985; Caligiuri and Beach, 1993;
Lowndes et al., 1992; Miyamoto et al., 1994; Nakashim a et al., 1995; Tanaka et al.,
1992; Zhu et al., 1994b). These include cdcl8, cdtl, cdc22 and cig2. The functions of
som e of these genes will be discussed in relation to the initiation of DNA
replication. Initial results indicated that cdclOp form ed a complex w ith reslp to
prom ote transcription during the mitotic cycle and res2p for transcription during
the meiotic cycle (Miyamoto et al., 1994; Tanaka et al., 1992; Zhu et al., 1994b).
Rep2p was show n to act as a transcriptional activator (Nakashim a et al., 1995).
How ever, recent evidence suggests that the situation is m ore complex. CdclOp,
reslp and res2p have been show n to exist as a heteromeric complex throughout the
mitotic cycle (Whitehall et al., 1999) and both re slp and res2p are required for
periodic transcription. CdclS transcript levels are constitutively low in reslA cells
and constitutively high in res2A cells (Baum et al., 1997). Cell cycle regulated
transcription cooperates w ith other m echanisms to ensure that DNA replication
occurs only once per cell cycle. This will be discussed later in relation to the
alternation problem.
23
Chapter 1 Introduction
I will now go on to describe the sequence of events leading up to the initiation of
DNA replication. These include the form ation of a pre-replicative complex at
origins preceding initiation, a process that requires the activity of two protein
kinases, cdc2p and hsklp. I will also discuss the involvem ent of the MCM proteins
in DNA replication and the evidence suggesting that they act as the S phase
helicase.
Table 1.1
Comparison of gene names between Schizosaccharomyces pombe and
Saccharomyces cerevisiae of genes required for DNA replication
Schizosaccharomyces pombe
Saccharomyces cerevisiae
cdclS
CDC6
orpl
ORCl
orp2
0RC 2
spOrcS
0RC 3
orp4
0R C 4
spOrcS
0R C 5
spOrcS
0RC 6
cdcl9/ndal
MCM2
mcm3
MCM3
cdc21
M CM 4
nda4
M CM S
mis5
M CM 6
mcmJ
M CM 7
cdtl
cuts
D P B ll
cdc23
DNA43/MCM10
sna41
CDC4S
hskl
CDC7
dfpl
DBF4
24
Chapter 1 Introduction
1.4.1 Origins
D espite the strong conservation of the basic m echanism of DNA replication
am ongst eukaryotes, the origins of replication display a surprisingly diverse
structure. The m ost well defined origins are those of Saccharomyces cerevisiae. The
origins are short, being 100-150 bp in length and consist of several elements. The A
dom ain contains an llb p consensus sequence, (A/T)TTTA(T/C)(A/G)TTT(A/T),
know n as the ARS consensus sequence (ACS). This dom ain is essential but not
sufficient for origin activity and several auxiliary elements also exist, Bl, B2, B3
and C. Little sequence conservation is observed betw een these dom ains but they
tend to be A /T rich and are sensitive to alterations in distance and orientation
relative to the ACS. A specific role for each elem ent has not been determ ined,
although the Bl element has been shown to cooperate w ith the ACS in the efficient
binding of ORC and the B3 element binds the A bfl transcription factor (reviewed
in Donovan and Diffley, 1996).
M etazoan origins represent the opposite extreme as they tend to be large and
heterogeneous. The length of S phase varies greatly during developm ent reflecting
a change in the frequency of initiation, not the rate of fork movement. Regulation
of replication initiation m ust therefore alter during animal development. There has
been some controversy over how metazoan origin specification occurs. Functional
ARS (autonom ously replicating sequence) elem ents have been difficult to
determ ine in m am m alian cells and the techniques used to identify origins have
also produced different results. 2-d gel electrophoresis identified large initiation
zones w ith no clear preference for initiation at particular sites. However, a
different technique using labelled nucleotide precursors identified most initiation
events as occurring at specific sites of 0.5-2kb. The current opinion appears to be
that initiation zones exist consisting of one or more high frequency initiation sites
and several low frequency initiation sites. All sites are detected by the 2-d gel
m ethod b u t only the high frequency sites are detected using biolabelling methods.
The DNA sequence is still im portant in determ ining an initiation site despite the
lack of a defined consensus sequence. Origins tend to contain an ORC binding site
and one or m ore A /T rich elements. Several factors cooperate to determ ine
w hether an origin fires including nuclear organization, chrom atin structure and in
some cases DNA méthylation (reviewed in DePamphilis, 1999).
25
Chapter 1 Introduction
The fission yeast origin lies betw een that of bu d d in g yeast and m etazoans in
structure, displaying characteristics of both. Several origins have now been
analyzed including arsl, arsSOOl and ars3002 and some conclusions can be draw n
from these investigations (Clyne and Kelly, 1995; Dubey et al., 1996; Kim and
H uberm an, 1998). Fission yeast origins tend to be larger than those of budding
yeast, generally betw een 0.5 and 1.5kb. This could be attributed to the fact that
they contain m any redundant elements as m ost short deletions barely have an
effect on ARS activity and often several dom ains m ust be deleted before a
significant effect is seen. How ever one or m ore essential regions and several
im portant regions have been identified for each origin using deletional analysis.
The im portant regions are A /T rich and asym metric, having m ostly As on one
strand and Ts on the other. Some consensus sequences have been identified for the
fission yeast origins and these tend to be clustered in the im portant regions of the
ARS elements, however a clear role for these has not yet been established (Clyne
and Kelly, 1995; Kim and H uberm an, 1998; M aundrell et al., 1988; Zhu et al.,
1994a).
1.4.2 ORC
The m ain function of an origin is to facilitate the binding of a heterohexameric
protein complex known as the origin recognition complex (ORC). ORC was first
identified in Saccharomyces cerevisiae as a DNA binding activity that gave protection
to the A and Bl elements of A R S l from DNasel digestion both in vitro and in vivo
(Bell and Stillman, 1992; Diffley and Cocker, 1992). This binding is both ATP
dependent and origin specific as m utations in the ACS of the A element either
red u ced or elim inated ORC bin d in g (Bell and Stillm an, 1992). Genomic
footprinting allow ed further characterization of b u d d in g yeast origins and
identified two states that existed at different stages of the cell cycle (Diffley et al.,
1994). The post-replicative footprint was similar to the one produced in vitro by
ORC (Fig. 1.4 A) and the pre-replicative footprint, present from the end of mitosis
until the beginning of S phase, produced an extended footprint, overlapping that
produced by ORC (Diffley et al., 1994).
ORC binds to origins throughout the cell cycle (Liang and Stillm an, 1997)
indicating that it is not sufficient for replication. ORC is, however, required for
26
Chapter 1 Introduction
replication as tem perature sensitive m utations in two subunits, orc2-l and orc5-l,
are unable to allow initiation of replication at the restrictive tem perature as
determ ined by the lack of a bubble arc on a 2-d gel (Liang et ah, 1995). CDC6,
w hich is hom ologous to cdcl8 from fission yeast, was identified as a multicopy
suppressor of the orc5-l m utant and w as later show n to be required for the
form ation of the pre-replicative complex (Cocker et al., 1996; Liang et al., 1995).
The function of Cdc6/18p in DNA replication and its involvem ent w ith the prereplicative complex will be discussed later.
ORC homologues have been identified in m any higher eukaryotes (reviewed in
Q uintana and D utta, 1999) as well as Schizosaccharomyces pombe. An O rclp
hom ologue w as isolated independently by two groups. Once by virtue of its
sequence homology to cdcl8 (Muzi-Falconi and Kelly, 1995) and also in a m utant
screen for new cell cycle genes (Grallert, 1996). O rp lp was show n to be an essential
protein required for both DNA replication and the checkpoint that acts to prevent
mitosis until S phase has been successfully com pleted. Both the mRNA (MuziFalconi and Kelly, 1995) and the protein were show n to be present at a constant
level throughout the cell cycle and the protein also localized to the nucleus
(Grallert, 1996). O rpl displayed genetic interactions w ith cdcl8 and cdcZl and the
protein could also im m unoprecipitate both cdclSp and cdc21p, indicating that a
complex could exist between ORC, cdcl8p and the MCMs (Grallert, 1996). More
recently, o rp lp has been show n to bind to the origins ars2004 and ars3002
throughout the cell cycle (Ogawa et al., 1999).
The second ORC subunit identified in fission yeast w as orp2p, the Orc2p
hom ologue (Leatherwood et al., 1996). It was isolated in a 2-hybrid screen w ith
cdc2p and has been shown both to contain cdc2p consensus phosphorylation sites
(Leatherwood et al., 1996) and to be a phosphoprotein. O rp2p is differentially
m odified throughout the cell cycle, indicating that ORC activity could be regulated
by cdc2p (Lygerou and Nurse, 1999).
O rp4p was isolated using degenerate PCR w ith b u d d in g yeast Orc4p prim ers
(Chuang and Kelly, 1999). The C-terminus of orp4p displays sequence homology
to the hum an, Xenopus and budding yeast counterparts. How ever the N-terminus
27
Chapter 1 Introduction
contains a unique sequence consisting of 9 copies of an A-T hook motif known to
m ediate DNA binding to the minor groove of A-T tracts (Chuang and Kelly, 1999).
As fission yeast origins do not possess an ACS, the DNA binding properties of
orp4p could facilitate ORC binding to the A /T rich sequence of an origin.
This hypothesis is supported by the fact that ORC purification from fission yeast
initially yielded a 5-subunit complex excluding orp4p. The purification of the
heterohexam er first required removal of the DNA by DNasel digestion (Moon et
al., 1999). This purification also allowed identification of the less well conserved
spOrcSp and spOrc6p homologues.
The final subunit, spOrcSp was isolated after a database search to look for Orc5p
homologues (Ishiai et al., 1997). SpOrcSp was show n to be essential as deletion of
the gene led to cells which first arrested w ith a 1C DNA content and then
underw ent an aberrant mitosis due to a defective checkpoint (Lygerou and Nurse,
1999). O rp lp , orp2p and spOrc5p were shown to exist in a complex as o rp lp could
im m unoprecipitate both orp2p and spOrc5p. The o rp lp /sp O rc 5 p complex was
show n to exist throughout the cell cycle. The three proteins also rem ained localized
to the nucleus and bound to chrom atin at all stages of the cell cycle (Lygerou and
Nurse, 1999).
C urrent evidence therefore suggests that the budding yeast and fission yeast ORC
complexes act in a similar m anner, as they are both required for DNA replication
and rem ain chromatin bound throughout the cell cycle. I will now discuss some of
the proteins that associate and function w ith ORC to prom ote DNA replication.
1.4.3 CdclS
Cdcl8 was cloned sim ultaneously in two ways, as a m ulticopy suppressor of the
cdclO-129 tem perature sensitive m utant and by com plem entation of the cdcl8-K46
m u ta n t (Kelly et al., 1993). C d c l8 transcription is cdclOp d ependent and
accum ulates periodically through the cell cycle, increasing in late mitosis and
decreasing at S phase (Baum et al., 1998; Kelly et al., 1993). The cdclS protein
mimics this periodicity although it does not accum ulate until exit from mitosis
(Baum et al., 1998). The rapid decrease in protein seen on entry into S phase is
28
Chapter 1 Introduction
indicative of an unstable protein, and in fact the half life has been estimated at <8
m inutes (Muzi-Falconi et ah, 1996). The restriction of cdcISp to G1 and early S
phase indicated a role in the prom otion of DNA replication. This was confirmed by
the analysis of a cdclSA strain after spore germination. CdclS is essential and its
deletion results in cells that are unable to initiate DNA replication but proceed into
mitosis, accumulating w ith a <1C DNA content and a cut phenotype, indicative of
a lack of the S phase checkpoint (Kelly et al., 1993). Overexpression of cdclS results
in cells that initiate repeated rounds of DNA replication in the absence of mitosis,
supporting the proposal that cdcISp is a key regulator of DNA replication and is
im portant for coordinating alternate rounds of S phase and M phase (Nishitani and
N urse, 1995).
The role th at cdcISp plays in initiating S phase w as first elucidated in
Saccharomyces cerevisiae w ith the cdclS homologue, CDC6 (Lisziewicz et al., 1988;
Zhou et al., 1989). Identification of two complexes bound to replication origins at
different stages of the cell cycle indicated that proteins other than ORC were
required at the level of the origin (Diffley et al., 1994). Cdc6p was show n by
genomic footprinting to be required for formation of the G1 specific complex, the
pre-replicative complex, as described previously (Cocker et al., 1996). The function
of Cdc6p was further characterized by the developm ent of two techniques: a cell
fractionation protocol that enriches for the chrom atin fraction (Donovan et al.,
1997) and a chrom atin precipitation (CHIP) protocol (Tanaka et al., 1997). The
latter uses form aldehyde to cross-link proteins both to each other and to DNA,
followed by im m unoprécipitation of proteins that m ay be bound to origin DNA
an d
PCR
to
selectively
am p lify
the D N A
se q u en ce b o u n d
to the
im m unoprecipitated protein. This technique allows the identification of proteins
bound to individual origins at different cell cycle stages. Results obtained using
these techniques identified Cdc6p as a loading factor for the MCM complex during
G1 (Fig. 1.4 B and C) (Aparicio et al., 1997; D onovan et al., 1997; Liang and
Stillman, 1997; Tanaka et al., 1997).
Similar results have recently been obtained in fission yeast. Chrom atin assays have
been used to dem onstrate that depletion of cdcl8p prevents the loading of cdc21p
(mcm4p) onto chrom atin (Nishitani et al., 2000). An in situ chrom atin assay also
29
Chapter 1 Introduction
(mcm4p) onto chrom atin (Nishitani et al., 2000). An in situ chrom atin assay also
provides evidence to support this hypothesis. Cdc21-GFPp has been show n to be
depleted from the nucleus after cells are treated w ith enzymes to permeabilize the
cell l\Jalls
and a non-ionic detergent wash to remove non-chrom atin bound
proteins, w hen cdcISp is absent from the cell (Kearsey et al., 2000).
1.4.4 MCMs
The m inichrom osom e m aintenance fam ily of proteins (mcm2-7p) w ere first
isolated as m utants that show ed origin specific defects in the m aintenance of
m inichrom som es in budding yeast (Maine et al., 1984; Sinha et al., 1986). They
were later show n to be required for DNA replication and part of the pre-replicative
complex, as described above (Fig. 1.4 C). H om ologues have been identified in a
num ber of different organism s (reviewed in Tye, 1999) and experim ents using
Xenopus extracts dem onstrated that the MCM com plex w as a com ponent of
"licensing factor", a factor thought to confer on cells the ability to replicate only
after passage through mitosis (Chong et al., 1995; Kubota et al., 1997; Kubota et al.,
1995; M adine et al., 1995; Thommes et al., 1997).
Several of the Schizosaccharomyces
pombe MCM genes w ere cloned by
com plem entation of either tem perature sensitive or cold sensitive m utants
deficient in DNA replication. M cm 2 was cloned by two groups, initially by
com plem entation of the cold sensitive m utant, ndal-376 (Miyake et al., 1993) and
secondly by com plem entation of the tem perature sensitive m utant, cdcl9-Pl
(Forsburg and N urse, 1994b). M cm 4 was cloned by com plem entation of the
tem perature sensitive cdc21-M68 m utant (Coxon et al., 1992). M cm5 was isolated at
the same time as ndal/m cm 2 by virtue of its ability to com plem ent the nda4-108
cold sensitive m utant (Miyake et al., 1993). Finally mcmô was cloned by its ability
to complem ent the mis5-268 tem perature sensitive m utant (Takahashi et al., 1994).
Schizosaccharomyces pombe m cm S was cloned using a hybridization strategy to
identify a gene with homology to a region w ith high sequence similarity between
Saccharomyces cerevisiae, Xenopus, hum an and m ouse M CM 3 homologues (Sherman
and Forsburg, 1998). The mcm7 gene has not yet been cloned in fission yeast b ut it
has been purified as part of a heterohexameric complex w ith the other five MCM
proteins (Adachi et al., 1997).
30
Chapter 1 Introduction
The MCM proteins localize to the nucleus throughout the cell cycle in fission yeast
(Maiorano et al., 1996; Okishio et al., 1996; Sherman and Forsburg, 1998). Mutation
of a single mcm leads to the redistribution of the entire complex from the nucleus to
the cytoplasm. This process requires active transport as it does not occur in a crml
m utant (Pasion and Forsburg, 1999). This is different to the situation in budding
yeast in which MCMs localize to the nucleus only during G1 and S phase (Dalton
and W hitbread, 1995; Hennessy et al., 1990; Yan et al., 1993). The localization of the
MCM complex in budding yeast is one way in which cells can limit S phase to once
per cell cycle and this indicates that other controls m ust exist to prevent re­
initiation of DNA replication in fission yeast. These will be discussed later.
The function of the MCM complex has rem ained elusive. Several lines of evidence
indicate that it acts as the S phase helicase. CHIP has been used to dem onstrate
that the budding yeast MCM complex leaves replication origins after initiation and
appears to m ove w ith replication forks associating w ith non-origin DNA w ith
similar kinetics to DNA polymerase e (Fig. 1.4 E) (Aparicio et al., 1997). A recent
report in budding yeast has also show n that the MCMs are required throughout
DNA replication, for elongation as well as initiation (Labib et al., 2000). Both of
these results w ould be consistent w ith the MCMs acting as the S phase helicase.
Biochemical evidence from both mouse and hum ans has show n that a hexameric
complex consisting of two Mcm4, 6 and 7 trim ers exhibits w eak DNA helicase
activity having the ability to displace 17-mer bu t not longer oligonucleotides
(Ishimi, 1997; You et al., 1999). The poor processivity of the helicase could reflect
the fact that the MCMs are not the true S phase helicase, or could relate to technical
difficulties w ith the in vitro experiment. For example, use of either a different
substrate or a different MCM sub-complex could solve the problem. Different sub­
complexes of the MCMs have been identified in fission yeast as mcm4p and
mcm6p form a core complex with which mcm2p associates more loosely (Sherman
et al., 1998). It is possible that a MCM sub-complex possesses the biochemical
activity and the other subunits are involved in regulating the activity but the fact
that all six subunits co-purify (Adachi et al., 1997) and are required for the correct
localization of the complex (Pasion and Forsburg, 1999) indicates that the view of a
heterohexameric complex is probably correct (Fig. 1.4 C).
31
Chapter 1 Introduction
1.4.5 Additional pre-replicative complex proteins
Several proteins other than ORC, cdcISp and MCMs m ay also be involved in the
form ation of the pre-replicative complex. C d tl w as isolated using a cyclical
procedure of im m unoprécipitation and amplification to identify genomic DNA
sequences bound by the cdclOp transcription factor (Hofm ann and Beach, 1994).
C dtl was show n to be transcribed periodically in a cdclOp-dependent m anner and
overexpression of c d tl is able to com plem ent a cdclO-129 m utant at the semiperm issive tem perature of 33°C. Cdtl is an essential gene and the null m utant has
the same phenotype as a cdclSA in that it is deficient in both DNA replication and
the S phase checkpoint (Hofmann and Beach, 1994; Kelly et al., 1993). Recent data
suggests that cdcl8p and cd tlp act closely together as c d tlp enhances the ability of
cdcISp to prom ote re-replication (Nishitani et al., 2000). The two proteins interact
via the C-term inus of cdcISp and both are required for the loading of cdc21p
(Mcm4) onto chrom atin b u t not for the chrom atin association of each other
(Nishitani et al., 2000). The current evidence therefore suggests that c d tlp is also a
com ponent of the pre-replicative complex (Fig. 1.4 B). Hom ologues have recently
been isolated in Xenopus and Drosophila which appear to function in a similar way
to fission yeast c d tlp (Maiorano et al., 2000; W hittaker et al., 2000). Database
searches have identified hom ologues in several other organism s including
hum ans, although no budding yeast homologue has so far been discovered. These
results indicate that cd tlp provides an essential and conserved function in DNA
replication.
Cuts was isolated in a screen for m utants that undergo cytokinesis in the absence
of norm al nuclear division (cell untim ely torn) (Hirano et al., 19S6). It was later
cloned by com plem entation of the cut5-T401 tem perature sensitive m utant and
was show n to be identical to rad4 (Fenech et al., 1991; Saka and Yanagida, 1993)
and hom ologous to the budding yeast gene D P B ll (Araki et al., 1995). Cells
lacking w ildtype cutSp are unable to initiate DNA replication or the S phase
checkpoint and undergo an aberrant mitosis and accumulate cells w ith a <1C DNA
content (Saka and Yanagida, 1993). The phenotype is sim ilar to that of both the
cdclSA (Kelly et al., 1993) and cd tl A (Hofmann and Beach, 1994) strains, and all
three proteins are nuclear localized (Nishitani et al., 2000; N ishitani and Nurse,
1995; Saka et al., 1994) indicating that cut5p could also function in the formation of
32
Chapter 1 Introduction
the pre-replicative complex (Fig. 1.4 B). However, experiments using the rad4-116
allele have enabled separation of the replication and checkpoint functions as cells
are able to initiate replication despite lack of the checkpoint. This indicates that
c u t5 p /rad 4 p plays a direct role in generating the S phase checkpoint signal and
does not m erely allow initiation of the signal as a consequence of pre-replicative
complex formation (McFarlane et al., 1997).
Cdc23 w as isolated by complem entation of the tem perature sensitive cdc23-M36
m utant (Aves et al., 1998). It is an essential gene required for the correct initiation
of DNA replication. Both the cdc23-M36 m utant and a null m utant arrest w ith a
single nucleus and an elongated phenotype. Sequence analysis suggested that
cdc23 w as a hom ologue of the budding yeast gene D N A43 (MCMIO). This was
confirm ed w hen expression of cdc23 in budding yeast w as show n to rescue the
tem perature sensitive dna43-l m utant at the restrictive tem perature (Aves et al.,
1998). D na43p/ McmlOp is thought to form part of the pre-replicative complex as it
binds to m em bers of the MCM complex (Merchant et al., 1997) and to chrom atin
(Fig. 1.4). The chrom atin association of Dna43p / M cm l Op is required for the
su b s e q u e n t lo ad in g of M cm2p
(H om esley et al., 2000). Interestingly,
Dna43p / M cm l Op is constitutively bound to chrom atin throughout the cell cycle
(H om esley et al., 2000), indicating that post-translational m odification could
m ediate the interaction with the MCM complex. The presence of cdc2p consensus
phosphorylation sites in both cdc23p and Dna43p / M cm l Op could provide a basis
for this modification.
The sna41 gene was first identified as a suppressor of the nda4-108 {mcmS) m utant
and w as subsequently cloned by com plem entation of the tem perature sensitive
sna41-912 m utant (Miyake and Yamashita, 1998). It is an essential gene required for
DNA replication and shows hom ology to the CDC45 gene from budding yeast
(34%) (Miyake and Yamashita, 1998), of which a m ore detailed characterization has
been perform ed. CDC45 was isolated by com plem entation of the cold sensitive
cdc45-l m utant and is required for DNA replication (Hardy, 1997; H opw ood and
Dalton, 1996; Zou et al., 1997). The protein levels rem ain constant throughout the
cell cycle (Owens et al., 1997) despite the periodicity of the mRNA (Hardy, 1997).
Cdc45p also localizes to the nucleus throughout the cell cycle (H opw ood and
33
Chapter 1 Introduction
Dalton, 1996). Cdc45p interacts genetically w ith orc2-l and either genetically or
physically w ith several m em bers of the MCM complex (Dalton and H opw ood,
1997; H ardy, 1997; Hopw ood and Dalton, 1996; Zou et al., 1997). It is recruited to
chrom atin and the pre-replicative complex late in G l, betw een Start and the
initiation of DNA replication, to form p art of a new complex nam ed the p re­
initiation complex (Fig. 1.4 D) (Aparicio et al., 1997; Zou and Stillman, 1998).
Chrom atin association of Cdc45p requires C dc28p/C lb kinase activity as well as
Cdc6p and Mcm2p but Cdc45p does not contain consensus phosphorylation sites
indicating that the requirem ent is indirect (Zou and Stillm an, 1998). In both
Saccharomyces cerevisiae and higher eukaryotes such as Xenopus and hum ans,
Cdc45p appears to be involved in the recruitm ent of DNA polym erase a to
replication origins (Aparicio et al., 1999; Kukim oto et al., 1999; M im ura and
Takisawa, 1998; Walter and N ewport, 2000). Cdc45p and DNA polym erase a are
both assembled differentially at early and late origins. Late origin binding of both
proteins occurs after DNA replication initiation from early origins and can be
inhibited if the S phase checkpoint is activated (Aparicio et al., 1999; Zou and
Stillman, 2000). Cdc45p, like the MCMs also appears to move with replication forks
(Fig. 1.4 E) (Aparicio et al., 1997).
1.4.6 Cdc2p/cyclin activity
It has long been known that cdc2p/cyclin activity is required for the initiation of
DNA replication (Nurse and Bissett, 1981), how ever substrates that fulfil the
requirem ents for this positive role of CDKs have not yet been identified. It is
know n that Cdc28p/Clb activity is required for loading of Cdc45p onto chromatin
in budding yeast (Fig. 1.4 D and E, and above) how ever as neither Cdc45p nor the
fission yeast homologue sna41p contain CDK consensus phosphorylation sites it is
possible that phosphorylation of another component of the pre-replicative complex
prom otes a conformational change to allow binding of Cdc45p/sna41p. Potential
candidates for this could be an ORC subunit, the m ost likely of which w ould be
Orc6p which is m odified to a slower m igrating form on entry into S phase in
b u d d in g yeast. This form is not present w hen the four Cdc28p consensus
phosphorylation sites are m utated (Liang and Stillman, 1997). The fission yeast
orp2p has also been shown to be differentially m odified throughout the cell cycle
(Lygerou and N urse, 1999). O rp2p is a phosphoprotein and contains cdc2p
34
Chapter 1 Introduction
consensus phosphorylation sites (Leatherwood et ah, 1996; Lygerou and Nurse,
1999); in fact it was first isolated in a 2-hybrid screen for cdc2p interacting proteins
(Leatherwood et ah, 1996). How ever the modification occurs in mitosis and the
protein becomes converted to a faster m igrating form as cells enter G l (Lygerou
and N urse, 1999). The timing of orc2p phosphorylation is therefore inconsistent
w ith it being a S phase target of CDK activity. An alternative candidate could be
cdc23p which contains two cdc2p consensus phosphorylation sites in the Nterm inal region of the protein (Aves et al., 1998). I previously suggested that
cdc23p phosphorylation could be involved in prom oting an interaction w ith the
MCM complex. Either of these options are possible, although as cdc2p kinase
activation occurs later in the cell cycle than MCM loading, this hypothesis is less
likely.
1.4.7 H sklp/dfplp kinase
The second kinase activity required for initiation of DNA replication is that of
h s k l / d f p l in fission yeast. The hom ologous kinase, C dc7p/D bf4p, has been
show n to act after C dc28p/C lb in Saccharomyces cerevisiae, indicative of the
sequential phosphorylation of pre-replicative complex com ponents by the two
kinases (Fig. 1.4) (Nougarede et al., 2000). Like CDKs, DDKs (Dbf4-dependent
kinases) also consist of a kinase subunit, h sk lp and a regulatory partner, dfplp.
The h sk l gene was isolated by degenerate PCR using oligonucleotide prim ers
against budding yeast CDC7 (Masai et al., 1995). Purification of the kinase led to
the identification of d fp lp as the regulatory subunit since it was found to be
associated w ith hsklp. Further analysis of d fp lp has show n it to be an essential
gene required for both DNA replication and the S phase checkpoint (Brown and
Kelly, 1999; Takeda et al., 1999). In fact d fp lp is phosphorylated in a chklp kinase
dependent m anner in response to HU treatm ent (Brown and Kelly, 1999). D fplp is
regulated both transcriptionally and post-translationally. This results in an increase
in protein level at the G l/S transition which corresponds to activation of the hsklp
kinase (Brown and Kelly, 1999; Takeda et al., 1999).
The MCM complex has been identified as a substrate of the DDK in a num ber of
organism s. Mcm2p has been show n to be a DDK substrate in budding yeast,
fission yeast and Xenopus (Brown and Kelly, 1998; Jiang et al., 1999a; Lei et al.,
35
Chapter 1 Introduction
1997). In fission yeast the h s k lp /d f p lp kinase specifically phosphorylated cdcl9p
(mcm2p) w hen presented w ith the purified MCM heterohexam eric complex
(Brown and Kelly, 1998). The C dc7p/D bf4p kinase w as also purified from
baculovirus and show n to phosphorylate Pol a-prim ase and all m em bers of the
MCM complex w ith the exception of Mcm5p (Weinreich and Stillman, 1999).
Another putative target of the DDK is Cdc45p. It has been show n to act at the same
time as Cdc7p in reciprocal shift experiments indicating that the two proteins are
dependent on each other for function (Owens et al., 1997). Xenopus Cdc7p is also
required for the chromatin association of Cdc45p (fares and Blow, 2000). Finally a
recent report has shown that budding yeast Cdc45p can be phosphorylated by the
Cdc7p/D bf4p kinase in vitro (Nougarede et al., 2000).
One hypothesis for the function of the DDK is to aid local unw inding of DNA at
origins. The structure of replication origins, determ ined by genomic footprinting in
b u d d in g yeast, changes betw een the CDC7 an d CDC8 (a thym idylate kinase
required for DNA replication) execution points, indicating that Cdc7p triggers
unw inding (Geraghty et al., 2000). The mcm5/cdc46-bobl m utant bypasses the
requirem ent for the Cdc7p kinase (Hardy et al., 1997) and m utant cells blocked in
G l w ith a-factor have the same ARS DNA structure as is found in a cdc8 m utant,
indicating that Cdc7p dependent unw inding m ay involve the MCM complex
(Geraghty et al., 2000).
1.5 Alternation problem
The ability to alternate S phase with M phase is one of the key problem s a cell has
to solve. CDKs are required for the onset of both of these events and the regulation
of this activity is essential in m aintaining the correct genom e ploidy. In fact
disruption of normal CDK activity is sufficient to alter the dependency of S phase
on the completion of mitosis. This was first discovered in a screen for diploidizing
m utants, ie. cells that undergo an additional round of DNA replication in the
absence of an intervening mitosis. Two previously identified cdc2 alleles were re­
isolated, cdc2-33 and cdc2-M26. Loss of cdc2p from a G2 cell is therefore able to
change cdc2p from the mitotic form to the S phase form (Broek et al., 1991). The
36
Chapter 1 Introduction
significance of the level of kinase activity in determ ining the cell cycle stage was
further dem onstrated by two discoveries: first that depletion of the mitotic cyclin,
cdcISp, could induce multiple rounds of DNA replication in the absence of mitosis
(Hayles et al., 1994) and secondly that the CDK inhibitor, rum l, could also induce
re-replication w hen overexpressed (Correa-Bordes and N urse, 1995; Moreno and
Nurse, 1994).
Deletion of the B-type cyclins cigl and cigl dem onstrated that the mitotic cyclin,
cdcl3, alone was able to prom ote both DNA replication, albeit w ith a slight delay
and mitosis indicating that the level of cdc2p associated kinase activity is the
determ ining factor for w hether cells undergo S phase or M phase (Fisher and
N urse, 1996). This work led to the proposal of the quantitative m odel which
suggested that a low level of kinase activity is required to prepare for DNA
replication, an increase from a low to m oderate level of kinase activity prom otes
DNA replication, maintenance of this level of activity prevents a subsequent round
of replication and the increase to a high level brings about the onset of mitosis (Fig.
1.3) (reviewed in Stern and Nurse, 1996). The m echanism s used to control the
cdc2p associated kinase level in a normal cell cycle include availability of a cyclin
p artner (controlled by transcription and proteolysis), phosphorylation and the
presence of CDK inhibitors, all of which have been described previously (Fig. 1.2).
Putative cdc2p substrates involved in both the initiation of replication and mitosis
have previously been mentioned, however we have yet to address the substrates
phosphorylated by cdc2p after S phase initiation to ensure that DNA replication
occurs only once per cell cycle.
It is critical to tightly regulate cdclS protein levels as overexpression of cdclS leads
to re-replication. CdclS is controlled both transcriptionally in a cdclOp dependent
m anner (discussed previously) and post-translationally. CdcISp contains six cdc2p
consensus phosphorylation sites (Kelly et al., 1993) and has been show n to be
phosphorylated by cdc2p, probably in association w ith cig2p (Baum et al., 1998;
Jallepalli et al., 1997; Lopez-Girona et al., 1998). Phosphorylation promotes binding
of cdcISp to p o p lp and p o p 2 p /s u d lp , the F-box like com ponents of the SCF
complex. These act as recognition factors for phosphorylated cdcISp and, along
w ith the other members of the complex, target cdcISp for degradation via the
37
Chapter 1 Introduction
proteasom e (Fig. 1.4 E) (Jallepalli et al., 1998; Kominami et al., 1998a; Kominami
and Toda, 1997; Wolf et al., 1999b).
R u m lp is also targ eted for proteolytic d e g ra d atio n via the SCF after
phosphorylation of two threonine residues, T58 and T62, by cdc2p (Benito et al.,
1998). W hen these threonine residues are m utated to alanine, ru m lp is stabilized
and cells occasionally re-initiate replication to become diploids (Benito et al., 1998).
H ow ever, this diploidization is m ore efficient if both ru m lp and cdcl8p are
stabilized, as in a popl or pop2/sudl m utant (Jallepalli et al., 1998; Kominami et al.,
1998a; Kominami and Toda, 1997; Wolf et al., 1999b). Proteolysis following cdc2p
phosphorylation is therefore a crucial m echanism by which DNA replication is
restricted to once per cell cycle.
Another im portant target of cdc2p phosphorylation is the MCM complex. Cdc21p
(mcm4p) contains several cdc2p consensus phosphorylation sites and has been
show n to exist in m ultiple phosphorylation states in fission yeast as well as
hum ans and Xenopus (Coue et al., 1996; H endrickson et al., 1996; M usahl et al.,
1995; N ishitani et al., 2000). Evidence initially suggested that phosphorylation
could play an inhibitory role in the chrom atin b in d in g of cdc21p as the
phosphorylated hum an Cdc21p appeared less tightly bound to nuclear structures
(M usahl et al., 1995), and X enopus Cdc21p became phosphorylated by Cdc2p
during S phase, greatly decreasing its affinity for chrom atin (Coue et al., 1996;
Hendrickson et al., 1996). More recent data obtained from a m am m alian in vitro
system suggests that the phosphorylation of Mcm4p by cyclin A /C dk2 inhibits the
helicase activity of the Mcm4p, 6p and 7p complex, thus providing a mechanism
for the inhibitory effect of CDKs (Ishimi et al., 2000). The situation in budding
yeast is som ew hat different as MCM localization is cell cycle regulated (as
discussed earlier), being nuclear in G l and cytoplasmic following S phase. This
nuclear exclusion during 0 2 and mitosis is dependent on Cdc28p associated w ith
either the G l cyclins (CLNs) or the B-type cyclins (CLBs) (Labib et al., 1999;
Nguyen et al., 2000). Thus the precise mechanism used by an organism to prevent
re-association of MCMs and hence re-formation of pre-replicative complexes in G2
appears to vary but all involve phosphorylation of Mcm4 by CDKs.
38
Chapter 1 Introduction
A num ber of mechanisms have therefore evolved in fission yeast to ensure that M
phase alw ays succeeds S phase. These include the periodic transcription and
d eg rad atio n of key proteins such as cdcISp and the inhibition of others by
phosphorylation such as cdc21p. Some of these m echanism s are redundant, for
exam ple constitutive expression of cdcl8 does not affect cell cycle progression
(Kelly et al., 1993). A multi-layered regulation system exists to preserve genome
integrity by ensuring that DNA replication occurs only once in every cell cycle .
1.6 Completion problem
C heckpoints act to m onitor the completion of cell cycle events and prevent cell
division until these events have been com pleted successfully (Hartwell and
W einert, 1989). Checkpoints operate in fission yeast to block the onset of mitosis if
DNA replication is not complete or DNA damage is not repaired. The checkpoints
are therefore initiated by two different signals b u t interestingly m any of the
proteins identified have been found to operate in both checkpoint controls. These
are know n as the checkpoint rad proteins and include radl, rad3, radS, radl7, radl6
and husl (Al-Khodairy and Carr, 1992; Enoch et al., 1992; Rowley, 1992).
Radi is predicted to have 3'-5' exonuclease activity and is homologous to RAD17 in
Saccharomyces cerevisiae (Lydall and Weinert, 1995). RadS is a m em ber of the PI-3
kinase fam ily and is related to M E C l in bu d d in g yeast and ATM in hum ans
(Bentley et al., 1996; Enoch and Norbury, 1995; Savitsky et al., 1995). Radl7 has
some hom ology to RFC which is required to load PCNA onto DNA. The budding
yeast hom ologue of radl7 is RAD24 (Griffiths et al., 1995). A hum an homologue of
rad9, has been identified (Lieberman et al., 1996), as has D D C l, a Saccharomyces
cerevisiae homologue (Longhese et al., 1997). H um an and m ouse genes have been
identified w ith sequence similarity to h u sl, but radlS has no know n hom ologue
(Kostrub et al., 1998; Volkmer and Karnitz, 1999).
39
Chapter 1 Introduction
Table 1.2
Com parison of gene names betw een Sch izosacch arom yces
pom be and
Saccharomyces cerevisiae of genes involved in the checkpoint pathway
Schizosaccharomyces pombe_____________ Saccharomyces cerevisiae
radl
RAD17
radS
M EC l
rad9
D D Cl
radl7
RAD24
radlS
husl
cdsl
RAD53
chkl
CHKl
Despite the rem arkable sim ilarity of the checkpoint rad m utant phenotypes, the
proteins have recently been show n to form sub-complexes and perform distinct
functions. RadlZp associates w ith subunit 3 of RFC which is required for both the
replication and dam age checkpoints (Shimada et al., 1999). This interaction is
conserved as Rad24p also interacts w ith two RFC subunits, Rfc2p and Rfc5p in
Saccharomyces cerevisiae (Shim om ura et al., 1998). R adlZ p rem ains bound to
chrom atin throughout the cell cycle (Griffiths et al., 2000) indicating that, along
w ith RFC, it could play a role in sensing dam age or stalled replication forks. It has
also been hypothesised that it could act as a landing pad for other checkpoint
proteins following initiation of the checkpoint signal (Fig. 1.5) (Griffiths et al.,
2000).
H u slp has been show n to interact w ith ra d lp in a rad9 dependent m anner in
fission yeast (Kostrub et al., 1998), indicating that the three proteins could form a
complex as occurs w ith the hum an hom ologues (Volkmer and Karnitz, 1999).
Interestingly, h u s lp is phosphorylated in response to DNA dam age and this
phosphorylation is dependent on the other checkpoint rad genes (Fig. 1.5) (Kostrub
et al., 1998). However in hum ans it is the Rad9p com ponent that is phosphorylated
in response to damage (Volkmer and Karnitz, 1999).
40
Chapter 1 Introduction
The checkpoint signals diverge downstream of the checkpoint rad proteins as one
of two protein kinases, chklp or cd slp , is activated depending on w hether the
signal is generated by dam age or stalled replication (Fig. 1.5). This decision
appears to be m ediated by radSp as it is required to initiate b u t not m aintain the
chklp response following DNA damage, but is required for both the initiation and
m aintenance of the cd slp response (Martinho et al., 1998). RadSp has also been
show n to physically interact w ith ch k lp and c d slp (M artinho et al., 1998)
indicating that it acts dow nstream of the other checkpoint rad proteins (Fig, 1.5).
This hypothesis is som ewhat controversial as a recent report show ed that radSp
stably interacts w ith and phosphorylates rad26p following DNA damage. This
does not require the function of the other checkpoint rad proteins (Edwards et al.,
1999). The authors conclude that the rad3p-rad26p complex acts either upstream
from, or in a parallel pathw ay to the other checkpoint proteins and could be
involved in detecting the DNA damage, therefore placing radSp at an earlier stage
in the pathw ay (Fig. 1.5).
The ch k lp and cd slp protein kinases transduce the checkpoint signal from the
checkpoint rad proteins to the cell cycle machinery, resulting in the inhibition of
cdc2p and hence mitosis. Both the dam age and DNA replication checkpoints
ultim ately act to m aintain cdc2p in its inactive tyrosine-15 phosphorylated form
(Enoch et al., 1991; R hind et al., 1997; R hind and Russell, 1998). The
phosphorylation state of tyrosine-15 is influenced by the kinases, w e elp and
m ik lp , and the phosphatase, cdc25p, and their deregulation bypasses the
checkpoint controls (Gould et al., 1990; Lundgren et al., 1991; Russell and Nurse,
1986; Russell and Nurse, 1987b). The interaction betw een the signal transducers
and the cell cycle machinery will be explored in greater detail in C hapter 2.
41
B
Mitotic ceil cycle
Sexual differentiation
M -factor
starvation
CZJ
h-
t
h-t-
CD
P-factor
G2
conjugation
c
)
zygote form ation
m eiosis and sporulation
Figure 1.1
The fission yeast life cycle
In the presence of sufficient nutrients haploid fission yeast cells grow mitotically. G2
comprises about 70% of the cell cycle whereas G l, S and M take up 10% each (A). Upon
starv atio n , cells fo llo w an a ltern ativ e d ev elo p m en tal fate and undergo sexual
differentiation (B). h+ or h- cells exit the cell cycle in G l and secrete a mating type specific
pheromone. Pheromones initiate conjugation which is immediately followed by meiosis
and sporulation, resulting in a zygotic ascus with four haploid spores.
T167
Y15
T167
CDK
Y 15
C DK
CKI
Cyclin
CKl (rum lp)
T 167
cyclin
Y15
CD K
Active complex
cyclin
n im lp /c d rlp h
cdc25p
-4
wee 1p
4---------m ik lp
©
N iflp
' cdr2p
©
T 167
Y 15
CDK
cyclin
B
Figure 1.2
Principles of CDK regulation
The CDK is first phosphorylated by CAK (CDK activating kinase) on T 167 which
enables it to associate with the cyclin subunit (A). CDK activity is also regulated by the
inhibitory phosphorylation of the Y 15 residue (B) and the reversible binding of the CKI
rum lp (C).
Protein kinase activity
cdc2p
cig2p
cdc2p
c d cl3 p
Figure 1.3
B-type cyclins control S phase and mitosis in fission yeast
The cdc2p kinase activity associated with cig2p peaks early in the cell cycle and brings
about the onset of S phase. The kinase activity associated with cdcl3p rises from S phase
and peaks in mitosis. CdcISp can fulfil three different functions in association with cdc2p:
it is essential for the onset of mitosis, it prevents re-replication, and it compensates for
cig2p as the major S phase cyclin in a cig2A strain.
A
Post-replicative complex
O
B
Early G 1
C
Pre-replicative com plex
CD K activity
D
Pre-initiation complex
0 —0
D D K activity
E
Replication initiation
Figure 1.4
e
o
o
o
o
o
•
ORC
cdc23p
cdcIS p
c d tlp
cut5p
M CM s
sna41p
Model for the initiation of DNA replication in fission yeast
ORC and cdc23p are constitutively bound to DNA throughout the cell cycle (A). CdcISp,
cdtlp and possibly cut5p bind to origins early in G l (B) and promote the loading of the
MCMs and formation of the pre-replicative complex (C). CDK activity is required for the
loading of sna41p and the formation of the pre-initiation complex (D). DDK activity is the
last requirement before initiation and is thought to promote local unwinding at origins.
After initiation, cdcISp is released from origins and phosphorylated by CDK leading to its
degradation. MCMs and sna41p are thought to move with the replication forks (E).
Stalled replication
DNA damage
ra d l7 p
( g ) —f
h u slp
RFC
y
ra d lp
^ a l s l |^
^ c h k l^
Cell cycle m achinery
-
>,
.
Figure 1.5
Model showing how checkpoint signals could be transmitted to the cell cycle machinery
The checkpoint signal is first initiated by either stalled replication forks or DNA damage.
The signal is transm itted to the checkpoint rad proteins, possibly via radlT p which is
constitutively bound to the DNA and could act as a landing pad for the other checkpoint
rad proteins. The pathway diverges again at radSp which transmits the signal to either cdslp
or chklp depending on whether the signal was initiated by stalled replication or damage.
C dslp and chklp transduce the signal to the cell cycle machinery which ultimately acts to
inhibit cdc2p by Y 15 phosphorylation.
Chapter 2
Characterization of ccfcfS domains and their
ability to perform essential o d d 8p functions
Introduction
C dcISp has a role both in prom oting DNA replication and in initiating the
checkpoint that acts to prevent mitosis until DNA replication has been successfully
completed. In this chapter I used a num ber of different cdcISp m utants including
the N -term inus of the protein, the C -term inus of the protein, and site specific
m utants, to discover which dom ains of the protein are required to carry out these
functions. I exam ined this by assaying the ability of cells to re-replicate and to
block m itosis w hen the m utants w ere overexpressed. I also investigated the
relationship betw een the m itotic kinase, cd c2 p /cd c l3 p and cdcISp during re­
replication. Finally I exam ined w here cdcISp acts in the checkpoint pathw ay and
how the checkpoint initiated by overproduction of cdcISp ultim ately acts to inhibit
the cdc2p/cdcISp kinase.
C h a p te r 2 C haracterization of cd c7 8 d om ains
Results
2.1 The C-terminus of cdcISp is sufficient for cdcISp
induced re-replication
It has been show n that cdcISp can induce DNA re-replication and block the onset
of m itosis w hen expressed to high levels (Nishitani and N urse, 1995). CdcISp
contains several motifs which m ay be involved in these functions. These include
six consensus phosphorylation sites (S/TPxK/R) for the cdc2p kinase, and an NTP
binding motif (GxxGxGKT). To investigate which dom ains of cdcISp are essential
for its function, a series of constructs encoding m utated versions of cdcISp were
generated (Fig. 2.1). CdclS-l-141p consists of the first 141 amino acids and includes
five out of the six cdc2p consensus phosphorylation sites, w hile cdclS-150-577p
and cdclS-150-577 (T374A)p correspond to the C-term inus of cdcISp, in which five
out of the six cdc2p consensus phosphorylation sites are deleted. However they do
include the NTP binding motif. The difference betw een these two constructs is that
the sixth cdc2p consensus phosphorylation site is m utated in 150-577 (T374A)p,
thus rem oving the last consensus site for phosphorylation by cdc2p. The final
construct, cdcl8-NTPp, encodes the complete cdcISp w ith a m utated NTP binding
motif (amino acid residues 204G and 205K are changed to AA). This should inhibit
cdcISp from binding to an NTP. In order to investigate w hether any of these
m utants w ere functional, w ildtype cdcl8 and the four m utant constructs were
transform ed into the tem perature sensitive cdcl8-K46 m utant. The constructs were
then expressed at the restrictive tem perature of 36°C to see if they could
complement the cdcl8-K46 m utant. Only w ildtype cdcl8 was able to complement.
The cells containing the cdcl8 m utant constructs w ere able to undergo at most a
few divisions. None of the m utants were therefore able to complement cdcl8-K46.
In order to investigate which cdcISp functions are defective in each m utant, their
ability to induce re-replication and to block mitosis w hen expressed to high levels
was assayed. Each cdcl8 construct was introduced into the pRep3X plasmid, thus
placing the genes under the control of the thiam ine repressible n m tl prom oter
(M aundrell, 1990). This is the strongest nm t prom oter and results in substantial
48
Chapter 2 C haracterization of cofc78 dom ains
overexpression of the gene. The m utants were transform ed into wildtype cells and
the phenotypes were examined by microscopy and FACS analysis 20 hours after
induction of the prom oter at 32°C. O verproduction of the w ildtype cdcISp or any
of the m utants caused the cells to elongate, unlike cells containing the vector alone
(Fig. 2.2 A). These results indicate that all of the cdcISp m utants are capable of
blocking mitosis.
N ext the ability of the cdcISp m utants to induce DNA re-replication was
exam ined. FACS analysis show ed an increase in DNA content of cells over­
expressing cdclS-150-577p and cdclS-150-577 (T374A)p. Over 40% of the cells had
a DNA content of greater than 4C (Fig. 2.2 B d and e). These m utants, like the
w ildtype protein, were therefore able to induce re-replication. The C-terminus of
cdcISp m ay even induce re-replication to a greater extent than the w ildtype
protein. Only a proportion of cells are able to induce re-replication as can be seen
from the continued presence of a 2C peak (Fig. 2.2 B b, d and e). This is because
cells contain a variable plasm id copy num ber and a m inim um num ber of plasmids
will be required in a cell before re-replication can be induced. Cells overproducing
cdclS-l-141p and cdclS-NTPp still elongated to a sim ilar extent as the other
m utants, as dem onstrated by the forward scatter dot plot. How ever only a small
apparent increase in DNA content was generated (Fig. 2.2 B c and f), and less than
10% of cells had a DNA content of greater than 4C. To verify that cdclS-l-141p and
cdclS-N T Pp w ere not causing a low level of re-rep licatio n leading to
diploidization, cells were plated onto media containing Phloxin B (PB) at the end
of the tim ecourse. Phloxin B is a red dye that allows differentiation betw een
haploid and diploid cells. Only living cells are able to pum p out Phloxin B and as
there is a greater proportion of dead or dying cells in a diploid colony compared to
a haploid colony as diploid cells are more sick, the diploid colonies stain a darker
pink. Only pale pink colonies, indicative of haploid cells, grew on the PB plates
when cdcl8-l-141p and cdcl8-NTPp had been expressed indicating that there were
no diploid colonies present. The increase in DNA content observed is most likely
due to either an increase in background staining or mitochondrial DNA (Sazer and
Sherwood, 1990) in the subset of cells expressing the constructs.
49
C h a p te r 2 C h aracterization of c d c t8 dom ains
W estern blots were perform ed to verify that the cdcl8 m utant proteins were
expressed in all cases. Antibodies against the C-term inus of cdcl8p indicated that
cdcl8-w tp (66kDa), cdcl8-150-577p (48kDa), cdcl8-150-577 (T374A)p (48kDa) and
cdcl8-NTPp (66kDa) were all expressed to equal levels (Fig. 2.2 C, lanes 1-4).
Several bands of lower molecular w eight are also seen and these are m ost likely
degradation products as cdcl8 is a highly unstable protein (Muzi-Falconi et al.,
1996). It is surprising that more cdcl8p products of lower m olecular weight are
present w hen the C-terminus of cdcl8p is expressed, as it is m ore stable than the
w ildtype protein (Baum et al., 1998).
To detect the N -term inus of cdcl8p (cdcl8-l-141p), antibodies against the entire
protein were used. No band was seen in the vector alone control. However, a
cdcl8p band of about 16kDa was present in the cdcl8-l-141p transform ant lane.
Endogenous cdcl8p was not detected as it is expressed at a m uch lower level than
that induced by the n m tl prom oter 20 hours after derepression (Fig. 2.2 D lanes 1
and 2).
These results indicate that all of the m utants were able to m aintain a block over
mitosis, while those expressing the C-terminus of the protein, cdcl8-150-577p and
cdcl8-150-577 (T374A)p, could also efficiently prom ote DNA re-replication.
2.2 CdclSp induced re-replication is not caused by
inhibition of the cdc2p/cdcl3p mitotic kinase
It has been suggested that DNA re-replication induced by high levels of cdcl8p
occurs indirectly due to the inhibition of the cdc2p/cdcl3p mitotic kinase (Wolf et
al., 1996). There are two possibilities for how this inhibition could be achieved.
Either cdcl8p could directly bind and inhibit cdc2p, or overproduction of cdcl8p
could saturate the proteolytic m achinery that degrades both itself and ru m lp
(Kominami and Toda, 1997). The latter could subsequently lead to an accumulation
of the CDK inhibitor and a decrease in the m itotic kinase activity. These
possibilities w ere investigated in several ways. Firstly, the mitotic kinase activity
w as assayed in cdcl3p im m unoprecipitates derived from cells overproducing
cdcl8-wtp and cdcl8-150-577p. The cdc2p kinase activity was followed during a 20
50
Chapter 2 C h aracterization of cd c7 8 d om ains
hour time period after induction of the prom oter at 32°C (Fig. 2.3 A). High levels of
w ildtype cdclSp depressed the m itotic kinase activity as previously reported
(Nishitani and Nurse, 1995), but cdcl8-150-577p did not, despite inducing DNA re­
replication. This experiment was repeated but in addition cdcl8-l-141p was also
overproduced. This enabled us to determine w hether the inhibition of the mitotic
kinase activity was due solely to the N -term inus of the protein. The cdc2 kinase
data was quantified at the 11 and 19 hour tim epoints using NIH Image (Fig. 2.3 B).
A decrease in the kinase activity was observed betw een 11 and 19 hours w hen
cdcl8-w tp and cdcl8-l-141p were overproduced. Cdcl8-150-577p overproduction,
again, had no effect on the mitotic kinase activity. This led us to the hypothesis that
it is the N-term inus of cdcl8p that interacts w ith cdc2p and may be responsible for
the inhibition of the kinase activity.
This hypothesis was confirmed w hen cdc2p was precipitated in order to look for
an interaction w ith either the N-term inus or C -term inus of cdcl8p. Cdc2p was
precipitated using either su c lp beads or BSA control beads in w ildtype cells
expressing HA tagged cdcl8-l-141p or cdcl8-150-577p 16 hours after induction of
the m edium strength nm t prom oter (nmt41) at 32°C. W estern blots were performed
and probed w ith anti-HA 12CA5 antibodies (Fig. 2.4 top panel) and anti-cdc2p
PSTAIR antibodies (Fig. 2.4 bottom panel). A greater proportion of the C-terminus
of cdcl8p w as found in the total cell extract (lanes 1 and 4) which m ay reflect a
difference in stability of the two m utants. How ever, only HA cdcl8-l-141p was
precipitated by the suclp beads (lanes 2 and 5). N either cdcl8p nor cdc2p were
precipitated w ith the BSA control beads (lanes 3 and 6). This indicates that only the
N-term inus of cdcl8p is able to interact with cdc2p. The fact that the C-terminus of
cdcl8p does not interact w ith cdc2p provides further support that re-replication
can occur w ithout cdcl8p acting directly on cdc2p to inhibit its activity.
These experim ents allow us to conclude that although cdcl8p can directly bind
cdc2p and depress its activity, it is not through this reduction in cdc2p kinase
activity that re-replication is induced. The cdcl8-150-577p neither results in a
decrease in cdc2p/cdcl3p kinase activity nor interacts w ith cdc2p but is still able to
prom ote re-replication to the same extent as cdcl8-wtp.
51
Chapter 2 C h aracterization of ccfc75 d om ains
In order to test the alternative possibility, that overproduction of cdclSp saturates
the proteolytic m achinery resulting in an increase of ru m lp . W estern blots were
perform ed w ith extracts derived from w ildtype cells overproducing cdclS-wtp,
cdcl8-l-141p and cdcl8-150-577p 20 hours after induction of the prom oter at 32°C.
The blots were probed w ith an ti-ru m lp (Fig. 2.5 top panel) and anti-a-tubulin
antibodies (Fig. 2.5 bottom panel). Levels of ru m lp did accumulate w hen cdclSw tp and cdcl8-l-141p were overproduced (Fig. 2.5 top panel, lanes 1 and 2) but
not w hen cdcl8-150-577p was overproduced(Fig. 2.5 top panel, lane 3). Therefore
overproduction of cdclSp can result in an increase of ru m lp levels b u t re­
replication can still occur in the absence of this, as w ith cdcl8-150-577p. To further
confirm this we overexpressed the cdcl8 m utants in a rum lA background (Fig. 2.6).
Re-replication was induced to the same levels in both w ildtype cells (Fig. 2.6 A)
and rum lA cells (Fig. 2.6 B). 1 therefore conclude that cdclSp induced re-replication
does not occur as a result of increased ru m lp levels leading to inhibition of the
cdc2p/cdclSp mitotic kinase.
As a consequence of these experim ents 1 conclude th at cdclSp induced re­
replication is not simply due to an inhibition of the cdc2p/cdclS p mitotic kinase.
2.3 Requirement of checkpoint genes for the mitotic block
C dclSp has previously been show n to have an additional role to that in DNA
replication, as deletion of the gene leads to an aberrant mitosis and cytokinesis as
cells undergo mitosis in the absence of DNA replication (Kelly et al., 1993). CdclSp
is therefore part of a checkpoint that m onitors the state of the cell and restrains
mitosis until S phase has been successfully completed. O verproduction of cdclSp
results in both re-replication and a block over m itosis, so it is possible that it
mimics activation of the DNA replication checkpoint. By expressing cdclSp in
checkpoint m utant backgrounds it m ay be possible to place where cdclSp acts in
the checkpoint pathw ay. Some of the cdclSp m utants are able to inhibit mitosis
w ithout inducing re-replication (cdclS-l-141p and cdclS-NTPp). This m ay allow
separation of the replication and checkpoint functions and help determine whether
functional domains of cdclSp differ in their ability to activate the checkpoint.
52
Chapter 2 C h aracterization of cc/c78 d om ains
The cdcl8 m utants (Fig. 2.1) were expressed in strains defective in the checkpoint
control. Five m utants were used, radl-1, rad3-136, rad9-192, radl7-h21 and husl-14,
all of which are unable to send the signal preventing mitosis w hen hydroxyurea
(HU), a drug that inhibits ribonucleotide reductase and hence blocks cells in early
S phase, is added to the cells (Al-Khodairy and Carr, 1992; Enoch et al., 1992;
Rowley, 1992). Cells w ere scored for elongation, indicating grow th w ithout
division and therefore a block over mitosis. Cells were considered elongated if they
were more than 1.5 times the size of a w ildtype cell 20 hours after derepression of
the n m tl prom oter at 32°C. Typically 60% of transform ed cells in an exponentially
grow ing population w ould contain a plasm id and consistently around 60% of
w ildtype cells transform ed w ith any of the cdcl8 constructs w ere found to be
elongated (Fig. 2.7 A a). In checkpoint m utant backgrounds, cells expressing cdcl8w tp, cdcl8-l-141p and cdcl8-N T Pp w ere all capable of blocking m itosis.
Elongation occurred to the same level as in w ildtype cells. H ow ever in all the
checkpoint m utants, expression of cdcl8-150-577p and cdcl8-150-577 (T374A)p did
not induce elongation, indicating that these m utants w ere unable to send the
checkpoint signal to prevent mitosis (Fig. 2.7 A b-f). Microscopic examination of
cells overproducing cdcl8-150-577p and cdcl8-150-577 (T374A)p in a radl-1 strain
confirm ed their inability to send the checkpoint signal as the cells were m uch
smaller and displayed a cut (cell untim ely torn) phenotype (Fig. 2.7 B d and e). This
is indicative of an aberrant mitosis in the absence of com pleted DNA replication.
This results in unequal segregation of the DNA as it m ay either be torn between
the two daughter cells or one cell m ay be left w ithout any of the genetic material
(anucleate). W estern blot analysis shows that all of the m utants w ere expressed
(Fig. 2.7 C and D) and therefore that the inability of cdcl8-150-577p and cdcl8-150577 (T374A)p to block mitosis was not due to lack of protein expression. In fact, the
protein levels of cdcl8-150-577p and cdcl8-150-577 (T374A)p in radl-1 cells appear
to be about 2 or 3 times higher than those of cdcl8w tp and cdcl8-NTPp (Fig. 2.7 C
lanes 1-4).
We conclude that high levels of w ildtype cdcl8p and m utants containing the Nterm inus can block mitosis even w hen the checkpoint control is defective. This
strongly suggests that cdcl8p overproduction does not mimic activation of the
norm al checkpoint control. It seems more likely that as the N-term inus can bind
53
Chapter 2 C h aracterization of
cdc18 d om ains
cdc2p (Fig. 2.4), it inhibits the mitotic kinase and blocks mitosis in a non-specific
m anner. However, w hen the N-term inus is deleted as in the cdcl8-150-577p and
cdcl8-150-577 (T374A)p constructs, the block over mitosis is dependent upon an
intact checkpoint control. In these cases the high levels of cdcl8p do appear to
induce activation of the checkpoint. Thus the C-term inus of cdcl8p appears to act
upstream of the rad and hus genes exam ined, w hilst the N -term inus acts in a
rad/hus checkpoint independent manner.
2.4 The NTP binding motif is required both for re­
replication and initiation of the checkpoint signal
The NTP m utant cdcl8-NTPp is also able to block mitosis w hen overproduced but
does not induce DNA re-replication (Fig. 2.2 A f and B f). There are two
possibilities for how cdcl8-NTPp could block mitosis. The first is that it is simply
due to the presence of the N-term inus of cdcl8p, as cdcl8-l-141p alone can inhibit
mitosis, perhaps by directly binding to cdc2p. The alternative is that cdcl8-NTPp
could allow a complex to form at the replication origins w hich is sufficient to
trigger a checkpoint signal, b u t is deficient for in itiatin g replication. To
differentiate between these possibilities and test w hether the N -term inus region is
required for the NTP m utant to block m itosis, a NTP 150-577 m utant was
constructed. W hen cdcl8-150-577-NTPp was overproduced in w ildtype cells re­
replication was not induced (Fig. 2.8 B) whereas overproduction of cdcl8-150-577p
induced re-replication (Fig. 2,8 A). There was also no block over mitosis as the
forward scatter dot plot demonstrates that the cells do not elongate. Therefore, an
intact NTP site is required both to induce re-replication and bring about a
checkpoint dependent block over mitosis. The cdcl8-NTPp m utant m ust therefore
block mitosis via its N-terminal region.
2.5 Requirement for cut5
Another gene, cut5, which is essential for DNA replication has been implicated in
the checkpoint (Saka et al., 1994; Saka and Yanagida, 1993). To investigate the
effects of the various cdcl8p m utants in cut5 m utant cells, they were introduced
into the tem perature sensitive m utant cut5-580 which blocks DNA replication and
54
C h a p te r 2 C h aracterization of
cdc18 dom ains
induces m itosis at the restrictive tem perature of 36°C. C ut5-580 cells were
transform ed w ith the cdcl8 m utant constructs and grow n in the absence of
thiam ine to allow protein expression for 20 hours at 25°C, The culture was then
split and half was shifted to the restrictive tem perature of 36°C. The cultures were
grow n for three further generations and then scored for elongated cells (Fig. 2.9).
The cells m ain tain ed at the perm issive tem p eratu re (25°C) elongated to
approxim ately the same extent as wildtype cells expressing the cdcl8 m utants (Fig.
2.7 A a). H ow ever, w hen shifted to 36°C, the C-term inus of cdclSp was again
unable to block cell division. This indicates that the C -term inus of the protein
requires cut5p to send the checkpoint signal to block mitosis.
2.6 Requirement for cell cycle core machinery
The DNA replication checkpoint initiated either by ongoing DNA synthesis, as
w ith re-replication, or a block in DNA synthesis, for example w hen HU is added to
cells, m ust ultim ately act to inhibit the cdc2p/cdcl3p kinase and hence prevent
mitosis. It does this by utilising the norm al cell cycle controls that act in 0 2 to
prevent activation of the kinase until the correct time. This control acts through the
inhibitory phosphorylation of the cdc2 tyrosine-15 residue and is regulated by the
w e e lp /m ik lp tyrosine kinases, and the cdc25p phosphatase. As the checkpoint
also involves tyrosine-15 phosphorylation (Enoch et al., 1991), it could either
activate w eelp or m iklp, or inhibit cdc25p, or both to inhibit cdc2p activity.
To investigate these possibilities I overexpressed the cdcl8 constructs in two
strains. The first was a cdc2 m utant, cdc2-3w, which allows cells to enter mitosis
w ithout cdc25p (Enoch and Nurse, 1990). If the checkpoint acted to inhibit cdc25p,
the cells w ould be unable to prevent m itosis w hen the cdclSp m utants were
overproduced as the cells w ould be able to enter mitosis regardless of cdc25p
activity. The cells would therefore continue dividing in a cdc2-3w strain and would
not be elongated. The cells were grown at 32°C for 20 hours after induction of the
prom oter and were scored for elongation. All of the m utants produced elongated
cells w hen overexpressed in the cdc2-3w strain (Fig. 2.10 A).
55
Chapter 2 C haracterization of c d c 78 dom ains
Cdc2-3w cdc25A cells are longer than cdc2-3w cells due to an increased generation
time (Russell and Nurse, 1987b). The fact that cdc2-3w cdc25A cells are elongated
shows that although cdc2-3w cells do not require cdc25p for mitotic entry, they are
still sensitive to changes in cdc25p activity. It was im portant to confirm that the
elongation seen w hen the cdclS constructs were overexpressed w as a result of a
block over m itosis as opposed to an elongated generation time. In order to
investigate this I looked at a sample of cdc2-3w cdc25A cells and com pared them
w ith cdc2-3w cells that had either been transform ed w ith the pRepSX vector or had
been overproducing cdclS-wtp for 20 hours (Fig. 2.10 C). I m easured the length of
15 cells in each case and calculated the m ean (Fig. 2.10 B). We also calculated the
standard deviation to look at the variability and found it to be highest for cdc2-3w
cells overproducing cdcl8-wtp. In this case it was 0.912 units, where the average
cell length was 4.12 units. We found that cdc2-3w cells overproducing cdcl8-wtp
were on average twice the length of cdc2-3w cdc25A cells. This indicates that cdc23w cells overexpressing the cdclS m utants are blocking mitosis and do not merely
have a longer generation time. We conclude that the DNA replication checkpoint
does not act solely through the inhibition of cdc25p.
The second strain used was weel-50 tniklA (Lundgren et al., 1991). At the restrictive
tem perature for w eel-50 (36°C) the cells do not possess a kinase capable of
phosphorylating tyrosine-15 and consequently inhibiting cdc2p. The m utants were
transform ed into this strain and cultures w ere grow n at the perm issive
tem perature for 20 hours following induction of the prom oter. The cultures were
then split and half were shifted to 36°C. At 25°C all of the m utants were able to
prevent mitosis thus causing cell elongation (Fig. 2.11 A and B a and c). However,
at 36°C although those producing cdcl8-w tp (Fig. 2.11 B b), cdcl8-l-141p and
cdcl8-NTPp were elongated, nearly all of the cells expressing cdcl8-150-577p (Fig.
2.11 B d) and cdcl8-150-577 (T374A)p were very small and displayed cut nuclei
indicating aberrant mitoses. These results indicate that the w e e lp /m ik lp kinases
are required for a response to the checkpoint signal activated by overproducing the
C-terminus of cdcl8p which leads to a block over mitosis.
56
Chapter 2 C haracterization of ccfc^fi dom ains
D iscussion
Previous work has shown that cdcl8p overexpression in fission yeast cells results
in re-replication of DNA and induces a checkpoint which blocks mitosis (Nishitani
and N urse, 1995). I show that a series of cdcl8p m utants can prevent mitosis,
resulting in cell elongation, but only those encoding the C-term inus of cdcl8p,
cdcl8-150-577p and cdcl8-150-577 (T374A)p, are able to induce DNA re-replication
to a level similar to that found w hen wildtype cdcl8p is overexpressed (Fig. 2.2).
These results indicate that the C-terminus of cdcl8p w ith an intact NTP binding
motif is able to carry out the re-replication function of cdcl8p.
Several lines of evidence have show n that this re-replication can occur in the
presence of cdc2p kinase activity. Cdc2p kinase assays using histone H I as a
substrate dem onstrate that overproduction of the C-term inus of cdcl8p does not
cause a decrease in cdc2p kinase activity despite inducing re-replication to a
similar extent as cdcl8-wtp (Fig. 2.3). However, both cdcl8-w tp and cdcl8-l-141p
do result in a decrease in the kinase activity w hen overproduced. This result was
confirmed w hen the binding of cdc2p to either the N -term inus or C-terminus of
cdcl8p was assayed (Fig. 2.4). It was discovered that only the N -term inus was
capable of interacting w ith cdc2p, thus providing a potential mechanism for the
decrease in cdc2p kinase activity. An alternative mechanism could be through the
accumulation of the CDK inhibitor ru m lp . Cdcl8p and ru m lp are degraded by the
same proteolytic pathw ay (Kominami and Toda, 1997). There w as therefore a
possibility that overproduction of cdcl8p w ould overw helm the proteolytic
machinery allowing ru m lp levels to increase. The re-replication induced by the Cterm inus of cdcl8p occurred in the absence of an accumulation of rum lp. However
an increase in ru m lp occurred w hen constructs containing the N-term inus of
cdcl8p were overproduced (Fig. 2.5, lanes 1 and 2). This accumulation of ru m lp
could be sufficient to drive an additional round of replication. This m ay account
for the 4C peak seen on the FACS profile (Fig. 2.2). To address w hether this was
correct we plated cdcl8-l-141p cells onto Phloxin B, 20 hours after induction of the
n m tl prom oter. N one of the resulting colonies were dark pink, indicative of a
diploid population. The continued presence of this 4C peak w hen cdcl8-l-141p
57
C h a p te r 2 C haracterization of cafcT8 d o m ains
was overproduced in a rum lA strain (Fig. 2.6) confirms that the increase in DNA is
not a small am ount of re-replication b u t is m ost likely due to either increased
background staining caused by cell elongation or m itochondrial DNA as reported
previously (Sazer and Sherwood, 1990).
As the C-terminus of cdcl8p can induce re-replication w ithout a decrease in cdc2p
kinase levels it indicates that cdclSp re-replication does not occur sim ply by
inhibiting the cdc2p/cdcl3p mitotic kinase, as occurs w hen the mitotic cyclin,
cdclSp, is switched off (Hayles et al., 1994) or ru m lp is overproduced (Moreno and
Nurse, 1994). This strengthens the case that cdclSp is a key regulator of S phase
initiation. This result also supports previous w ork suggesting that cdclSp re­
replication does not require a decrease in kinase levels since cdcl8 m utated in the
first five CDK phosphorylation sites w as able to re-replicate even w hen co­
expressed w ith cdclSp to increase cdc2p/cdclS p kinase activity (Jallepalli et al.,
1997).
I also showed that the C-terminal constructs of cdclSp, cdclS-150-577p and cdclS150-577 (TS74A)p, were unable to m aintain the block over mitosis in checkpoint
deficient strains (Fig. 2.7). These results indicate that the C-terminus of the protein
acts upstream of the checkpoint genes exam ined and requires the rad and hus
genes to send the checkpoint signal to block mitosis. M utants containing the Nterm inus of cdclSp (cdclS-w tp, cdclS-l-141p and cdclS-NTPp) w ere able to
prevent mitosis in the checkpoint deficient strains. Similarly the mitotic block
induced by high levels of the C-terminus of cdclSp requires the cut5 protein while
m utants containing the N -term inus of cdclSp can block mitosis in the absence of
cut5p function (Fig. 2.9).
These results suggest that high levels of cdclSp can block m itosis by two
mechanisms. In the first m echanism the N-term inus region containing five of the
cdc2p consensus phosphorylation sites binds the cdc2p mitotic kinase directly (Fig.
2.4) and blocks mitosis independently of the checkpoint control. I suggest that this
is an unphysiological mechanism, resulting from overproduction of the proteins
and does not provide any insight into the function of the checkpoint. In the second
mechanism the block over mitosis is brought about by the C-term inus which does
58
Chapter 2 C h aracterization of
cdc18 dom ains
operate through the checkpoint control and requires the checkpoint rad/hus genes.
The C -term inus region requires an intact NTP site to send the checkpoint signal,
and the sam e site needs to be intact to induce DNA replication. Thus it is likely
that the C-term inus block over mitosis is brought about by the induction of DNA
replication w hich then activates the norm al checkpoint control. This result
suggests that cdclSp acts at the beginning of the pathw ay to induce the DNA
replication checkpoint and not at the end of the pathw ay by binding directly to
cdc2p.
It is possible to speculate on the nature of the checkpoint signal; it could be a
replication complex on the DNA or the presence of replication interm ediates once
replication has been initiated. The cdclS-150-577 (NTP)p m utant expressed in
w ildtype cells could not induce DNA replication or activate the checkpoint signal
as could be seen from the FACS data (Fig. 2.8). As these defects may have been due
to the failure to form a complex or fire origins, it was impossible to separate the
checkpoint function from that of replication and hence gain further insight into
how the signal is initiated.
The C-term inus of cdclSp alone is therefore able to carry out both of the essential
functions of cdclSp but is still unable to com plem ent the cdcl8-K46 tem perature
sensitive m utant w hen expressed at the restrictive tem perature. The N -term inus of
cdclSp is thought to play a predom inantly regulatory role as it contains 5 out of
the 6 cdc2p consensus phosphorylation sites, the phosphorylation of which targets
cdclSp for degradation (Baum et al., 199S; Jallepalli et al., 1997). However, the Nterm inus of cdclSp is still essential for cell viability. W hether this is due to a
requirem ent for cdclSp destruction at the end of S phase to allow norm al cell cycle
progression, or is related to another, as yet unknow n function of cdclSp, will be
discussed in more detail in a later chapter.
I have sh o w n th at w hen cdclS-150-577p or cdclS-150-577 (T374A)p are
overexpressed in the absence of w e e lp /m ik lp function, cells enter m itosis
prem aturely resulting in small cells displaying cut phenotypes (Fig. 2.11). This
suggests that the checkpoint activated by high cdclSp levels maintains cdc2p in its
tyrosine-15 phosphorylated state w ith reduced kinase activity. W hen the same
59
Chapter 2 C haracterization of c d c 78 d om ains
m utants are overexpressed in a cdc2-3zu strain which acts independently of cdc25p,
the cells are able to m aintain a block over mitosis indicating that the checkpoint
does not act to inhibit cdc25p (Fig. 2.10). This is inconsistent w ith results obtained
w hen HU is added to a cdc2-3w strain as these cells continue to divide when DNA
replication is blocked (Enoch and N urse, 1990). This can be explained if the
inhibitory signal sent to indicate ongoing replication is stronger than that found
w hen replication forks are halted by the addition of HU. A lternatively, re­
replication induced by high levels of cdclSp could be detected by the damage
pathw ay as DNA dam age is able to produce a block over mitosis in a cdc2-3zv
strain (Al-Khodairy and Carr, 1992). This point will be addressed in more detail
later. The constructs containing the N-term inus of cdclSp, cdclS-wtp, cdclS-l-141p
and cdclS-NTPp, do not require either w e e lp /m ik lp or cdc25p to block mitosis,
indicating th at the inhibition in this case is not d ep en d en t on tyrosine-15
phosphorylation. These results are consistent w ith our conclusions that the Nterm inus of cdclSp prevents mitosis by binding directly to cdc2p.
Since this w ork was carried out, further progress has been m ade into how the
checkpoint signal is transduced to ultimately inhibit mitosis. The evidence that the
checkpoint is m aintained through tyrosine phosphorylation of cdc2p has been
controversial at times (Barbet and Carr, 1993; Knudsen et al., 1996) but recent work
confirms that this phosphorylation is essential to m aintain both the DNA damage
and DNA replication checkpoints in fission yeast (Rhind et al., 1997; Rhind and
Russell, 1998). Two protein kinases provide a link betw een the rad and hus
proteins and the cell cycle machinery that regulates cdc2p activity. These are cdslp
(M urakami and Okayama, 1995), and chklp (W alworth et al., 1993). C d slp is
required for the checkpoint arrest induced by stalled replication forks or damage
caused d uring S phase (Lindsay et al., 1998; M urakam i and Okayam a, 1995).
C h k lp is prim arily involved in the damage checkpoint (W alworth et al., 1993) but
is activated by HU if cd slp is absent (Lindsay et al., 1998). It has been proposed
that c d slp prevents the occurrence of DNA dam age structures during S phase
arrest.
C d slp is thought to bind and phosphorylate w eelp in response to HU, however
the checkpoint is still m aintained in a weel m utant. M iklp has also been shown to
60
Chapter 2 C haracterization of cdc7 8 d o m ains
accumulate in response to HU but not in a cdslA strain, thus both tyrosine kinases
contribute to the inhibitory phosphorylation of cdc2p in a c d slp dependent
m anner (Boddy et al., 1998; Christensen et al., 2000). Both cd slp and chklp have
been show n to phosphorylate cdc25p (Furnari et al., 1999; Zeng et al., 1998) and
chklp is thought to bind cdc25p (Boddy et al., 1998). This phosphorylation occurs
at several sites, the major one being Serine 99, and prom otes binding to the 14-3-3
protein rad24p (Furnari et al., 1999; Zeng et al., 1998). Binding leads to nuclear
exclusion of cdc25p as the complex is actively transported from the nucleus by the
exportin crm lp (Lopez-Girona et al., 1999; Zeng and Piwnica-W orms, 1999). This
removes cdc25p from the vicinity of its target, cdc2p. Cdc2-3w and cdc2-3w cdc25A
cells are not hypersensitive to dam age suggesting th at they are checkpoint
proficient and consequently that there is a cdc25p independent signalling pathway.
The checkpoint is irradicated if both w eelp and cdc25p are inactivated and thus
acts phenotypically as a chklA strain. This suggests that the cdc25p independent
pathw ay acts through w eelp. W eelp has been show n to be hyperphosphorylated
on overexpression of chklp or UV irradiation and w eel protein levels have also
been shown to increase (O'Connell et al., 1997; Raleigh and O ’Connell, 2000).
Given these results, it w ould be interesting to see w hether ch k lp or c d slp is
activated by cdcl8p induced re-replication. As c d slp is not activated during a
norm al S phase (Lindsay et al., 1998) it is possible that re-replication could be
sensed as dam age and lead to activation of chklp. Alternatively, cd slp may not be
activated during a norm al S phase which is completed w ithin about 10 m inutes
(Bostock, 1970). C d slp could therefore be activated in cells held in S phase for a
longer period of time, either through addition of HU, inactivation of cdc22p, the
small subunit of ribonucleotide reductase, or re-replication. It w ould also be
informative to discover whether re-replication induced by inhibition of the mitotic
kinase, th rough overexpression of ru m lp or inactivation of cdcl3p, w ould
stimulate the same checkpoint pathw ay as overexpression of cdcl8p. In the former
case cells are thought to undergo a normal S phase followed by exit from G2 to G l,
thus bypassing mitosis. The latter however, can be thought of as an intra-S re­
replication w ith cells never exiting DNA replication. It is therefore possible that
overexpression of cdcl8 w ould generate replication structures recognised as
dam age rather than ongoing replication. The fact that both the re-replication and
61
Chapter 2 C haracterization of c d c 78 d o m ains
damage checkpoints are m aintained in a cdc2-3w strain, as previously m entioned,
b u t the same cells cut on addition of HU m ay provide a further clue that re­
replication could be recognised as damage rather than incomplete replication.
The m odel in Fig. 2.12 sum m arises the m ain conclusions. The N -term inus of
cdclSp binds to cdc2p and inhibits m itosis in an unphysiological m anner as a
result of overexpression. The C -term inus of cdclSp is crucial for both the
replication function of cdclSp and for the checkpoint that acts through cut5 as well
as the rad and hus genes. CdclSp also requires an intact NTP binding motif for both
of these activities. The checkpoint pathw ay induced by high levels of the Cterm inus of cdclSp exerts its effect through a pathw ay that requires the activity of
the w e e lp and m ik lp tyrosine kinases, resulting in an inactive tyrosine-15
phosphorylated cdc2p/cdcl3p complex.
62
cdclS-wtp
cdcl8-l-141p
cdcl8-150-577p
cdc 18-150-577 (T374A)p
cdcl8-NTPp
Figure 2.1
cdcl8 constructs
W ildtype cdclS p contains a putative NTP binding m otif and six cdc2p consensus
phosphorylation sites, cdc 18-1-14Ip possesses the first 141 amino acids. cdcl8-150-577p
consists of amino acids 150-577 as does cdc 18-150-577 (T374A)p, however this has an
additional mutation from T to A at amino acid 374 in the sixth cdc2p phosphorylation site.
cdcl8-NTPp consists of the full length protein with the NTP binding motif mutated from
GK to AA at am ino acids 204-205. The black circles represent cdc2p consensus
phosphorylation sites, the black rectangle depicts the NTP binding m otif and the grey
rectangle represents the mutated NTP binding motif.
B
pRep3X
pRep3X
f
cdcl8-w tp
■
cdcl8-w tp
S
100(
Q
c d c l8 -l-1 4 1 p
^
cdcI8-150-577p
c d c l8 -l-1 4 1 p
CD
J
cdc 18-150-5772
100 (
6 cdc 18-150-577 (T374A )p
6
S
c d c !8-150-577 (T374A)p
1000
cdcl8-N T P p
8
cdcl8-N T P p
a
S
100(
248
DNA content (C)
Forward Scatter
Figure 2.2
Overproduction of the C-terminus of cdclSp is required and sufficient for DNA re­
replication
Wildtype cells transformed with the cdc 18 mutants and a vector control were grown at
32°C for 20 hours after induction of the promoter. (A) Cells were fixed and stained with
DAPI. Bar 15 pim. (B) DNA content and cell length was analyzed by FACS.
I
kDa
î
97.4 66 —
4 6 -
Cl.
06
I
kDa
}
66 —
4 6 -
1 i
anti-C -cdcl8p
30-
302 1 .5 1 4 .3 -
21.5 1 4 .3 anti-a-tubulin
}
anti-cdclS p
anti-a-tubulin
Figure 2.2 C and D
Protein levels were determined by Western blotting. 25 pig of protein was loaded per lane.
Blots were probed with anti-cdcl8p C-terminus antibody (C top panel), anti-cdcl8p
antibody (D top panel) and anti-a-tubulin antibody as a loading control (C and D bottom
panels).
cdcl8-w tp
cdcl8-150-577p
0
11
12
13
14
15
16
18
20
hours after induction
B
^
100 -
S
75 -
«
50 -
r~ |
11 hours
19 hours
Figure 2.3
cdclSp induced re-repiication does not require depression of the cdc2p/cdcl3p mitotic
kinase
(A) Histone kinase assays were performed on cdclSp immunoprecipitates from wildtype
cell extracts overproducing cdcl8-w tp and cdcl8-150-577p. (B) Histone kinase assays
were also performed from wildtype extracts overproducing cdcl8-wtp, cdc 18-1-14Ip and
cdcl8-150-577p. The data was quantified at the 11 hour and 19 hour timepoint, using NIH
image.
H A c d c l8 -l-1 4 1 p H A cdcl8-150-577p
HA cdcl8-150-577p
a-H A
H A c d c l8 -l-1 4 1 p
a -cdc2p
1
2
3
4
5
6
Figure 2.4
cdcl8-150-577p does not interact with cdc2p directly when overproduced
Western blots were performed on suclp or BSA control bead precipitates from wild type
cells overproducing HA cdcl8-l-141p and HA cdcl8-150-577p from the nmt41 promoter
for 16 hours. 5 pg of total extract and precipitates from 100 pg of extract were run. Blots
were probed with anti-HA 12CA5 antibody (top panel) and anti-cdc2p PSTAIR antibody
(bottom panel).
a.
f
kDa
06
06
66 —
46 —
a n ti-ru m lp
30 —
a nti-a-tubulin
Figure 2.5
The C-terminus of cdclSp does not induce increased levels of rumlp when
overproduced
Protein levels were determined by Western blots performed from extracts of wild type
cells overproducing cdcl8-w tp, cd cl8 -l-1 4 1 p and cdcl8-150-577p, 20 hours after
induction of the promoter. Blots were probed with anti-rumlp antibody (top panel) and
anti-a-tubulin antibody as a loading control (bottom panel).
B
pRep3X
pRep3X
c dcl8-w tp
c dcl8-w t 3
c d c l8 -l-1 4 1 p
c d c l8 -l-1 4 1 p
cd cl8 -1 5 0-577p
cdcl8-150-577p
cd c 18-150-577 (T374A)p
cdc 18-150-577 (T374A)p
cdcl8-N T P p
cdcl8-N T P p
C
2 4 8
DNA content (C)
Forward Scatter
2 4 8
DNA content (C)
Forward Scatter
Figure 2.6
cdclSp induced re-replication can occur in the absence of rumlp
W ildtype cells (A) and ru m lA cells (B) were transform ed with the c d c l8
mutants and a vector control and were grown at 32°C for 20 hours after the
induction of the promoter. DNA content and cell length were analysed by FACS.
□ wt
□ radl
80
80
60
60
40
40
20'
20
!
o rad3
DD
1ii e i
ir
o
rad9
f ■husl
radl 7
80
80
80
40
I
ii
^ 2 >' -5
1
ill
" A
B
pRep3X
>
\ \
cdcl8-w tp
cd cl8 -l-1 4 1 p
f
cdcl8-150-577p
c d c l8 -150-577 (T374A)p
cdcl8-N T Pp
Figure 2.7
The cdclSp C-terminus is unable to block mitosis when overproduced in a checkpoint
deficient background
Wildtype cells and checkpoint deficient strains transformed with a vector control and the
cdcJS constructs were grown at 32°C for 20 hours after induction of the promoter. (A)
300 cells were scored for elongation. (B) radl-1 cells were fixed and stained with DAPI.
Bar 15 //m.
I
&
_
g
^
00
00
06
kD a
97.4
66
}
-
anti-C -cd cl8 p
46 —
30 21.5
14.3
an ti-cd cl8 p
anti-a-tubulin
2
3
anti-a-tubulin
4
Figure 2.7 C and D
Protein levels were determined by Western blotting in radl-1 cell extracts. 25 fxg of protein
was loaded per lane. Blots were probed with anti-cdcl8p C-terminus antibody (C top
panel), anti-cdcl8p antibody (D top panel) and anti-a-tubulin antibody as a loading control
(C and D bottom panel).
B
+T
+T
12hr-T
12hr-T
14hr-T
14hr-T
17hr-T
17hr-T
20hr-T
20hr-T
IS
8
g
2 4 8
DNA content (C)
u
Forward Scatter
2 4 8
DNA content (C)
Forward Scatter
Figure 2.8
An intact NTP site is required both to induce re-replication and to initiate the
checkpoint
Wildtype cells overproducing cdcl8-150-577p (A) and cdc 18-150-577-NTPp (B)
were grown for 20 hours after the induction of the promoter. DNA content and cell
length were analysed by FACS.
□ cut5 25°C
□ cut5 36°C
y
I
?
1
06
i.
o.
s
1 3
o6
1
b
ë
00
Figure 2.9
The C-terminus of cdclSp also requires cutSp to prevent mitosis
CUÎ5-580 mutant cells were transformed with the cdcl8 constructs and a vector control
and were grown at 25°C for 20 hours after induction of the promoter. The cultures were
then split and half were shifted to the restrictive temperature of 36°C. They were allowed
to grow for a further 3 generations (12 hours at 25°C and 7 hours plus 1 hour for temp­
erature shift recovery at 36°C) before 300 cells were scored for elongation.
B
□ cdc2-3w
80
60-
I
40-
I
t
I
I ‘I
I
1
1
I
I
1
3
I
1
I %
“ g
oè
cdc2-3w
pRep3X
cdc2-3w cdc25S.
cdc2-3w
c d c l8 -w tp
Figure 2.10
The checkpoint induced by cdclSp overproduction does not act solely through the
cdc25p phosphatase
cdc2-3w cells were transformed with the cdcl8 constructs and a vector control. (A) cdc23w cells were grown at 32°C for 20 hours after the induction of the promoter and 300 cells
were scored for elongation. (B) cdc2-3w cells expressing a vector control, and overproducing
cdc 18-wtp, 20 hours after induction of the promoter at 32®C and cdc2-3w cdc25A cells
were measured for cell length and the mean was calculated. (C) Cells were fixed and
stained with DAPI. Bar 15pm.
B
%
40
H
20
□
wee 1-50 mikJA 25°C
■
wee 1-50 miklA 36°C
a
weeY-JO m/A:/A 25°C
wee I-50 mikl A 36°C
c d c l8 -w tp
c d c l8 -w tp
■
weel-50 mikl A 25°C
weel-50 mikl A 36°C
c d cl8 -1 5 0 -5 7 7 p
c d cl8 -1 5 0 -5 7 7 p
Figure 2.11
The weelp/miklp tyrosine kinases are required for the DNA replication checkpoint
that acts through cdclSp
weel-50 mikl A cells were transformed with the cdcl8 mutants and a vector control. (A)
weel-50 mikl A cells were grown at 25°C for 20 hours following induction of the promoter.
The cultures were then split and half were shifted to the restrictive temperature of 36°C.
Cells were grown for 3 generations then 300 were scored for elongation for each point.
(B) weel-50 mikl A cells overproducing cdcl8-wtp at 25°C (a) and 36°C (b), and cdcl8150-577p at 25°C (c) and 36°C (d) were also fixed and stained with DAPI. Bar 15 //m.
cdcISp N-terminus
rad/ hus
checkpoint
independent
M phase
S phase
À
M cdc2p/cdcl3p
cdcISp C-terminus
T
A
w e elp /m ik lp
rad/hus
checkpoint dependent
Figure 2.12
Model for the role of cdcISp in the DNA replication checkpoint
The C-terminus of cdcISp acts upstream of the rad and hus genes in the DNA replication
checkpoint. The pathway requires the function of the wee Ip and miklp tyrosine kinases
to inhibit the cdc2p/cdcl3p kinase and hence mitosis. The N-terminus of cdcISp can
prevent mitosis independently of the rad and hus checkpoint genes, probably via a direct
interaction with cdc2p.
Chapter 3
A functional analysis of cdc18 homologues in
Schizosaccharomyces pombe
Introduction
Cdcl8 has hom ologues in Saccharomyces cerevisiae, Xenopus laevis and hum ans. In
this chapter I investigated their ability to com plem ent the cdcl8-K46 tem perature
sensitive m utant. I also determ ined w hether they, like cdcl8, are able to induce re­
replication w hen overexpressed, either in the presence or absence of w ildtype
cdcISp function. The effect of co-expression of cdtl w ith cdcl8 and its hom ologues
w as also exam ined in both the com plem entation and re-replication assay as it is
know n to act co-operatively w ith cdcISp to prom ote replication.
C h a p te r 3 A nalysis of
cdc18 hom ologues
Results
3.1 Cdcl8 has homologues in Saccharomyces cerevisiae,
Xenopus laevis and Homo sapiens
CdclS has been found to have homologues in several other organisms that are both
structurally and functionally similar. The gene products are called Cdc6p in other
organisms and to avoid confusion they will be designated ScCdcbp {Saccharomyces
cerevisiae), XlCdc6p
{Xenopus
laevis) and H sC dc6p {Homo
sapiens). The
Saccharomyces cerevisiae gene was isolated by com plem entation of a tem perature
sensitive cdc6 m utant from a genomic library (Lisziewicz et al., 1988; Zhou et al.,
1989). The Xenopus laevis homologue was cloned using degenerate PCR primers,
based on sequence conserved betw een the budding and fission yeast genes, to
amplify a segment of its cDNA. This PCR product was then used to isolate a full
length cDNA (Coleman et al., 1996). A sim ilar m ethod was used to clone the
hum an gene (Sanders Williams et al., 1997). This was also identified independently
in a two-hybrid screen as a PCNA interacting protein (Saha et al., 1998). Recently a
mouse homologue has also been identified (Berger et al., 1999).
The proteins share approximately 30% identity (Fig. 3.1) and have several motifs in
common. They all possess a putative nuclear localization signal and several
consensus sites for CDK phosphorylation which indicates that their localization
and activity could be regulated in a similar m anner. The presence of both a NTP
binding and hydrolysis motif in all homologues could indicate a shared function
(Coleman et al., 1996; Kelly et al., 1993; Lisziewicz et al., 1988; Saha et al., 1998;
Sanders Williams et al., 1997; Zhou et al., 1989). In fact C d c l8 /6 p appears to have a
role in prom oting DNA replication in all organisms. A m ore precise function has
been found in yeast and Xenopus as C d c l8 /6 p can specifically load the MCM
family of proteins onto chrom atin thus establishing the pre-replicative complex
(Aparicio et al., 1997; Colem an et al., 1996; D onovan et al., 1997; Liang and
Stillman, 1997; Nishitani et al., 2000; Tanaka et al., 1997). W ork w ith a mammalian
cell-free system demonstrated a similar dependence on Cdc6p for MCM loading in
hum ans (Stoeber et al., 1998).
78
Chapter 3 A nalysis of
cdc18 hom ologues
As the cdcl8 homologues appear to share sequence identity, functional motifs and
perform a similar cell cycle role I decided to examine w hether the homologues
could functionally substitute for cdcl8 in fission yeast. As I was aware that the cdtl
protein acted cooperatively w ith cdcISp to prom ote DNA replication in fission
yeast (N ishitani et ah, 2000), I decided to co-express c d t l w ith the cdcl8
homologues in the assay for complementation to prom ote the chance of a rescued
phenotype.
3.2 ScCDC6 and XlCdcG initially appeared to complement
cdcl8-K46
As I was unaw are of the effect the cdcl8 homologues m ay have w hen expressed in
fission yeast I w anted to be able to control their expression. I therefore used the
nm t thiamine regulatable prom oter (Maundrell, 1990). M utations in the TATA box
of the nm t prom oter have been m ade which alter the levels of transcript produced
but not the thiam ine repressibility. This allows a range of prom oter activity with
nm t81 producing expression levels approxim ately 12 tim es lower than nm t41
which in turn expresses at about 6 times less than n m tl (Basi et al., 1993). I knew
that nm t81-cdcl8 rescued the cdcl8-K46 m u tan t w hen expressed from the
m ulticopy plasm id Rep81 and that high levels of expression under the control of
the n m tl prom oter resulted in lethality caused by re-replication of the DNA
(Nishitani and Nurse, 1995). I therefore decided to clone the cdcl8 homologues into
the vectors containing the two lower strength prom oters, Rep81 and Rep41. Cdtl
was cloned into both Rep42 and Rep82, vectors w ith the same prom oter as Rep41
and Rep81 b u t having the fission yeast ura4 gene as a m arker rather than the
budding yeast LEU2 gene.
The strategy used to investigate whether the cdcl8 hom ologues can complement
the cdcl8-K46 m utant is outlined in Figure 3.2. The cdcl8 gene and its homologues
were transform ed into the cdcl8-K46 m utant, either w ith or w ithout the cdtl gene.
C dtl was also transform ed alone, as were the vectors on their ow n as a negative
control. The cdcl8-K46 strain also contained the leul-32 and ura4-D18 m utations so
cells containing specific plasm id combinations w ere selected by their ability to
grow on different media. Cells transform ed w ith both a Rep41/81 and Rep42/82
79
Chapter 3 A nalysis of
cdc18 hom ologues
vector were grown on minimal media containing thiamine, so both plasmids m ust
be present to com plem ent the auxotrophy b u t gene expression is repressed.
Minimal m edia supplem ented w ith uracil and thiam ine selected for a Rep41/81
vector and minimal media supplem ented w ith leucine and thiam ine selected for a
Rep42/82 vector. Transformants were grown at 25°C, the perm issive tem perature
for cdcl8-K46. Colonies formed after approxim ately four days at which stage cells
were replica plated to minimal media containing the same supplem ents as before
but either in the absence or presence of thiamine. This allowed the prom oter to be
expressed or repressed to provide a greater range of expression levels. The nmt41
prom oter is expressed approximately 200 fold less in the presence of thiamine than
the absence, thus producing a lower expression level than from nm t81 in the
absence of thiamine (Basi et al., 1993).
The cells were incubated at 25°C for a further 24 hours before they were replica
plated again, this time to media containing both leucine and uracil, thiam ine if
present before and Phloxin B. Cells were incubated at 36°C overnight before the
plates were visually screened for colonies that were able to complement the cdcl8K46 m utant at its restrictive tem perature of 36°C. Phloxin B helped to discriminate
betw een d ividing cells and those that w ere dying due to an inability to
complem ent the cdcl8-K46 defect as dying cells stain a darker pink. To make the
screening easier the media was fully supplem ented so that both the cells that do
not com plem ent and cells that have lost one of the plasm ids will have a cdc
phenotype.
The visual screen initially produced several com plem enting combinations w hen
thiam ine was absent from the plates. Both Rep41-cdcl8 and Rep81-cdcl8 could
complement the cdcl8-K46 m utation. They therefore acted as a positive control for
the experiment. Rep41-X1CDC6 and Rep42-cdtl together appeared to complement
the defect well and Rep81-ScCDC6 alone complem ented less well. The latter cells
w ere longer and the population w as m ore heterogeneous b u t they were still
dividing as judged by the presence of septa. Cells from both these transform ants
were patched from the original transformation plates to allow further analysis.
80
Chapter 3 Analysis of
cdc18 hom ologues
3.3 Ability of Rep81-ScCDC6 and Rep41-XICDC6+Rep42cdtl to form colonies at 36°C
In order to assess further the ability of the hom ologues to complem ent the cdcl8K46 m utant, their ability to allow formation of colonies at 36°C was assayed (Fig.
3.2). Rep81-ScCDC6 cells were grow n at 25°C in selective m edia as were Rep81
cells as a negative control and Rep81-cdcl8 cells as a positive control. Rep41XlCDC6+Rep42-cdtl cells were also grown in selective m edia at 25°C alongside
Rep41+Rep42, and Rep41-cdcl8+Rep42 as controls. Cells w ere counted using a
haemocytometer and 1000 cells were plated from each culture onto two plates. One
was placed at 25°C and the other at 36°C. The num ber of colonies formed at both
tem peratures was m onitored over a period of several days and the num ber after 7
days is presented in Table 3.1.
Neither the Rep81 or Rep41+Rep42 containing cells were able to prom ote colony
form ation at 36°C. Only 2% and 5%, respectively, of the colonies formed at 25°C
also form ed at 36°C. Expression of both Rep81-cdcl8 and Rep41-cdcl8+Rep42
perm itted colony formation at 36°C, 70% and 77% respectively of the num ber of
colonies grow ing at 25°C. As these plasm id combinations acted as negative and
positive controls it enabled us to determ ine the significance of the num ber of
colonies form ed at 36°C w hen Rep81-ScCDC6 and Rep41XlCDC6 and Rep42-cdtl
were expressed. Rep81-ScCDC6 and Rep41-XlCDC6+Rep42-cdtl transform ants
also formed colonies at 36°C, 54% and 62% respectively of the num ber of colonies
grow ing at 25°C. This analysis indicated that both Rep81-ScCDC6 and Rep41X1CDC6 w hen co-expressed w ith Rep42-cdtl w ere able to substitute for cdcl8
function.
The total num ber of colonies form ed w hen both Rep41 and Rep42, and Rep41cdcl8 and Rep42 were expressed was 5-8 fold lower than expected. However this
did not affect the com parison betw een the num ber of colonies form ed at the
perm issive and restrictive tem perature as the percentage was similar between the
two experim ents using the negative controls (Rep81 and Rep41+Rep42) and the
positive controls (Rep81-cdcl8 and Rep41-cdcl8+Rep42).
81
%
Number of colonies formed
colonies
at specified temperature
formed 36°C
cdcl8-K 46 cells transformed
with cdc 18 and homologues
25^'C
36''C
colonies
formed 25°C
Rep81
1028
23
2
Rep81-cdcl8
992
697
70
Rep81-ScCDC6
968
523
54
Rep41 and Rep42
218
11
5
Rep41-cdcl8 and Rep42
123
95
77
Rep41-X1CDC6 and Rep42-cdtl
1132
707
62
Table 3.1
Rep81-ScCDC6 and Rep41-XlCDC6+Rep42-cdtl appeared to complement cdcl8-
K46 when the ability to form colonies was assayed
cdcl8-K46 cells transformed with cdc 18 and homologues that initially appeared to
complement at 36°C were assayed by their ability to form colonies at 25°C and 36°C.
1000 cells were plated and the number of colonies formed after 7 days was counted.
Chapter 3 A nalysis of
cdc18 hom ologues
In order to assess whether the homologues could complement the cdcl8-K46 defect
as well as cdcl8, cells w ere picked from the colonies and DAPI staining was
perform ed (Fig. 3.3). Rep81-cdcl8 appeared to grow equally well at 25°C and 36°C
as judged by cell and nuclear m orphology (Fig. 3.3 A, a and c). However, Rep81ScCDC6 looked less healthy at 36°C (Fig. 3.3 A, d). There were still growing and
dividing cells w hen Rep81-ScCDC6 was expressed b u t there w ere also some
elongated cells containing an abnorm al nucleus. This is consistent w ith the initial
result that Rep81-ScCDC6 com plem ented less well than Rep81-cdcl8. Rep41X1CDC6 and Rep42-cdtl however, appeared to grow as well at 36°C as Rep41cdcl8 and Rep42 did at both 25°C and 36°C (Fig. 3.3 B), indicating that it
complements effectively.
3.4 Ability of Rep81-ScCDC6 and Rep41-X1CDC6+Rep42cdtl to grow in liquid media at 36°C
A more stringent test for complementation was also used. In this, cells were grown
to exponential phase in liquid m inimal m edia at 25°C. C ultures were then split.
Half continued to grow at 25°C whereas the other half were shifted to 36°C, the
restrictive tem perature for the cdcl8-K46 m u tan t (Fig. 3.2). Their ability to
complement was assayed by cell num ber increase over a 10 hour period (Fig. 3.4 A
and 3.5 A) and by their cellular m orphology (Fig. 3.4 B and 3.5 B). Rep81, Rep81cdcl8 and Rep81-ScCDC6 were all able to grow w ith similar kinetics at 25°C (Fig.
3.4 A, a). At 36°C Rep81-cdcl8 continued to grow exponentially but cell num ber
stopped increasing after 5 hours w hen both Rep81 and Rep81-ScCDC6 were
expressed (Fig. 3.4 A, b). Cells expressing Rep81 and Rep81-ScCDC6 at 36°C have a
distinct cellular m orphology w hen stained w ith DAPI (Fig. 3.4 B, d and f), cells are
elongated, often have several septa and have abnorm al nuclei. This indicates that
Rep81-ScCDC6 is unable to complement the cdcl8-K46 defect w hen assayed in this
way. Rep41-X1CDC6 and Rep42-cdtl behaved similarly to Rep41 and Rep42, and
consequently to Rep81-ScCDC6, w hen the ability to complement in liquid media at
36°C was tested. Cells stopped growing after approxim ately 5 hours (Fig. 3.5 A b),
and DAPI stained cells had the same abnorm al m orphology as described above
(Fig. 3.5 B d and f). I diluted the cultures in pre-w arm ed m edia and grew them
overnight at the same tem perature to determ ine w hether the homologues could
83
Chapter 3 A nalysis of
cdc18 hom ologues
complement if incubated for a longer period of time. There was no further growth
w hen Rep81, Rep41, Rep81-ScCDC6 or Rep41-CdCDC6 and Rep42-cdtl were
expressed. I therefore conclude that Rep81-ScCDC6 and Rep41-X1CDC6 expressed
w ith Rep42-cdtl are unable to complement cdcl8-K46 at the restrictive tem perature
w hen the ability to grow in liquid media is assayed.
In order to verify this result I attem pted to duplicate it. However, despite repeating
the transform ation followed by the visual screen at the restrictive tem perature
several times, I was unable to identify Rep81-ScCDC6 and Rep41-X1CDC6+Rep42c d tl as com plem enting the cdcl8-K46 m utant. Only Rep81-cdcl8 and Rep41cdcl8+Rep42 w ere isolated as having the ability to complement. I varied several
factors w hen repeating the experiment in order to duplicate m y first result. Several
transform ation protocols w ere used, including the lithium acetate procedure,
electroporation and protoplasting. I also used different plasm id concentrations as
it was possible that the ability to complement was very sensitive to precise protein
levels and perhaps the balance between the cdcl8 homologue and cdtl. I therefore
kept the am ount of cdcl8 or its homologue constant at Ipg and varied the cdtl level
from 0.3pg, to Ip g , to 3pg per transform ation. H ow ever none of these changes
affected the outcome which was that I was unable to repeat the initial results. The
possible reasons for this will be discussed later.
3.5 Overexpression of ScCDC6 induces re-replication to a
similar level as cdcl8
I decided to assess the functional sim ilarity of cdcl8 and its hom ologues by an
additional m ethod; the ability to induce re-replication w hen overexpressed. Cdcl8
and the three homologues were expressed from the nmt41 prom oter, w ith either
Rep42-cdtl (Fig. 3.6 A) or Rep82-cdtl (Fig. 3.6 B) as c d tlp is know n to act
cooperatively w ith c d cl 8 p in a re-replication assay (Nishitani et al., 2000). Cells
were grown to exponential phase in thiamine containing media. The thiamine was
then washed out to induce expression from the nm t prom oters. Cells were grown
for 20 hours before being fixed and analysed by FACS. I discovered that cdtl alone
did not prom ote re-replication. The hum an and Xenopus hom ologues were also
unable to prom ote re-replication w hen co-overexpressed w ith c d tl. These
84
Chapter 3 A nalysis of
cdc18 hom ologues
constructs w ere also unable to invoke a checkpoint as the forw ard scatter
dem onstrates that cell length did not increase. However, both Rep41-cdcl8 and
Rep41-ScCDC6 induced re-replication to similar extents w hen co-overexpressed
with cdtl, and could maintain a block over mitosis as judged by the elongated cells
in the forward scatter.
There w ere two possible explanations for ScCdc 6 p being able to induce re­
replication. The first was that ScCdc 6 p had an intrinsic ability to prom ote re­
replication w hen co-expressed w ith cd tlp . The alternate explanation was that
overproduction of ScCdc 6 p allow ed interaction w ith and saturation of the
proteolytic system, thus allowing accumulation of the endogenous cd cl 8 p. The re­
replication w ould therefore be induced by the endogenous cd cl 8 p.
3.6 ScCdc6p induced re-replication requires cdcISp function
but does not increase its endogenous protein levels
In order to differentiate between these alternatives I expressed Rep41-cdcl8 and
Rep41-ScCDC6 w ith either Rep42, Rep42-cdtl or Rep82-cdtl in a cdcl8-K46 m utant
background. Cells were grown at the permissive tem perature of 25°C for 18 hours
following derepression of the prom oter by thiam ine wash-out. Cell cultures were
split and half was shifted to the restrictive tem perature of 36°C. Cells were grown
for a further 2.5 generations which am ounts to 10 hours at 25°C and 5 hours 50
m inutes plus 1 hour for tem perature shift recovery at 36°C. Cells were then
analysed by FACS (Fig. 3.7 A), DAPI staining (Fig. 3.7 B) and W estern blotting (Fig.
3.7 C and D). I show ed that Rep41-cdcl8 is able to prom ote re-replication to a
sim ilar extent at both 25°C and 36°C. H ow ever, although Rep41-ScCDC6 can
prom ote re-replication at 25°C, the re-replication is abolished at 36°C. This
suggests that the endogenous c d c l 8 p provides an essential function for this
ScCdcbp induced re-replication. However, cd cl 8 p levels do not accumulate when
Rep41-ScCDC6 is overexpressed (Fig. 3.7 D upper panel) and in fact the protein
level rem ains sim ilar to w ildtype (Fig. 3.7 C lanes 1 and 2). W ildtype c d cl 8 p
function is therefore required for the re-replication induced w hen ScCdc6 p is co­
overproduced w ith cd tlp but this re-replication is not caused by an increase in the
endogenous protein levels.
85
Chapter 3 Analysis of
cdc18 hom ologues
D iscussion
Proteins that are both structurally and functionally homologous to cdcl8 have been
identified in several organism s. In experim ents to exam ine the ability of
hom ologues to com plem ent the cdcl8-K46 tem p eratu re sensitive m utant I
identified two situations in which a cdcl8 hom ologue was able to complement the
cell cycle defect. The first was w hen the Saccharomyces cerevisiae hom ologue,
ScCDCô, was expressed at low levels using the nmt81 prom oter. The second was
w hen the Xenopus laevis homologue, XICDC6, was co-expressed w ith cdtl using the
m edium strength promoters in the Rep41 and Rep42 vectors respectively (Table 3.1
and Fig. 3.3). H ow ever, I have been unable to repeat this experim ent which
suggests that complementation is very sensitive to specific conditions.
W ork from several different labs has given conflicting results about the ability of
cdcl8 hom ologues to functionally rescue cdcl8 m utants. It has been reported that
ScCDC6 is unable to functionally substitute for cdcl8 (Dutta and Bell, 1997; Wolf et
al., 1999a). H ow ever another recent stu d y states th at ScCDCô is able to
complement both a cdcl8-K46 m utant and a cdcl8A strain (Sanchez et al., 1999).
One possibility for the discrepancies could be the protein level of the cdcl8
homologues. It is know n that overexpression of cdcl8 results in re-replication of
the DNA and is lethal to the cells. For this reason only the m edium and low level
prom oters w ere used in our experiments. However, the w ork by Sanchez et al.
states that the n m tl prom oter was used and that high levels of ScCdc 6 p are
required to achieve complementation. The problem w ith trying to compare these
results is that different ScCDCô cDNAs m ay have been used which may affect
expression level even from the same promoter. An example of how small changes
in the cDNA sequence can have dramatic consequences for gene expression is that
of the original cdcl8 cDNA isolated (Kelly et al., 1993) com pared to one isolated
later that contained an extra 89 nucleotides upstream from the start site (Nishitani
and Nurse, 1995). This additional sequence was sufficient to allow re-replication
w hen expressed using the n m tl promoter. An alternative explanation for why the
full strength n m tl prom oter was required for com plem entation of cdcl8 could be
86
(hlûo
li^ L
9
H J A c U v ^ i^ J ^ U
(d ill
C c ( jL l^ ') ( 4 t
ijy jü
['S
f'XdGiVÜ (/(litOf
6
(jA ^d
a)U ^
o it ^
Chapter 3 A nalysis of
cdc18 hom ologues
because an integrated copy of nmtl:ScCDC6 was used, whereas I used a multicopy
plasm id. Several lower level expressing plasm ids could allow the sam e level of
protein production as can be achieved from one integrated higher expression level
plasm id. The only w ay to come to a firm conclusion about this w ould be to tag
both constructs and directly compare the protein expression levels w ithin a cell
population that is either able or unable to complement the cdcl8 gene. The cDNAs
could also be exchanged and the experiments repeated to see if the same results are
obtained. At present it is impossible to conclude whether the ScCDCô and XICDC6
gene products are able to fully complement the cdcl8-K46 m utant.
Interestingly, the presence of c d tlp w as of no benefit w hen looking for
complem entation w ith ScCDCô, an organism that does not appear to possess a cdtl
homologue. However, even though XlCDCô was only found to complem ent once,
it only did so w hen co-expressed w ith cdtl. As a hom ologue of the fission yeast
cd tl gene has recently been identified in Xenopus laevis (Maiorano et al., 2000) it
w ould be interesting to see w hether co-expression of the Xenopus laevis cdcl8 and
cdtl hom ologues w ould result in complementation of the cdcl8-K4ô m utation in a
m ore consistent m anner. Furtherm ore, as the hum an cdcl8 hom ologue was also
unable to complement, it m ay be interesting to repeat the experiment in the future
if a hum an cdtl homologue is cloned. The sequence of a 5' truncated hum an cDNA
encoding a putative cdtl homologue can be found in the databases.
The m echanism by which ScCdc 6 p is able to prom ote re-replication has also been
som ew hat controversial (Sanchez et al., 1999; Wolf et al., 1999a). Wolf et al. state
that ScCdc 6 p induced re-replication requires only am ino acids 2-73. This part of
the protein is sufficient to allow an interaction w ith both cdc 2 p and pop 2 p, thus
overexpression results in titration of the proteolytic m achinery that degrades
ru m lp and cdcISp, allow ing both proteins to accum ulate. H ow ever, the re­
replication still occurs in a rum lA strain and the cdcISp levels appear to increase
only by about 2 fold w hen the N-term inus of ScCDCô is overexpressed. This level
of increase w ould not be inconsistent with our results (Fig. 3.7 C lane 1 and D lane
1) w hen ScCDCô is overexpressed. It seems unlikely that a doubling of cdcISp
caused by ScCDCô overexpression could produce the same level of re-replication
as that found w hen cdcl8 is overexpressed (Fig. 3.7 C lane 3). Wolf et al. discuss
87
Chapter 3 A nalysis of
cdc18 hom ologues
this point, stating that both popl rum l and pop! rum l double m utants are able to
m aintain a norm al genome ploidy despite levels of cdcISp as high as those in cells
overexpressing ScCdc 6 p. They therefore conclude that accum ulation of ru m lp
appears to be the key event to perm it re-replication. As re-replication can still
occur in a rum lA strain, they suggest that in this case, re-replication could be due
to sequestration of cdc 2 p by cdcISp or ScCdc 6 p, preventing the kinase from
phosphorylating substrates required for inhibiting re-replication. Although I can
not rule out this possibility, I w ould propose a more direct role for ScCdc 6 p in
prom oting re-replication as I have show n in m y work that overexpressing the Nterm inus of cdcISp does not result in re-replication, despite being able to inhibit
the cdc2p/cdcl3p kinase (Fig. 2.3), bind to cdc2p (Fig. 2.4) and allow accumulation
of ru m lp (Fig. 2.5).
In com paring the work of Sanchez et al. w ith that of m y ow n the question of
expression levels is, once again, param ount. In order to achieve significant re­
replication, an integrated nmtl:5cC0Cb strain had to also possess a m ulticopy vector
carrying the transcription factor n tfl, known to regulate expression from the nm tl
prom oter (Tang et al., 1994). This increased ScCdc 6 p levels sufficiently to allow re­
replication. The fact that the nmtlScCOCb strain is unable to re-replicate alone is
presum ably related to the fact that ScCOib is integrated and also perhaps that they
could be using a different cDNA, as discussed previously.
The m ain difference between my results and those of Sanchez et al. arises when the
ability of ScCdc 6 p to induce re-replication w hen the endogenous cdcl8 function is
com prom ised is examined. Sanchez et al. examined this in both a cdcl8-K46 and
cdcl8A background and found in both cases that re-replication occurred to the
same extent as w hen cdcISp was present. I found that re-replication induced by
overexpression of ScCDCô was compromised in a cdcl8-K46 m utant at 36°C (Fig.
3.7). H ow ever, the experim ental system s used w ere different. I used lower
expression levels of ScCDCS but maximised the ability to induce re-replication by
co-expressing cdtl. It is possible that ScCdc 6 p is less effective at interacting with a
fission yeast protein or perform ing an essential function and therefore when it is
expressed at relatively low levels, as in m y experim ents, c d c l 8 p is required to
carry o ut that function. H ow ever, increased expression of ScCdc 6 p could
Chapter 3 A nalysis of
cdc18 hom ologues
compensate for the fact that it functioned less effectively and cd cl 8 p would not be
required. A possible explanation for this could be related to the fact that cdcISp
interacts w ith c d tlp (Nishitani et al., 2000). There is no cdtl gene in budding yeast
so ScCdc 6 p m ay interact more weakly w ith cdtlp. CdcISp could therefore promote
the interaction to allow re-replication when ScCdc6 p is expressed at a lower level.
As w ith the ability to complement, it m ay be interesting to overexpress the cdcl8
hom ologue w ith the cdtl homologue from a particular organism and see whether
the proteins are then able to prom ote re-replication.
It w ould appear that none of the cdcl8 homologues examined here can functionally
substitute for cdcl8. Despite the fact that the cdcl8 homologues behave similarly in
different organisms, there could be changes in both function and regulation. Some
of these differences will be discussed later (Chapter 5).
One of the major differences betw een the organism s w hich could be directly
relevant to the function of cdcISp is origin specification. It is know n that the
definition of an origin varies greatly betw een different organisms. This suggests
that cdcl8 hom ologues could be unable to recognise Schizosaccharomyces pombe
origins. Alternatively, higher eukaryotes may have a more complex pre-replicative
complex, possibly involving more proteins. These could be required for the cdcl8
hom ologue to interact at origins. W hen these are absent, as in fission yeast, the
hom ologue m ay be unable to bind. As progression is m ade in this direction, we
m ay be able to discover if either of these hypotheses are correct.
89
. . 10 . . .
SQ A Q A TISFPI
HsC dc6
Z lC dc6
c d c 18
ScCdc6
consensus
s r s q s s iq f p
ig c h t p r r c n
•
•
•
«30
•
. . m S a i p i t p t k I . ••
. . . .
HsC dc6
Z lC dcS
c d c 18
ScCdc6
consensus
I
I
•20
tKL^AjgHKAKNSSDA
(KTgoTgAKEVSgAKS
' id^ aJ idctnI tnq
• .4 0
• •
EPTNVQTVTC
RVKAL
E IC SS V SL P L
LPKEL
lE IP T T
H S P . a . . * . .
I R R N ...................7 I 7 F D D A P A T
.6 0
•
•
•
.7 0
SggggLGDDNLCN
S^^QLGDDNRCN
RK g rL A SSH FgT P
R
i^iaOKKLQFTDV
***---- ———I ——**** ——___
.
8 0
. .
. 90
1 00 . . . 110 . . . 120
. .
140
71:H L P P C S P P K gG K g :N G P g IS H T L K
R jJ V F D N Q L T I F T K H P S K R E L A K B H Q M R I I
IT T N gE Q
7 1 : P T L S C S P P K ^ r [ S T G Q ra r..T P K
R gL F D E N Q A A A A F lT P L S g L B K lg D P Y Q l
TPPSggK
6 4 : R I K T E L G E L a_E E n _[?DL t _B n . . _. F P
V P F a E jl
l
kE
e n k k p k l p t t p q t p k t ^ I t |_ q i v _t p ï _
LK
_
4 1 : E S S P E K L Q F G S Q S I F L R T K ................... A L | g Q K S S E L V N L N S | D G A L { 3 A| | Tt A
aE
e Y E Q V |N . . . F L A K A IS E H i^S
71% —————— ——* ——* ————* ——————
———————————* ————* —* —* ———— — ——* — ———— —
P
;140
: 138
: 130
: 101
140
. . . 150
.
. . 160
.
. . 170
. .
. 180
.
.
. 1 9 0
. .
. 200
.
210
HsC dc6
1 4 1 : R C P L K K E g A C m R g g ( g E g C Y g Q A K L V F T L N T A 0 P D R i g P ...................m g g R g M D g g m N g L R E i g c g K K g S i g : 2 0 5
Z lC dc6
1 3 8 : . . . . g R N ^ G l Q ^ R Q E g H c Y ^ A K H A L N T A I P F T E R i J L ...................^ ^ > ^ A F M t B l T S « s 1 r k B s W : 1 9 9
c d c 18
1 3 0 : . . . . L O slp H R G ^ P P T K T P S T P S Y N S T A K L S M R K S Y R S A G V V p îB lN là b c S ljE s fa F R O y ilD lN A g a A iW : 196
ScCdc6
1 0 1 : .................. D ^ Y | T G P P G T ^ T A ^ D M I I R Q K F Q s | p L S i g s .................... T P R S K D g g ...................g ^ N P N L g N L S g : 1 5 4
c o n s e n s u s 1 4 1 : ----------------- * — * _ * *
* * — * ----------------------------- * -------* ---------------- * ★ * _ * — * * * _ *
i* _ * — * * -* * :2 1 0
220
HsC dc6
X lC dc6
c d c 18
ScCdc6
consensus
HsC dc6
Z lC dc6
c d c 18
ScCdc6
consensus
230
240
206:
C g S R m g O D L K K g F’TTLLKK G F K T I M
200:
^KQCKTFTVY
L g H N g D H V V S Q Y P . .. KV
1 M VC Y
. . . L E S .................V A V T S
. 270
.
. . 280
Q E E V S R . . PA G R D H B R :273
G G R S S . . .L A A R O m| r :2 6 6
_ R E E IL E N E D H H IN F Q C :2 6 4
D S F Q D L N G P . . . T L Q I R N |Q : 203
C^KgQESKoBLKQC]
197:
1 5 5 :F E L P D
I
=
= = = »= * = »_=» = = »» = * | | * ** = » = = ** | »» §= »= * = = = =
== =—
#280
340
gAEmGpmivmFT.g
Bs
. .3
2 74:R
2 6 7 :N
2 6 5 : E m i S HF g Q S A H E | Y N P V I l 3
. T
.
HANTSHBOSVRT
I :336
1:3 2 8
:328
:271
IA_
2 0 4 : H 'V 3 F B E P Y a R R T T F a v
VSF
LARl
HsC dc6
Z lC dc6
c d c 18
ScCdc6
consensus
360
337:
R E R C R ig
329:
329:
T . R H IT j
2 7 2 :1
3 5 1 : 1 * 1 1 * ---------------- I
HsC dc6
Z lC dc6
c d c 18
ScCdc6
consensus
. 480
.
.
. 490
460
CRS :4 3 3
380:
TIV i
C L S :4 2 5
372:
AQHONT
. . . . . . . : 44 6
___________________________
394:À G B T P F IH P
3 1 1 : g r g p ................ MTVÿ cia TW lC AX E NK , U i - ^ L F . M L
fY l3 L R k # F L L S P T R G S L N S A !* T V P l|T l3 T m S P V R : 375
4 2 1 : * * * ----------------* I * - * * 1 * 1 * - * - * I I * 1 1 * * I * * I * * * 1
* — 1_ * _ * ------------; 4 9 0
RPQCRæ
DRGLLæ
HsC dc6
Z lC dc6
c d c 18
ScCdc6
consensus
HsC dc6
Z lC dc6
c d c 18
ScCdc6
consensus
410
FTD
A ^R T A A T T SE R N N P FT PIR SISE
iqH s
* ------- * _ 1 _ |
1 I --------------- ----------------------------- * * ------------------------------------------------------------------------------ * J _ *
420
:379
:3 7 1
:393
0 :3 1 0
----------------------- * * ; 4 2 0
I NW S
VRSgTIgRgL0E
GFigiV^R^LlE
.
HsC dc6
Z lC dc6
c d c 18
ScCdc6
consensus
390
DlgN.............................. Q
.
.
500
. 520
.
. . 530
.
.
. 540
V D G N M M T L SaE aA Q D SFP FT K g jia i
.
4 3 4 :P g E . . g . . L I P R
:4 9 9
:4 9 4
:4 9 8
:434
| F V N N | S T R T R I A R H n K !!3 3 l
_ * * I * * * * __ * _________ * * * * * 5 5 6 0
4 2 6 :P ^E A g S N P V P R
4 4 6 :.
. . . . . .
V Y G D piA S N G .gsS D S F P igQ gR L F T
Hvd1B
3 7 6 : 9 P S . . . . QG
491*—
1—
—
—
2—
—
—
—
—
—
r
5 00:R
4 95:R
499:D
4 3 5 :E S
y
A
e
—
—
—
—
. . 580
Q Q |A A B D g
qqI p g
rlI yp
dtI ap
I
I
I
gq
ts
qrn
—
—
—
—
—
*—
:5 6 7
:562
:568
:502
. .
. 640
568 :L g G N g A T G g p : 578
5 6 3 : l I g n B n s g | . :5 7 2
5 6 9 : t | r R F F D R R . . :5 7 7
5 0 3 :T R I S Q R P F |H :5 1 3
6 3 1 : - * - - * * --------* - : 6 4 1
Figure 3.1
Sequence alignment of cdcISp and homologues
The cdcISp sequence is aligned with HsCdc6, XlCdc6 and ScC dc6.0 denotes identity
between all four sequences, 0 denotes identity between three sequences and g denotes
similarity between at least three sequences.
Transform cdcl8-K46 cells with cdc]8 and homologues
Plate on min+T (leu/ura)
grow at 25°C for - 4 days
(until colonies formed)
Replica plate to min (leu/ura) to induce promoter and min+T (leu/ura)
grow at 25°C overnight
Replica plate from min to min+leu+ura+PB and
from min+T to min+leu+ura+T+PB
grow at 36°C overnight
Screen visually for colonies that complement
cdcI8-K46 at 36°C, patch colonies to min+T
Test ability to complement further by:
grow cells in min at 25°C
grow cells in min at 25°C
Plate 1000 cells on min at 25°C
Plate 1000 cells on min at 36°C
Split culture and grow half at 25°C
and half at 36°C
Count number of colonies formed and
look at cells with DAPI staining
Follow cultures by cell number and
DAPI staining for 10 hrs
(Table 3.1 and Figure 3.3)
(Figures 3.4 and 3.5)
Figure 3.2
Strategy used to investigate vyhether the cdcl8 homologues complemented the
cdcl8~K46 temperature sensitive mutant
A
B
a
R e p 8 1 -c d c l8 a t2 5 °C
Rep81 a t3 6 °C
R e p 8 1 -cd c l8 a t 36°C
R ep81-S cC D C 6at36°C
R ep41-cdcl8 and Rep42 at 25°C
Rep41 and Rep42 at 36°C
R ep41-cdcl8 and Rep42 at 36°C
Rep41-X1CDC6 and Rep42-cdtl at 36°C
a
Figure 3.3
Rep81-ScCDC6 and Rep41-XICDC6+Rep42-cdtl appeared to complement cdcl8-
K46 when the ability to form colonies at 36°C was assayed
cdcl8-K 46 cells transform ed with c d c l8 and homologues that initially appeared to
complement at 36°C were further assayed by their ability to form colonies at 25°C and
36°C. Colonies were picked and DAPI staining was performed. (A) R ep81-cdcl8 at
25°C (a) and 36°C (c), Rep81 (b) and Rep81-ScCDC6 (d) at 36°C. (B) Rep41-cdcl8+
Rep42 at 25°C (a) and 36°C (c), Rep41+Rep42 (b) and Rep41-XlCDC6+Rep42-cdtl (d)
at 36°C. Bar 15pm.
Rep81 at 25°C
Rep81 at36°C
R e p 8 1 -cd c l8 a t 25°C
O
- - - O - - - R ep81-S cC D C 6at25°C
R e p 8 1 -c d c l8 a t3 6 °C
— O — R ep 8 1-ScCD C6 at 36°C
100000
•
o
100000 -
O
-O'
Cell num ber
Cell num ber
O'
-O'
-O
.0
10000 -
Tim e (hrs)
Tim e (hrs)
B
Rep81 al2 5 °C
Rep81 a t3 6 °C
R e p 8 1 -cd c l8 a t 25°C
R ep81 cdc 18 at 36°C
Rep81-ScCDC6 at 25°C
Rep81-ScCDC6 at 36°C
Figure 3.4
Rep81-ScCDC6 did not appear to complement cdcl8-K46 when the ability to grow
in liquid media at 36°C was assayed
cdcl8-K 46 cells transformed with c d c l8 and homologues that initially appeared to
complement at 36°C were grown in liquid media at 25°C. The cultures were then split
and half were shifted to 36°C. (A) Cell number was followed for 10 hours after the
cultures were split at 25°C (a) and 36°C (b). (B) Cells were fixed and stained with DAPI
10 hours after the cultures were split. Bar 15pm.
3
□—
Rep41 and Rep42 at 25°C
□—
O
R ep41-cdcl8 and Rep42 at 25°C
-O’..... R ep41-cdcl8 and Rep42 at 36°C
- - - O - - - R ep41-X lC D C 6 an d R ep 4 2 -cd tl a t2 5 °C
b
Rep41 and Rep42 at 36°C
- - - O - - - Rep$l-X 1CDC6 and Rep42-cdtl at 36°C
10000
10000 Cell num ber
Cell num ber
1000
-O
1000
Tim e (hrs)
Tim e (hrs)
B
Rep41 and Rep42 at 25 C
Rep41 and Rep42 at 36°C
R ep41-cdcl8 and Rep42 at 25 C
Rep41-cdc 18 and Rep42 at 36 C
Rep41-X1CDC6 and R ep42-cdtl at 25°C
Rep41-X1CDC6 and R ep42-cdtl at 36°C
Figure 3.5
Rep41-X1CDC6 and Rep42-cdtl did not appear to complement cdcl8-K46 when the
ability to grow in liquid media at 36°C was assayed
cdcl8-K46 cells transformed with cdcJS and homologues that initially appeared to comp­
lement at 36°C were grown in liquid media at 25°C. The cultures were then split and half
were shifted to 36°C. (A) Cell number was followed for 10 hours after the cultures were
split at 25°C (a) and 36°C (b). (B) Cells were fixed and stained with DAPI 10 hours after
the cultures were split. Bar 15pim.
Rep41 and Rep42-cdtl
J
B
Rep41 and Rep82-cdtl
J
Q
R ep41-cdcl8 and Rep42-cdtl
R ep41-cdcl8 and R ep82-cdtl
Rep41-ScCDC6 and Rep42-cdtl
Rep41-ScCDC6 and R ep82-cdtl
R ep41-H sC D C 6and Rep42-cdtl
d
Rep41-XICDC6 and Rep42-cdtl
2 4 8
DNA content (C)
Forward Scatter
d
Rep41-HsCDC6 a nd Rep82-cdtl
Rep41-X1CDC6 and R ep82-cdtl
2 4 8
DNA content (C)
Forward Scatter
Figure 3.6
ScCdc6p can induce re-replication to similar levels as cdcISp when co-overproduced
with cdtlp
Wildtype cells were transformed with cd cIS or homologues behind the nm t4I promoter
(Rep41) and cdtl behind either nm t4I (Rep42) (A) or nrntS! (Rep82) (B). Cells were
grown for 20 hours after induction of the promoter. DNA content and cell number was
analysed by FACS.
Rep41 and R ep42at25°C
Rep41 and Rep42 at 36°C
II
R ep41-cdcl8 and Rep42 at 25°C
R ep41-cdcl8 and R ep42-cdtl at 25°C
R ep41-cdcl8 and Rep42 at 36°C
I
R ep41-cdcl8 and Rep42-cdtl at 36°C
J
R e p 4 l-c d cl8 and Rep82-cdtl at 25°C
rr
l
R ep41-cdc 18 and R ep82-cdtl at 36°C
□l
Rep41-ScCDC6 and Rep42 at 25°C
Rep41-ScCDC6 and Rep42 at 36°C
II
Rep41-ScCDC6 and Rep42-cdtl at 25°C
Rep41-ScCDC6 and R ep42-cdtl at 36°C
Rep41-ScCDC6 and Rep82-cdtl at 25°C
Rep41-ScCDC6 and R ep82-cdtl at 36°C
2 4 8
DNA content (C)
Forward Scatter
2 4 8
DNA content (C)
Forward Scatter
Figure 3.7
ScCdc6p can promote re-replication without the increase of endogenous cdcISp levels
cdcl8-K 46 cells were transformed with cdc 18 or ScCDCô and cdtl and were grown for 18
hours at 25°C before being split and half shifted to 36°C. Cells were grown for a further 2.5
generations (10 hours at 25°C and 5 hours 50 minutes plus 1 hour for temperature shift
recovery at 36°C). (A) DNA content and cell length were analysed by FACS.
B
Rep41
and Rep42
at 25°C
R ep41-cdcl8
and Rep42
at 25°C
%;
Rep41
and Rep42
at 36°C
R ep41-cdcl8
and Rep42
at 36°C
Rep41-ScCDC6
and Rep42
at 25°C
Rep41-ScCDCô
and Rep42
at 36°C
R ep41-cdcl8 and
Rep42-cdtl
at 25°C
R ep41-cdcl8 and
Rep42-cdt 1
at 36°C
Rep41-ScCDCô and
Rep42-cdtl
at 25°C
Rep41-ScCDCô and
Rep42-cdtl
at 3Ô°C
R ep41-cdcl8 and
Rep82-cdtl
at 25°C
R ep41-cdcl8 and
Rep82-cdtl
at 3Ô°C
Rep41-ScCDCô and
Rep82-cdtl
at 25°C
Rep41-ScCD Cô and
Rep82-cdtl
at 3Ô°C
Figure 3.7 B
(B) Cells were fixed and stained with DAPI; Rep41 and Rep42 at 25°C (a) and 36°C (b),
Rep41-cdcl8 and Rep42 at 25°C (c) and 36°C (d), Rep41-cdcl8 and Rep42-cdtl at 25°C
(e) and 36°C (f), Rep41-cdcl8 and Rep82-cdtl at 25°C (g) and 36°C (h), Rep41-ScCDC6
and Rep42 at 25°C (i) and 36°C (j), Rep42-ScCDC6 and Rep42-cdtl at 25°C (k) and 36°C
(1) and Rep41-ScCDC6 and Rep82-cdtl at 25°C (m) and 36°C (n). Bar 15pm.
00
i
11
II
I j iu
11
25°C 36°C
175
83
62
25°C 36°C 25°C 36°C 25°C 36°C
anti-cdclS p
47.5
anti-a-tubulin
H
ll
11
aï
II
25°C 36“C 25°C 36°C
ai
V) _
11
25°C 36°C
83
62
anti-cdclSp
47.5
anti-a-tubulin
Figure 3.7 C and D
Protein levels were determined by Western blotting. 50pig of protein was loaded per lane.
Blots were probed with anti-cdcl8p antibody (C and D top panel) and anti-a-tubulin
antibody as a loading control (C and D bottom panel).
Chapter 4
A mutational analysis of cdc18
Introduction
C d cl 8 p has a num ber of structural motifs potentially im portant for its function and
regulation. In order to investigate the role of these motifs I constructed a strain in
which cdcl8 is under the control of a repressible prom oter and m ade site specific
m utants of cdcl8 integrated at a different locus where they were expressed from
the endogenous cdcl8 prom oter. I exam ined w hether the m utants w ere viable
w hen cells were depleted for wildtype cdcl8. M utants that were unable to grow in
the absence of cdclSp were physiologically and biochemically characterized to
describe their defects.
Chapter 4 M utational an alysis of
cdc18
Results
4.1 Characterization of the 81-cdcl8 S/O strain
C dclSp contains several structural motifs that are conserved betw een cd cl8
hom ologues in different organisms, indicating that they could be im portant for
cdclSp function. Mutagenesis of these motifs should illuminate both how cdclSp is
regulated and w hat its precise role in the cell cycle could be.
In order to carry out a physiological analysis it was im portant that:
1) wildtype cdclSp could be repressed in order to investigate any potential defects
of the m utants
2)
m utants were expressed at wildtype levels
3) wildtype and m utant copies of cdclSp could be distinguished.
To create a strain in which the w ildtype copy of cdclSp could be repressed I first
chose which prom oter w ould be suitable. The nm t prom oters are repressed in the
presence of thiamine and have been m utated to express at three levels (Basi et al.,
1993; M aundrell, 1990). The strongest prom oter n m tl, causes re-replication in
fission yeast w hen used to overexpress cdcl8 (Nishitani and Nurse, 1995, Chapter
2). Both nmt41-cdcl8 and nmt81-cdcl8 are capable of com plem enting the cdcl8-K46
tem perature sensitive m utation w hen expressed from a m ulticopy plasm id but
nmt41-cdcl8 also results in a small am ount of re-replication (Chapter 3). I therefore
used the nmt81 prom oter. The strain was m ade using a hom ologous integration
technique (Bahler et al., 1998) to replace the endogenous prom oter w ith that of
n m t8 1 . The strain is designated 81-cdcl8 S /0 as the n m t81-cdcl8 gene can be
Switched Off on the addition of thiamine.
To characterize the strain, 81-cdcl8 S /0 cells were grow n to exponential phase at
32°C in the absence of thiamine. Thiamine was then added to the culture and the
phenotype was analysed by FACS, DAPI staining and W estern blotting (Fig. 4.1).
C dclSp levels were undetectable w ithin an hour of thiam ine addition (Fig. 4.1 C
lanes 2 and 3). This corresponded w ith an accum ulation of cells w ith a 1C DNA
100
Chapter 4 M utational an alysis of
cdc18
content (Fig. 4.1 A b). By 3 hours almost all of the cells had a 1C DNA content and
by 4 hours a proportion of cells had a DNA content of less than 1C (Fig. 4.1 A, d
and e). Cells initially accum ulate in C l as they are unable to initiate DNA
replication in the absence of cdclSp. However, these cells are also unable to send
the checkpoint signal to inhibit m itosis so they undergo a nuclear division
followed by septation in the absence of DNA replication giving rise to some cells
w ith a DNA content of <1C (Kelly et al., 1993). This can be visualised by DAPI
staining cells from the 3 and 4 hour tim epoints w hen cells possessing a cu t
phenotype are first seen (Fig. 4.1 B, d and e). The protein disappears rapidly due to
its short half life (Muzi-Falconi et al., 1996) and the cell phenotype after addition of
thiam ine is equivalent to a cdclSA strain (Kelly et al., 1993). One thing to note is
that the expression level produced from the nm tSl prom oter is several fold lower
than the w ildtype protein level. An 81-cdcl8 S /0 cell p opulation is m ore
heterogeneous in cell length as the cells are slightly sick. However, cells are viable
and the lower expression level aids a complete depletion of the protein when the
prom oter is switched off.
4.2 A 5.2kb genomic fragment of cdclS complements the 81cdclS S/O strain
In order to tackle the problem of expressing the m utants at w ildtype levels, I used
a 5.2kb genomic fragm ent of cdcl8 (a gift from José Ayté) cloned from the cl4C8
cosmid. A S acl/A p aL l digest was perform ed on the cosmid and the fragment was
cloned into the m ulticopy plasm id pIRT2 on a S a c l/S m a l digest. This fragment
contained 2.5 kb of upstream prom oter sequence, the 1.8kb O pen Reading Frame
and approxim ately 0.9kb of dow nstream sequence. It w as possible that this
genom ic DNA fragm ent (gcdcl 8 ) w ould be able to rescue the 81-cdcl8 S/O
phenotype w hen thiamine was present as w ildtype expression of the gene could be
produced from the endogenous prom oter. I also cloned the genomic fragment of
cdcl8 into the pJK148 vector w hich does not carry an ARS and so can not be
m aintained in a cell population unless integrated. pJK148 also contains the leul
m arker and integrates preferentially at the le u l locus on transform ation. I
transform ed both pIRT2-gcdcl8 and pJK148-gcdcl8 into 81-cdcl8 S/O cells
alongside pJK148 as a negative control. Presence of the plasm ids was selected by
101
Chapter 4 M utational analy sis of
cdc18
the ability to grow on media lacking leucine as the strain is auxotrophic for leucine.
T ransform ants w ere grow n to exponential phase at 32°C in m edia lacking
thiamine. Thiamine was then added and cells were followed for 10 hours by FACS,
cell num ber and DAPI staining (Fig. 4.2). Cells transform ed with pJK148 are unable
to complem ent the 81-cdcl8 S/O strain. The FACS profile dem onstrates that cells
accum ulate w ith a 1C DNA content w ith the same kinetics as the 81-cdcl8 S/O
strain (Fig. 4.2 A, a to f and Fig. 4.1 A). Cell num ber data suggests that cells stop
dividing 5 hours after thiam ine addition and this tim ing corresponds to an
accumulation of cells w ith a. cut phenotype (Fig. 4.2 B and C, a to c). Both pIRT2g cd cl 8 and pJK148-gcdcl8 are able to complem ent the 81-cdcl8 S/O strain in the
presence of thiamine. The FACS data shows that w hen either pJK148-gcdcl8 (Fig.
4.2 A, g to i) or pIRT2-gcdcl8 (Fig. 4.2 A, j to 1) are expressed the cells can maintain
a 2C DNA content. The cell num ber data demonstrates that cells continue to divide
(Fig. 4.2 B) and the DAPI staining that they are of a w ildtype size and morphology
(Fig. 4.2 C, d to i). pIRT2 is a m ulticopy plasm id so cells w ould contain a variable
num ber of plasm ids and some m ay have lost the plasmid. Plasm id loss results in
small starved cells, which can be seen on the FACS profile as a 1C peak (Fig. 4.2 A,
k and 1). This could also explain the slower grow th rate of pIRT2-gcdcl8 compared
to pJK148-gcdcl8 as pJK148-gcdcl8 is probably integrated so w ould have a
constant copy number.
H aving confirmed that a genomic fragm ent of cdcl8, one expressed under its own
prom oter, could com plem ent the 81-cdcl8 S/O strain, the next problem of
d istinguishing betw een the w ildtype and m utant copies of c d c l 8 p could be
addressed. The genomic cd c l8 fragm ent w as tagged at the C -term inus so
expression from the endogenous prom oter w ould not be affected. A triple HA tag
w as used as it was know n that introducing this 3' to the cdcl8 gene using the
hom ologous recom bination m ethod (Bahler et al., 1998) resulted in a fully
functional gene product (B. Baum, unpublished results). The cdcl8 stop codon was
replaced by a N o tl restriction site using site-directed m utagenesis. The triple HA
tag w as then cloned w ith a N o tl digest and orientation w as confirm ed by
sequencing. The m utants were constructed by site-directed m utagenesis of pJK148gcdcl8-3HA.
102
Chapter 4 M utational an alysis of
cdc18
4.3 Mutant construction
C dclSp possesses a num ler of structural motifs (Fig. 4.3). These include the highly
conserved W alker A and W alker B box motifs w hich are essential for stable
binding and hydrolysis o; nucleotides in a num ber of proteins (Walker et al., 1982).
The W alker A motif contiins the consensus sequence GxxGxGKT (as described in
C hapter 2). Structural amlysis has shown that this m otif forms a loop that binds
nucleotides. The W alker B m otif contains the consensus sequence DExD. The
conserved residues play a role in coordinating the m agnesium ion (Guenther et al.,
1997; Story and Steitz, 1952). Many of the proteins that contain the Walker A motif
are proteins in w hich hydrolysis is coupled to the binding of another molecule,
(DNA, RNA, protein). In the RecA protein, ATP and ADP have been found to
stabilize different conformations (Fujita et al., 1997; Story and Steitz, 1992). The
conformation stabilized by ATP has a much higher affinity for DNA. This provides
an indication as to how NTP binding and hydrolysis could relate to cdclSp
function. ATP b inding could be required for cdclSp binding to DNA and
hydrolysis could then result in the release of cdclSp from chrom atin, although
w hether this occurs before initiation of replication, acts as the trigger for initiation
or occurs later is currently unknown.
The Walker A motif was m utated so the conserved lysine residue was changed to
the negatively charged glutam ate residue. This am ino acid substitution had
previously been show n to have the m ost dram atic phenotype w hen m ade in the
Saccharomyces cerevisiae homologue Cdc 6 p (Perkins and Diffley, 199S; W ang et al.,
1999; W einreich et al., 1999). The conserved glutam ate of the W alker B motif was
m utated to a glycine. This m utant had originally been identified as a dom inant
negative w hen overexpressed in budding yeast (Perkins and Diffley, 199S).
The major role of cdclSp is thought to be to load the MCM family of proteins onto
chrom atin (Nishitani et al., 2000). For this to occur cdclSp m ust be localized in the
nucleus. Im m unofluoresence data shows that the overexpressed cdclS protein
localizes to the nucleus (Nishitani and N urse, 1995) and a m ore recent study
reports that a myc-tagged cdclSp expressed at w ildtype levels is located in the
nucleus (Nishitani et al., 2000). CdclSp contains two putative bipartite nuclear
103
Chapter 4 M utational analy sis of
cdc18
localization signals (Fig. 4.3) which could be responsible for the correct localization
of the protein and hence have a direct effect on the ability of cdclSp to perform its
designated function. Bipartite nuclear localization signals (NLS) contain two basic
residues (lysine or arginine) followed by a spacer of 10 or 11 amino acids followed
by at least 3 basic residues out of the next 5 (Robbins et al., 1991). Cdc2p consensus
p hosphorylation sites are often found close to bipartite nuclear localization
seq u en ces, in d ic a tin g
th at lo calizatio n m ay be in flu e n ce d by cdc 2 p
phosphorylation (Robbins et al., 1991; Takei et al., 1999). M utating the basic
residues of the proximal arm of the bipartite NLS to neutral residues has been
found to exclude the cytokine interleukin-5 from the nucleus (Jans et al., 1997). I
therefore m utated the two putative nuclear localization signals as indicated:
NLSl
RKRxxxxxxxxxxxKRxK
AAAxxxxxxxxxxxKRxK
NLS2
KKxxxxxxxxxxKxxKR
AAxxxxxxxxxxKxxKR
I also combined the two m utants in case the sequences acted redundantly.
Finally a m u ta n t w as constructed in w hich all 6 of the cdc2p consensus
phosphorylation sites, S/TPxK /R , were m utated so the S /T residue was changed
to alanine. Stepwise mutagenesis was perform ed to construct both the NLS1+NLS2
and P l -6 m utants. The plasm ids were sequenced after each round of mutagenesis
to confirm that the expected m utation had been successfully introduced w ithout
the acquisition of new m utations. Phosphorylation is know n to be required to
target cdclSp for degradation via the SCF pathw ay (Baum et al., 1998; Jallepalli et
al., 1997; Kominami and Toda, 1997). I was therefore interested to see whether a
stable cdclSp w ould interfere with the normal alternation of S and M phase.
104
Chapter 4 M utational analy sis of
cdc18
T able 4.1
C onstruction o f m utants
M utant
Motif
Amino acid substitution
WA
GxxGxGKT
K-^E
WB
DExD
E-»G
NLSl
RKRxxxxxxxxxxxKRxK
RKR^AAA
NLS2
KKxxxxxxxxxxKxxKR
KK->AA
P l -6
S/T PxK /R
S/T-^A
The m utants were constructed by site-directed m utagenesis of the pJK148-gcdcl83HA plasm id as previously m entioned, and were then transform ed into the 81cdcl8 S/O strain. Transform ants were selected by conversion of the 81-cdcl8 S/O
strain to leucine prototrophy. To increase the probability of integration at the leul
locus, the plasm id can be linearisesd by digesting w ith a restriction enzyme that
cuts w ithin the leu l gene. However, due to the presence of the genomic cdcl8
fragm ent in the plasm id there was no restriction site available that was present
only once in the leul gene and not elsewhere in the plasmid. I was therefore unable
to improve the chance of integration at the leul locus in this way. The presence of
the 5.2kb of genomic DNA in the plasmid also provides a large region of homology
w ith the cells genomic DNA and produces a second site w here hom ologous
recombination w ould result in integration of the plasmid. These factors m ay have
been responsible for the low frequency of integ ratio n at the le u l locus
(approxim ately 1:50 integrants w ere in teg rated at the le u l locus). M any
transform ants w ere screened by Southern blotting to ensure that the plasm ids
were integrated at the leul locus.
DNA was prepared from transform ants and a Bam H l digest was performed. This
was followed by Southern blotting. Blots w ere probed w ith cdcl8 and leul (Fig.
4.4). A Bam H l digest produces a band of 9.1 kb at the cdcl8 locus which should
rem ain unchanged. The leul locus corresponds to a 14.8 kb band. On integration of
the pJK148-gcdcl8-3HA plasm id at the leul locus, this 14.8kb band is converted to
four bands following BamHl digestion (Fig. 4.4 A). A leul probe m ade with only
105
Chapter 4 M utational analy sis of
cdc18
the open reading frame recognises a 4.2kb and 17.7kb band (Fig. 4.4 B top panel).
W hen the vector pJK148 is integrated as a control, the leul probe still recognises
bands of the same size. This is because the cloning of gcdclS into pJK148 deleted a
BamHl site l.lk b downstream of the leul gene. W ithout the presence of the gcdcl 8
fragm ent, this B am H l site still exists, thus bands of 4.2kb and 17.7kb are
recognised, as seen on the leul Southern (Fig. 4.4 B, top panel, lane 2) but the 1.4kb
and 2.9 kb bands are not produced as they are specific to the genomic cdcl8
fragment. A cdcl8 probe therefore recognises the 9.1kb band at the endogenous
locus and the 2.9kb band w hen the m utant is integrated at leul (Fig. 4.4 B, bottom
panel, lanes 3,4 and 6 to 9).
The exception to this band pattern occurred w hen the W alker B (WB) m utant was
integrated (Fig. 4.4 B, lane 5). The leul probe recognised bands of the correct size,
as did the cdcl8 probe for the 2.9kb band. This indicated that the pJK148-gcdcl83HA-WB plasm id was integrated correctly at the leul locus. However, there was a
change in band size at the endogenous cdcl8 locus, from 9.1 kb to approxim ately
7kb. This could m ean one of two things, either a new B am H l site had been
introduced or 2kb of DNA had been deleted w ithin the original Bam H l fragment.
A 2kb deletion could affect w hether the w ildtype gene was present and whether
the prom oter was present that allows the gene to be sw itched off by thiamine. I
have therefore tried to remake the strain although so far to no avail. This has been
attributed to the low frequency of integration at the le u l locus as previously
described. In the m eantim e I have perform ed a characterization of the 81-cdcl8
S/O-W B strain and show n that the full length, w ildtype c d c l 8 protein is both
produced and switches off in response to thiamine, as expected.
4.4 Complementation of mutants
In order to characterize the phenotype of the a d d 8 m utants the first thing to
establish was w hether they were able to rescue the lack of w ildtype cd cl 8 protein
w hen it was sw itched off. The 81-cdcl8 S/O strains containing the vector control,
the w ildtype c d cl 8 p or one of the 7 m utants were grow n to exponential phase at
32°C in media lacking thiamine. The cell cultures were then split and thiamine was
added to half. This switches off the endogenous cdcl8 gene resulting in the rapid
106
Chapter 4 M utational an alysis of
cdc18
depletion of w ildtype cd cl 8 protein. Samples were taken every hour for 10 hours
for cell num ber, FACS analysis, DAPI staining and to make protein extracts. The
phenotype of each strain will be described in turn.
81-cdcl8 S/O-JK cells contain the vector pJK148. This strain differs from the strain
described previously (Fig. 4.2) and we have confirmed integration at the leul locus
in this case. The phenotype is, however, equivalent. The 81-cdcl8 S/O-JK cells are
unable to continue growing in the presence of thiamine as the only copy of cdcl8 in
the cell has been switched off. Cell num ber stops increasing exponentially between
4 and 5 hours after the addition of thiamine (Fig. 4.5 A). The FACS profile shows
that a 1C peak begins to accumulate by 1 hour after the addition of thiamine and
by 5 hours all of the cells have a DNA content of 1C or less than 1C (Fig. 4.5 B).
Likewise the DAPI staining demonstrates that m any cells w ith a cut phenotype are
present 5 hours post thiamine addition (Fig. 4.5 C). This data demonstrates that the
81-cdcl8 S/O-JK strain acts as both the 81-cdcl8 S/O strain and the 81-cdcl8 S /0 pJK148 strains (Fig. 4.1 and Fig. 4.2).
W estern blots were perform ed to look for depletion of the w ildtype protein after
the addition of thiamine. As c d cl 8 p is an unstable protein, w ildtype expression
levels can be difficult to detect. I discovered that detection was im proved by using
protein extracts m ade from fresh cells rather than frozen pellets. However, a cross­
reacting band of almost exactly the same size as cd cl 8 p is also present. As I was
looking for the loss of w ildtype protein after thiam ine addition it was extremely
im portant to separate these two bands. A longer gel system was used to allow
greater separation of cd cl 8 p and the cross-reacting band and control extracts of
cdcl8-HA cells and w ildtype cells were also run to dem onstrate that the lower band
was cross-reacting and not a different c d c l 8 p isoform . The cdcl8-H A strain
possesses one copy of cdcl8 tagged at the C-terminus w ith 3HA at the endogenous
locus. The anti-cdcl 8 p antibody recognises two bands w ith both the cdcl8-HA and
w ildtype strains (Fig. 4.5 D). Both possess a lower molecular w eight band which I
believe is a protein that cross-reacts w ith the c d c l 8 p antibody. Cdcl8-H A cells
possess a band of a higher molecular w eight than the w ildtype protein as the tag
increases the molecular weight of the protein by approxim ately 4.5kDa (Fig. 4.5 D,
lanes 1 and 2, upper panel). The cd cl 8 -HA band is also recognised by an anti-HA
107
C h a p te r 4 M utational an alysis of
cdc18
antibody (Fig. 4.5 D, lane 1, m iddle panel). The tubulin W estern confirms that the
proteins w ere equally loaded (Fig. 4.5 D, lanes 1 and 2, bottom panel). Having
confirmed that the lower band is a cross-reacting protein I examined the 81-cdcl8
S/O-JK extracts m ade either in the absence of thiam ine or 1 hour after thiamine
addition (Fig. 4.5 D, lanes 3 and 4). The cross-reacting band recognised by the
cdclSp antibody is present in both lanes (upper panel) b u t a slightly higher
molecular weight band of the same size as the w ildtype protein (lane 2 ) is present
in the absence of thiamine (lane 3) and disappears w hen thiamine is added (lane 4).
No protein is seen using the anti-HA antibody as there is no tagged protein present
in the cells (middle panel). The anti-tubulin control confirms equal protein loading
(Fig. 4.5 D bottom panel).
The 81-cdcl8 SjO -wt strain continues to grow in the presence of thiam ine as the
cdcl8-3H A expressed from the endogenous prom oter at the leul locus is able to
rescue the depletion of cdclSp. Cell num ber increase is the sam e in both the
presence and absence of thiam ine (Fig. 4.6 A). FACS analysis shows that cells
m aintain a 2C DNA content indicating no C l arrest (Fig. 4.6 B) and DAPI staining
shows that the cells have norm al nuclear m orphology 10 hours after the addition
of thiam ine (Fig. 4.6 C). W estern blots dem onstrate that the cdcl8-3HA protein is
produced as there is a protein of a higher molecular weight recognised by both the
cdclSp and the anti-H A antibodies (Fig. 4.6 D). The w ildtype protein also
disappears on the addition of thiam ine but the cross-reacting band remains (Fig.
4.6 D lanes 1 and 2). The anti-tubulin W estern dem onstrates that equal amounts of
protein were loaded (Fig. 4.6 D bottom panel).
The 81-cdcl8 S/O -W A strain appears to act identically to the 81-cdcl8 S/O-JK strain
(Fig. 4.7). Cells arrest w ith exactly the same kinetics after thiam ine addition as can
be seen from the cell num ber graph (Fig. 4.7 A). The FACS profiles and DAPI
staining confirm that the two strains act similarly as cells accumulate initially in C l
before undergoing another division in the absence of DNA replication, thus
producing cells w ith a cut phenotype (Fig. 4.7 B and C). W estern blotting shows
that the cdclS-WA-3HA protein is produced (Fig. 4.7 D, upper and m iddle panels).
The w ildtype protein is also depleted 1 hour after the addition of thiamine (Fig. 4.7
D, u p p er panel). An anti-tubulin W estern dem onstrates that the proteins are
108
Chapter 4 M utational an alysis of
cdc18
equally loaded (Fig. 4.7 D, bottom panel). It therefore appears that the cd cl 8 -WA3HAp is produced but is non-functional, unable to either initiate DNA replication
or the checkpoint that inhibits mitosis until DNA replication is completed. The
cells act identically to the 81-cdcl8 S/O-JK strain after thiamine addition.
81-cdcl8 S/O-WB is also unable to rescue the depletion of w ildtype cdclSp when
thiam ine is added to an exponentially growing population of cells. However, the
term inal phenotype is different to the W alker A m utant. 81-cdcl8 S/O-WB cells
arrest earlier than 81-cdcl8 S/O-JK and 81-cdcl8 S/O -W A cells. Cell division slows
by 3-4 hours rather than 4-5 hours (Fig. 4.8 A). The reason that the 81-cdcl8 S/O-WB
cells stop dividing earlier is due to their cell cycle arrest point. The 81-cdcl8 S/OWB cells arrest w ithin S phase, unlike both 81-cdcl8 S/O-JK and 81-cdcl8 S/O -W A
cells which are unable to initiate either DNA replication or the checkpoint so
continue into the next mitosis and arrest after that. The cdcl8-WB-3HA protein
appears to be able to perform bulk DNA synthesis as the FACS profile
demonstrates that cells arrest with a 2C DNA content (Fig. 4.8 B). The fact that cells
arrest indicates that S phase is not completed and a checkpoint m ay have been
initiated. The DAPI staining strengthens this idea as cells are elongated (Fig. 4.8 C).
H ow ever by later tim epoints cells appear to have entered mitosis as septa are
present and the nuclei look fragm ented and abnorm al (Fig. 4.8 C, d). The FACS
data also indicates this as the 10 hour tim epoint (Fig. 4.8 B, d) has a very broad
peak indicating that the cells possess a variable DNA content. This could be
because the W alker B m utant has a partially deficient checkpoint and the cells
eventually leak through and enter mitosis.
W estern blot analysis dem onstrates that the full length w ildtype protein is
produced and that it is depleted w ithin 1 hour of the prom oter being switched off
(Fig. 4.8 D, upper panel). The W estern data also dem onstrates that the cdcl 8 -WB3HA protein is produced (Fig. 4.8 D, upper and m iddle panel) and the tubulin
W estern shows that the equal am ounts of protein were loaded (Fig. 4.8 D bottom
panel).
The 81-cdcl8 S/O -N l strain is able to continue growing after the w ildtype protein is
depleted, indicating that this putative nuclear localization signal is not required for
109
Chapter 4 M utational an alysis of
cdc18
c d c l 8 p function. Cell num ber continues to increase w ith the same kinetics after
thiam ine addition (Fig. 4.9 A). FACS analysis shows that the cells m aintain a 2C
DNA content and the forw ard scatter indicates that there is no change in cell
length (Fig. 4.9 B). This was confirm ed by DAPI staining as cells have norm al
nuclear m orphology 10 hours after thiamine addition (Fig. 4.9 C). The Western blot
analysis shows that the cd cl 8 w ildtype protein is absent 1 hour after addition of
thiam ine and that the cdcl8-N l-3H A protein is produced (Fig. 4.9 D, upper and
m iddle panels), thus the ability to grow in the presence of thiam ine is not due to
the persistence of w ildtype cd cl 8 protein bu t due to the presence of c d cl 8 -N l3HAp. These results suggest that NLSl is not essential and that NLS2 may be the
functional nuclear localization signal.
The 81-cdcl8 S /0 -N 2 strain was examined and cells were show n to grow equally
well in the presence and absence of thiamine (Fig. 4.10). Cell num ber increases at
the same rate (Fig. 4.10 A), cells have a 2C DNA content (Fig. 4.10 B), DAPI
staining dem onstrates that nuclear morphology does not alter after the addition of
thiam ine (Fig. 4.10 C) and W estern blot analysis shows that the w ildtype c d cl 8
protein is depleted, the cdcl8-N2-3HA protein is produced and equal amounts of
protein are loaded (Fig. 4.10 D). As NLS2 was also not essential another possibility
was that the two putative nuclear localization signals acted redundantly and both
had to be m utated to inhibit cd cl 8 p nuclear localization and hence function.
The 81-cdcl8 S/0-N 1+ N 2 strain combined both of the m utated putative nuclear
localization signals but the protein was still fully functional as judged by the ability
to m aintain grow th after thiamine addition. Cell num ber increased w ith the same
kinetics in the presence and absence of thiam ine (Fig. 4.11 A), cells maintain a 2C
DNA content (Fig. 4.11 B) and DAPI staining shows that cells had normal nuclear
m orphology (Fig. 4.11 C). The w ildtype protein is sw itched off in response to
thiam ine and the triple HA tagged m utant protein is produced (Fig. 4.11 D, upper
and m iddle panels). These data indicate that neither of the putative bipartite
nuclear localization signals are required for cd cl 8 p function.
The final m utant strain exam ined was 81-cdcl8 S/O -P l-6, in which all 6 of the
putative cdc2p consensus sites were m utated. As phosphorylation of cd cl 8 p by
110
Chapter 4 M utational an alysis of
cdc18
cdc2p is known to target the protein for degradation by the SCF pathw ay (Baum et
al., 1998; Jallepalli et al., 1997; Kominami and Toda, 1997), it was possible that the
cdcl8-Pl-6-3HA protein w ould be more stable and the prolonged presence of the
protein could disturb norm al cell cycle progress from S phase to G2 to mitosis.
However, this was not the case. Cell num ber increased w ith norm al kinetics in the
presence or absence of thiamine (Fig. 4.12 A). Cells m aintained a 2C DNA content
(Fig. 4.12 B) and DAPI staining dem onstrated that the nuclei looked wildtype (Fig.
4.12 C). The w ildtype protein is depleted shortly after thiam ine addition (Fig. 4.12
D, top panel). The cdcl8-Pl-6-3HA protein does not appear to be noticeably more
abundant than the w ildtype cdcl8 protein or other m utants expressed from the
sam e prom oter, w hen a comparison of relative abundance is m ade between the
m utant protein, and the cross-reacting band and the w ildtype protein (for example
Fig. 4.9 D top panel, compared w ith Fig. 4.12 D top panel; all samples were run on
the same gel). It would therefore appear that the degradation of cdcl8p at the end
of S phase is one control that acts redundantly w ith others to prevent re-initiation
of DNA replication.
As m ost of the m utants constructed were able to sustain norm al growth when the
w ildtype cdcl8 was switched off, I decided to focus m y investigation on the 81cdcl8 S/O -W A and 81-cdcl8 S/O-WB strains which were unable to rescue the 81cdcl8 S/O strain in the presence of thiamine.
4.5 Quantitative analysis of the NTP binding (WA) and
hydrolysis (WB) mutants
As p rev io u sly described the phenotype of the 81-cdcl8 S/O -W A strain is
indistinguishable from that of the 81-cdcl8 S/O-JK strain after thiam ine addition
suggesting that the cdcl8-WA-3HA protein is non-functional. The 81-cdcl8 S/O-WB
strain is capable of initiating DNA replication w hen the w ildtype protein is
depleted by thiam ine addition as the cells arrest w ith a 2C DNA content and
becom e elongated indicative of cell cycle arrest. H ow ever, by 10 hours after
thiam ine addition cells contain septa and fragm ented nuclei indicating that the cell
cycle arrest has not been m aintained and cells have attem pted mitosis. I quantified
these observations in order to better understand the nature of the m utant defect.
Ill
Chapter 4 M utational an a ly sis of
cdc18
Cells fixed in 70% ethanol during the com plem entation tim ecourse described
p reviously w ere rehydrated in w ater. They w ere then stained w ith either
calcofluor to visualise septa, or DAPI to stain the DNA. The septation index and
percentage of abnormal nuclei were then determ ined at each tim epoint (Fig. 4.13).
Septation index rem ained relatively constant after addition of thiam ine in the 81cdcl8 S/O-JK and 81-cdcl8 S/O -W A strains. This can be explained as both strains are
unable to initiate either DNA replication or the checkpoint to inhibit mitosis, so
cells continue into mitosis and septation. Cytokinesis will proceed at a slow rate so
cell num ber increases slightly and a small proportion of the cell population contain
a septum . The 81-cdcl8 S/O-W B strain undergoes a transient decrease in the
percent of septated cells corresponding to the early arrest. This was confirmed by
the cell num ber data which showed a delay in cell num ber increase (Fig. 4.8 A). By
5 hours after the addition of thiamine, the septation index began to increase so that
by 10 hours it was at a similar level to that found in the other strains (Fig. 4.13 A).
The criteria used to determine nuclear abnormality was:
1) cells w ith a cut phenotype where the septum bisects a nucleus that has not been
segregated to the two cell poles
2) cells where one daughter has not received any genetic m aterial and therefore
does not contain a nucleus
3) fragm ented nuclei w ith several DAPI stained areas, some of which have a
norm al nuclear m orphology b u t are extremely small, other areas are diffuse,
spreading through the cell. Background staining always appears m uch higher
in these cells.
The 81-cdcl8 S/O-JK and 81-cdcl8 S/O -W A strains have a sim ilar percentage of
abnorm al nuclei. After thiam ine addition, abnorm al nuclei start to appear by 4
hours in both strains and the curve rises steeply so by 7 hours 80% of cells have a
nucleus w ith an abnorm al m orphology and by 9 hours alm ost 100% of cells
possess abnormal nuclei (Fig. 4.13 B). The 81-cdcl8 S/O-W B strain also accumulates
cells with abnormal nuclei but with a delay of approxim ately 2 hours compared to
the W alker A m utant. The curve is also less steep. Cells w ith abnorm al nuclei start
to increase after 4 hours in the presence of thiamine. This corresponds to the point
112
Chapter 4 M utational an alysis of
cdc18
at which the septation index starts to increase. By the 9 and 10 hour timepoints the
percentage of cells w ith abnormal nuclear material is about 80%. These data show
that the cdcl8-WB-3HA protein is able to initially block mitosis but not maintain
the block so the cells eventually enter m itosis resulting in abnorm al nuclear
m orphology (Fig. 4.13 B and 4.8 C).
4.6 The 81-cdcl8 S/O-WB and cdcl8-K46 mutants arrest with
the same kinetics but different terminal phenotypes
81-cdcl8 S/O-W B cells have a similar phenotype after the addition of thiamine as
the cdcl8-K46 tem perature sensitive m utant at the restrictive tem perature. Both
m utants elongate and arrest w ith a 2C DNA content. The two strains were
therefore compared to investigate w hether the inability to m aintain the block over
mitosis for a prolonged period, as seen in the W alker B m utant, was common to
both strains. The strains were grown to exponential phase at 25°C, the permissive
tem perature for the cdcl8-K46 m utant, then both were shifted to 36°C and thiamine
was simultaneously added to the 81-cdcl8 S/O-WB cells. Cells were incubated for 8
hours at 36°C and samples were taken at hourly intervals for FACS analysis, cell
num ber, septation index and the percentage of abnormal nuclei (Fig. 4.14).
The FACS analysis demonstrates that both strains m aintain a 2C DNA content (Fig.
4.14 A). The FACS peak does drift som ew hat th ro u g h o u t the tim ecourse,
presum ably due to cell elongation and increased background staining (Sazer and
Sherwood, 1990). In both m utants the cell num ber increase stops by 4 hours after
the shift to 36°C and addition of thiamine. However, the cdcl8-K46 cells begin to
increase in cell num ber again from 6 hours onw ards (Fig. 4.14 B). This is
presum ably due to the leakiness of the tem perature sensitive m utant. Septation
index and the percentage of cells w ith abnorm al nuclei w ere scored after
reh y d ra tin g fixed cells in w ater and staining w ith calcofluor and DAPI
respectively. The septation index demonstrates that both strains undergo an initial
decrease in the percentage of septated cells as they arrest. However, the septation
index begins to increase for cdcl8-K46 cells as they leak through the block at 6
hours (Fig. 4.14 C). The percentage of abnorm al nuclei also begins to increase at
this point for the cdcl8-K46 strain (Fig. 4.14 D). This w ould be expected as the cells
113
Chapter 4 M utational an alysis of
cdc18
have been unable to complete DNA replication successfully b u t have entered
mitosis. The 81-cdcl8 S/O-W B m utant strain accum ulates cells w ith abnorm al
nuclei at a m uch earlier stage, despite the septation index not increasing until 7-8
hours. By 5 hours after the additon of thiamine, 1 hour after cells have arrested, the
percentage of abnormal nuclei has increased to 25%. It then continues to increase
dram atically and by 8 hours after the addition of thiam ine, alm ost 95% of cells
have an abnormal nuclear morphology. This indicates that mitosis is not restrained
in these cells as it is in cdcl8-K46 cells so the checkpoint signal m ay not be initiated.
This result is som ew hat different to the expected result, as the initial data
suggested that the cdcl8-WB-3HA protein was able to initiate b u t not complete
DNA replication and initiated a checkpoint signal that led to a block over mitosis.
To investigate this further I examined the requirem ent for the checkpoint proteins
in the initial block over mitosis in the Walker B mutant. The 81-cdcl8 S/O-WB strain
was crossed w ith a rad3-136 m utant strain in order to isolate a checkpoint defective
81-cdcl8 S/O-WB rad3-136 strain. If the Walker B m utant cells do require an intact
checkpoint to establish the initial block that allows cell elongation, less elongation
w ould be expected after addition of thiamine in the checkpoint defective strain as
the cells w ould not arrest. The septation index would not decrease and cells would
accum ulate abnorm al nuclei at an earlier tim epoint as m itosis w ould not be
inhibited. Unfortunately, I was unable to make this strain as 81-cdcl8 S/O cells did
not form colonies after germination. The spores are able to germinate but cells can
undergo at m ost two or three divisions. This m ight be due to the low level of
cdcl8p in the cells. I have already stated that the cdcl8 protein levels produced
from the n m t81 prom oter are lower than w ildtype levels b u t that this level is
sufficient for a mitotic cell cycle. However, it does not appear to be sufficient for
cells to re-enter the mitotic cell cycle effectively after mating. The inability to cross
the strain has m eant that I have been unable to positively conclude that a
checkpoint signal is not sent to allow the initial cell cycle block. My results do
suggest that the mitotic checkpoint m ay not be initiated in the W alker B m utant,
however this needs further investigation.
114
Chapter 4 M utational an alysis of
cdc18
4.7 The 81-cdcl8 S/O-WB strain exhibits a delay over S
phase initiation after release from a HU block
To gain further insight into the defect of the 81-cdcl8 S/O -W B strain, a
H ydroxyurea (HU) block and release experim ent was perform ed to compare the
kinetics of S phase entry in a synchronous culture in the following strains: 81-cdcl8
S/O -JK th at is unable to com plem ent the depletion of w ildtype cdclSp after
addition of thiamine, the 81-cdcl8 S/O-wt strain that does complement as wildtype
protein is still produced and the 81-cdcl8 S/O-WB strain that I w ish to investigate.
All three strains were grown to exponential phase at 32°C, then HU was added to
block cells at the beginning of S phase and thiam ine was added 3 hours after the
addition of HU to switch off the w ildtype cdcl8 gene. Cells were released from the
HU block by filtering and w ashing three tim es in m inim al m edia containing
thiam ine then resuspending them in thiam ine containing m edia to m aintain
depletion of w ildtype cdclSp. Cells were incubated at 32°C to allow growth and
tim epoints were taken for FACS analysis every 20 m inutes for 3 hours (Fig. 4.15 A).
These cells w ere also rehydrated and stained w ith calcofluor and DAPI so they
could be scored for septation (Fig. 4.15 B) and percentage of binucleate cells (Fig.
4.15 C) to assess the synchrony of release into S phase.
All three strains complete the first S phase 40 to 60 m inutes after release from the
HU block. The 81-cdcl8 S/O-JK cells start to accumulate w ith a 1C DNA content at
100 m inutes. This increases to approxim ately 60% of the cells by 120 m inutes and
by 140 m inutes 90% of the cells are in C l (Fig. 4.15 A, a). Cells are able to complete
the first S phase as w ildtype cdclSp was present in the previous G1 to allow
form ation of the pre-replicative complex at origins. Cells undergo mitosis between
80 and 100 m inutes after release from the HU block as can be seen by the increase
in the percentage of binucleates (Fig. 4.15 C). Mitosis occurs soon after completion
of S phase as HU blocked cells elongate allow ing them to m eet the size
requirem ent for mitosis, cells therefore spend the m inim um time required in G2
(Fantes and N urse, 1978). The lack of w ildtype cdclSp after m itosis prevents
form ation of pre-replicative complexes and hence initiation of DNA replication.
Therefore w hen cells begin to septate, betw een 100 and 120 m inutes after release
from the HU block (Fig. 4.15 B), the G1 population of cells is first visualised. The
115
^
2S?
C\
O
^
LO
#F
:
5%^
C h a p te r 4 M utational analy sis of
cdc18
81-cdcl8 S/O -w t strain produces w ildtype cdcl8-3H A protein as the cells exit
m itosis approxim ately 80 m inutes after HU release as judged by the peak of
binucleate cells (Fig. 4.15 C). The septation index peaks at 100 m inutes (Fig, 4.15 B)
and a 4C DNA content shoulder is seen at this stage on the FACS profile as cells
initiate DNA replication sim ultaneously w ith septation (Fig. 4.15 A, b). The cells
rem ain w ith a 2C DNA content for the rest of the timecourse. Both the 81-cdcl8
S/O-JK, which is unable to undergo S phase but can still enter mitosis, and 81-cdcl8
S/O-wt strains show an increase in both the septation index and percent of
binucleate cells from 140 m inutes as cells are still long enough to m eet the size
requirem ent and the second mitosis is initiated relatively quickly.
The 81-cdcl8 S/O-WB strain also shows a peak of binucleate cells 100 minutes after
release from the HU block and the septation index peaks betw een 100 and 120
m inutes after release (Fig. 4.15 B and C). Therefore the kinetics of the first mitosis
are equivalent in all three strains. H ow ever, the FACS profile is som ew hat
different to both of the other strains (Fig. 4.15 A, c). Cells predom inantly have a 2C
DNA content at 100 minutes, by 120 minutes approxim ately 50% of the cells have a
DNA content of less than 2C and by 140 m inutes m ost cells have a DNA content of
less than 2C. The DNA content then gradually increases so by 180 m inutes is
betw een 1C and 2C. The cdcl8-WB-3HA protein is therefore able to initiate DNA
replication b u t w ith a delay of approxim ately 60 m inutes com pared to w ildtype
cells. The second mitosis is also delayed but only by approxim ately 40 minutes as
both the septation index and percent of binucleate cells starts to increase at the 180
m inute timepoint.
My previous data w ould suggest that although these cells have a 2C DNA content,
DNA synthesis has not been successfully completed as w e know that these cells
are unable to properly segregate the DNA w hen m itosis is attem pted. Cells
therefore appear w ith abnorm al nuclei. A checkpoint signal m ay not be sent in
these cells as the delay over initiation of the second mitosis com pared to the other
strains is only 40 m inutes. The DNA does not appear to be recognised as
incom pletely replicated. This could suggest a m ore direct link betw een the
w ildtype cdcl8p and initiation of the checkpoint signal. This will be discussed in
more detail later.
116
C h a p te r 4 M utational analy sis of
cdc18
4.8 Does cdclSp interact directly with the MCM proteins
As the m ain function of cdclSp is thought to be to load the MCM proteins onto
chrom atin it is possible that they interact at som e stage of the cell cycle. I
im m unoprecipitated cdclSp to see if it was able to interact w ith the Mcm4p
hom ologue, cdc21p, and vice versa. The intention was to look for an interaction
betw een cdc21p and the w ildtype cdclSp and then investigate w hether this
interaction w as either w eaker or lacking w hen the NTP binding (WA) and
hydrolysis (WB) m utants were expressed.
I initially tried to im m unoprecipitate cdclS-3HAp and cdc21p from exponentially
grow ing cells using antibodies to the HA tag and a cdc21 polyclonal antibody
(Nishitani et al., 2000). Three strains were used, 81-cdcl8 S/O-JK, 81-cdcl8 S/O-wt
and orpl-H A as a positive control for the anti-HA imm unoprécipitation. The orplHA p has previously been show n to im m unoprecipitate w ith anti-HA antibodies
(Grallert, 1996). Cells w ere grown to exponential phase at 32°C, harvested and
protein extracts were made. Im m unoprécipitations (IPs) w ere perform ed using
5mg of soluble protein. 5pl of either the 16B12 monoclonal anti-HA antibody or the
cdc21p polyclonal antibody was used for each IP. Either Protein G or Protein A
beads respectively, were then added to the extract/antibody mix. Protein A beads
alone were included w ith the cdc21p IP as a negative control as a cdc21A strain is
not viable and the MCM proteins are too stable for a sw itch off strain to be
effective.
The total protein extract before im m unoprécipitation and the im m unoprecipitate
w ere run sim ultaneously on a 10% SDS PAGE protein gel. The IP was lOx more
concentrated than the extract. A W estern blot of the anti-HA IP was first probed
w ith anti-HA antibodies. This show ed that orp l-H A p is m ore abundant than
cdcl8-3HAp (Fig. 4.16 A, top panel lanes 2 and 3). O nly a small am ount of the
cdcl8-3H A p is precipitated. This could be due to the instability of cdcl8p or
decreased efficiency of the IP. No band is recognised by anti-HA antibodies in the
81-cdcl8 S/O-JK lanes as w ould be expected (Fig. 4.16 A, top panel, lanes 1 and 4).
The anti-cdcl8p W estern confirms this result as the total extracts from each strain
contain w ildtype cdcl8p (Fig. 4.16 A, m iddle panel, lanes 1 to 3) but only the 81117
Chapter 4 M utational an alysis of
cdc18
cdcl8 SfO -wt cells contain cdcl8-3HAp (Fig. 4.16 A, m iddle panel, lanes 2 and 5).
These blots were next probed with the cdc21p antibody (Fig. 4.16 A, bottom panel).
There is an abundance of cdc21p in the total extracts and a band of the correct
molecular weight is also recognised in the pellet, how ever this is not enhanced in
the 81-cdcl8 S/O-wt IP compared to the cdcl8 S/O-JK IP. This band could be either a
cross-reacting band of the same molecular weight as cdc21p or a small am ount of
cdc21p could be precipitated in a non-specific m anner w ith the beads.
The W estern blot of the anti-cdc21p im m unoprecipitates was first probed with the
anti-cdc21p antibody. This shows that cdc21p is present in all of the total extracts
as expected (Fig. 4.16 B, top panel, lanes 1 to 3) and is im m unoprecipitated very
efficiently w hen the antibody is present (Fig. 4.16 B, top panel, lanes 4 and 5
com pared w ith 6). The blot was next probed w ith the anti-HA antibody. This
dem onstrated that the cdcl8-3HAp is present in the total extracts with the 81-cdcl8
S/O -w t but not the 81-cdcl8 S/O-JK cells (Fig. 4.16 B, bottom panel, lanes 2 and 3
com pared w ith 1). However, no cdcl8-3HAp was seen in the anti-cdc21p IP (Fig.
4.16 B, bottom panel, lanes 4 to 6). This confirmed the result w ith the anti-HA IP
that cdc21p and cdcl8-3HAp can not be im m unoprecipitated from exponentially
growing cells.
A Hydroxyurea block and release was perform ed to synchronise the cells and look
for an interaction at the cell cycle stage w hen the cdcl8p was thought to load the
MCM complex onto chromatin. This should maxim ise the chance of seeing an
interaction. The im m unoprécipitations w ere perform ed both w hen cells were
blocked at the start of S phase in HU and at two tim epoints after the release. The
81-cdcl8 S/O-JK and 81-cdcl8 S/O-wt strains w ere grow n to exponential phase at
32°C. Thiamine was then added to the 81-cdcl8 S/O -w t cells to deplete them of
untagged w ildtype cdcl8 protein. This was to ensure that only the tagged protein
w as available to interact w ith cdc21p to m axim ise the chance of seeing an
interaction. HU was added 30 minutes after the thiam ine and cells accumulated at
the block point at the beginning of S phase (Fig. 4.17 A). The first tim epoint was
taken after cells had been in HU for 3 hours. Cells were released from the block by
w ashing three times in m inim al m edia {81-cdcl8 S/O-JK), or m inim al m edia
containing thiam ine {81-cdcl8 S/O -w t), resuspended in the sam e media and
118
Chapter 4 M utational analy sis of
cdc18
incubated for 100 minutes at 32°C. The second and third tim epoints were taken 80
m inutes and 100 m inutes after release from the HU block. FACS sam ples were
taken in the block and every 20 m inutes during the release (Fig. 4.17 A). Both
strains completed the first S phase 40-60 m inutes after release and a 4C shoulder
was seen at 100 m inutes in the 81-cdcl8 SlO-wt strain indicating that the second S
phase had been initiated. This corresponds to the peak of septation for both strains
(Fig. 4.17 B). The percent of binucleate cells peaks at 80-100 m inutes (Fig. 4.17 C).
These results indicate that in the m ajority of cells, m itosis is com pleted by
approxim ately 80 m inutes and the following S phase is initiated by 100 minutes.
Therefore, the 80 and 100 m inute timepoints cover the w indow between the end of
m itosis and start of S phase w hen cdcl8p and cdc21p w ould be expected to
interact. Cells from the HU tim epoint should allow the interaction to be seen if it
persists after initiation of DNA replication.
The im m unoprécipitations were perform ed using cells from an HU block, 80 and
100 m inutes after release, as previously described. The anti-HA antibody was able
to im m unoprecipitate cdcl8-3HAp in all three tim epoints as an enriched band is
seen w ith both the anti-HA and anti-cdcl8p westerns (Fig. 4.17 D a, b and c, top
and m iddle panel, lane 4). The cdc21p band seen in the pellets is not enriched in
the 81-cdcl8 SfO -wt im m unoprecipitates (Fig. 4.17 D, a, b and c, bottom panels,
lanes 3 and 4). The cdc21p IP gave a similar result (Fig. 4.17 E). The cdc21p was
im m unoprecipitated very efficiently at each tim epoint w hen the antibody was
present but not w hen it was absent (Fig. 4.17 E, a, b and c lanes 4 and 5 compared
w ith lane 6). However, the cdcl8-3HA protein was not im m unoprecipitated with
the cdc21p antibody (Fig. 4.17 E, a, b and c, lanes 4 to 6). I was therefore still unable
to IP cdcl8p and cdc21p despite synchronising the cell cultures and perform ing the
im m unoprécipitations w hen there w as the greatest chance of detecting an
interaction. I was unable to use this as an assay for exam ining the defects of the
cdcl8p NTP binding and hydrolysis mutants.
An alternative to investigating an interaction betw een cdcl8p and cdc21p could be
to examine w hether the m utants were able to load cdc21p onto chromatin. It has
been reported recently that in fission yeast cdcl8p is required for chrom atin
association of cdc21p (Kearsey et al., 2000; Nishitani et al., 2000). I crossed a strain
119
Chapter 4 M utational an a ly sis of
cdcW
in which the cdc21p has been tagged w ith GFP at its C-term inus, w ith 81-cdcl8
S/O-JK, 81-cdcl8 SjO-wt, 81-cdcl8 S/O -W A and 81-cdcl8 S/O-WB. This w ould allow
me to use the m ethod developed by Kearsey et al. to investigate w hether cdc21GFPp was still able to bind chrom atin w hen w ildtype cdcl8p was depleted but
cdcl8-W A-3HAp or cdcl8-WB-3HAp were expressed. However, the 81-cdcl8 S/O
cells were again unable to form colonies following germ ination so I was unable to
perform the experiment. I have therefore been unable to provide further insight
into the biochemical defects of the cdcl8p NTP binding and hydrolysis m utant.
120
Chapter 4 M utational analy sis of
cdc18
D iscussion
C dclSp has a num ber of structural motifs that have im plications both for the
function and the regulation of the protein. To investigate the effect these motifs
have on cdclSp function, a site-directed m utagenesis of several dom ains was
perform ed. The m utants were expressed in a strain in which the w ildtype cdcl8
was under the control of a repressible prom oter The prom oter was switched off to
deplete cells of w ildtype cdclS protein and cells w ere exam ined to investigate
w hether they were still able to maintain growth. Only two m utants were unable to
sustain norm al growth. These w ere the NTP binding (Walker A) and hydrolysis
(Walker B) m utants and it is these that will be discussed in more detail.
The W alker A m utant appeared to be completely non-functional and acted as
though no cdcl8p was present in the cells. The 81-cdcl8 S/O-WA cells arrested with
the same phenotype and kinetics as the 81-cdcl8 S/O-JK strain in which only the
vector was integrated (Fig. 4.5, 4.7 and 4.13). This is consistent w ith results
obtained w ith the cdcl8-NTPp m utant (Chapter 2), which was also m utated in the
NTP binding dom ain. I discovered that this m utant was unable to initiate re­
replication w hen overexpressed in w ildtype cells, how ever it w as capable of
blocking mitosis (Fig. 2.2). As the N-term inus of cdcl8p was able to interact w ith
cdc2p (Fig. 2.4) and did not require the checkpoint rad a n d hus genes to block
m itosis (Fig. 2.7) I constructed a m utant in w hich the N -term inus of the cd cl8NTPp m utant was deleted, thus irradicating the dom inant cell cycle effect. When
overexpressed this m utant w as unable to either initiate re-replication or the
checkpoint (Fig. 2.8), indicating that the NTP binding motif was essential for both
functions. Results with the 81-cdcl8 S/O-WA strain lead to the same conclusion but
are more convincing as the m utant protein is expressed at endogenous levels, it is
the only copy of cdcl8p present in the cells and there is only a single amino acid
change, not two amino acid substitutions and a 149 amino acid deletion.
From this work it was known that the cdcl8-WA-3HA protein was non-functional
in that it was unable to initiate either DNA replication or the checkpoint, however I
did not know which aspect of protein function was defective. To understand the
121
Chapter 4 M utational a n aly sis of
cdc18
biochemical nature of the m utant there were several questions to answer. These
related to the interaction of the m utant protein with DNA and the MCM proteins. I
hypothesised that the cdcl8-WA-3HA protein w ould not bind to chrom atin as it
has been suggested that binding of ATP to some proteins stabilizes them in a
conformation in which they have a high affinity for chrom atin (Fujita et al., 1997;
Story and Steitz, 1992). This hypothesis could be tested in one of tw o ways. A
subcellular fractionation protocol to enrich for the chrom atin com ponent could be
used (Lygerou and Nurse, 1999; Nishitani et al., 2000). Alternatively a Chrom atin
Association (CHIP) assay could be performed in which proteins bound to DNA are
cross-linked w ith formaldehyde, DNA is sheared and antibodies to the protein of
interest are used to im m unoprecipitate the p ro tein /D N A complex. The crosslinking is reversed and PCR is used to amplify specific DNA sequences, in this case
origin DNA. Unfortunately, due to time constraints, these experim ents were not
performed.
I w ould also like to have determined whether the cdcl8-WA-3HA protein was able
to interact w ith the MCM proteins. As the m echanism of loading of MCMs onto
chromatin by cdcl8p is unknown, it is possible that the Walker A m utant would be
able to bind the MCM complex but not DNA. How ever I was unable to detect an
interaction by im m unoprécipitation betw een w ildtype cdcl8p and the Mcm4p
hom ologue, cdc21p so I did not perform any im m unoprécipitation experiments
w ith the m utant. There are several possibilities as to w hy an interaction between
the two proteins was not seen. The first relates to the stability of cdcl8p. As cdcl8p
is a very unstable protein m uch of the protein could have been degraded by the
end of the experim ent. This w ould greatly decrease the chance of seeing an
interaction. Another possibility is that the interaction betw een cdcl8p and cdc21p
is transient. They may interact solely for the loading step so are not present as a
com plex on the DNA. I tried to m aximise the chance of seeing a transient
interaction by blocking the cells at the beginning of S phase using HU, then
re le a s in g
cells
to
u n d e rg o
a
re la tiv e ly
s y n c h ro n o u s
cell
cycle.
Im m unoprécipitations were perform ed from cells judged to be in G l, G l/S and
early S phase. However, I was still unable to detect an interaction (Fig. 4.17). To
stabilize a brief interaction it may be possible to chemically cross-link the proteins
before perform ing the im m unoprécipitation. This has p ro v ed m oderately
122
Chapter 4 M utational an a ly sis of
cdc18
successful w hen im m unoprecip itating H sCdc6p w ith either HsM cmSp or
HsMcmZp (Fujita et ah, 1999). However, it is suggested that m ost of the HsMCM
complexes are loaded onto chromatin away from sites of HsCdc6p binding so only
a small proportion of the HsMCMs are complexed w ith HsCdc6p. To expand on
this hypothesis it is possible that C dcl8p in fission yeast facilitates binding of the
MCM proteins to chromatin b ut not through a direct interaction. It is possible that
w hen cdcl8p binds to the chrom atin it induces either a conformational change to
the DNA which allows MCM binding, or it results in the exposure of another
protein that is able to interact w ith the MCM complex. The final alternative is that
cdcl8p binds to a MCM complex that does not contain cdc21p. There is evidence
that the MCM proteins form a range of sub-com plexes that possess different
functions, in both fission yeast and higher eukaryotes (Adachi et al., 1997; Ishimi,
1997; Ishimi et al., 1998; Pasion and Forsburg, 1999; Sherm an and Forsburg, 1998;
Sherm an et ah, 1998). H ow ever, Sherm an et al. w ere also unable to
im m unoprecipitate cdcl8p and MCM subunits despite trying w ith mcm2p, 4p and
6p (Sherman et al., 1998). This suggests that cdcl8p m ay not load the MCMs
through a direct interaction.
To investigate w hether the cdcl8-WA-3HA protein could load the MCM proteins,
either the subcellular fractionation chromatin assay m entioned previously or an in
situ chrom atin assay could be used (Kearsey et al., 2000). The in situ chromatin
assay uses a GFP-tagged cdc21p which is detected by GFP fluoresence after the cell
is perm eabilized by enzymatic digestion and w ashed w ith a non-ionic detergent.
Only proteins that are bound to chrom atin will rem ain in the nucleus after this
procedure. As discussed earlier, I attem pted to construct strains in which the
nmt81-cdcl8, triple-HA tagged m utants and cdc21-GFP were all present. However
this was unsuccessful due to the fact that the 81-cdcl8 S /0 strains did not form
colonies after germination. I believe that this is due to cdcl8 protein levels being
too low to allow cells to re-enter the mitotic cell cycle. This could be addressed by
expressing cdcl8 on a m ulticopy plasm id to increase protein levels while the two
strains mate. The plasm id could then be lost after colony form ation by growing in
non-selective media. Alternatively a new strain could be constructed in which the
w ildtype cdcl8 is placed under the m edium strength nmt41 promoter. The protein
level m ay be slightly higher than the w ildtype b u t if only one integrated copy is
123
Chapter 4 M utational an aly sis of
cdc18
present there should be sufficient cdclSp to allow the 41-cdcl8 S/O strain to
germinate but not sufficient to induce re-replication.
The W alker B m utant has a different phenotype to the W alker A m utant. An
exponentially growing population of cells initially arrests w ith a 2C DNA content
on depletion of wildtype cdcISp but cells later enter mitosis (Fig. 4.8 and Fig. 4.13).
This is different to the cdcl8-K46 tem perature sensitive m utant which also arrests
w ith a 2C DNA content and the same kinetics as 81-cdcl8 S/O-WB after a shift to
the restrictive tem perature indicating that they have the sam e block point.
How ever the 81-cdcl8 S/O-WB cells accumulate abnorm al nuclei at a m uch earlier
stage than cdcl8-K46 suggesting that they are unable to m aintain the checkpoint
arrest (Fig. 4.14).
The HU block and release experiment indicates that the 81-cdcl8 S/O-WB cells are
delayed on entry into S phase (Fig. 4.15). There could be several explanations for
this, depending on w hat the function of ATP hydrolysis is. Replication initiation
m ay occur at a slower rate if the cdcl8-WB-3HA protein is unable to hydrolyse
ATP. Alternatively only a subset of origins m ay fire or some of the components of
the pre-replicative complex m ay not be loaded onto chrom atin. To investigate
w hich of these options may be correct a num ber of techniques could be used. The
chrom atin assay and in situ chromatin assay w ould allow us to determine whether
the cdcl8-WB-3HA protein and cdc21p are able to bind to chrom atin and could
give an indication as to whether less protein is loaded. A more detailed analysis to
determ ine which proteins were able to bind to origin DNA and w hether initiation
proteins were loaded only onto a subset of origins could be achieved using the
CHIP assay. This w ould give an indication as to w hether fewer origins assembled
the pre-replicative complex that w ould be required to allow S phase initiation.
H ow ever, to determ ine unequivocally w hether only a subset of origins fired, 2dimensional agarose gel electrophoresis w ould have to be perform ed on a range of
origins (Brewer and Fangman, 1987). This is a technique that allows the separation
of DNA fragm ents according to two param eters, first size and second topology.
The DNA molecules are detected by hybridization and the presence of a bubble arc
indicates that an origin fired within the detected fragment.
124
C h a p te r 4 M u ta tio n a l a n a ly s is of
cdc18
T he m o st p u z z lin g p h e n o ty p e of the 81-cdcl8 S/CTstrain is th a t it a p p e a rs u n a b le to
m a in ta in a c h e c k p o in t signal to in h ib it m itosis. U n fo rtu n a te ly , I h a v e b een u n ab le
to e sta b lish w h e th e r the 81-cdcl8 S/O -W B cells are ab le to in itia te a ch ec k p o in t
w h ic h later beco m es defective, or w h e th e r the c h ec k p o in t signal is n e v e r sent, d u e
to a n in a b ility to c o n stru c t a n 81-cdcl8 S/O -WB c h e c k p o in t d efectiv e strain . A n
a lte rn a tiv e w a y of in v e stig a tin g w h e th e r a ch ec k p o in t sig n al is in itia te d w o u ld be
to look for a ctiv atio n of eith er the c h k lp or c d s lp kinases im p lica te d in th e d am ag e
a n d re p lic a tio n c h e c k p o in t re sp e c tiv e ly . A c tiv a tio n o f c h k lp is d e te c te d as a
b a n d sh ift th a t occurs in resp o n se to d a m a g in g a g en ts a n d is th o u g h t to b e d u e to
a u to p h o s p h o ry la tio n (W alw o rth a n d B ernards, 1996). C d s lp a ctiv a tio n is d e te cted
b y e x a m in in g th e k in ase activity u sin g M yelin Basic P ro te in (MBP) as a su b stra te
(L in d say et al., 1998). T he level of m ik lp co u ld also be in v e stig a te d as it h a s b een
sh o w n to a c c u m u la te in re s p o n s e to sta lle d re p lic a tio n (B o d d y e t al., 1998;
C h risten sen et al., 2000).
If a ch ec k p o in t signal is n o t se n t in the W alker B m u ta n t it is p o ssib le th a t the cell
e lo n g a tio n seen is c au sed b y a C l d e lay p rio r to rep lica tio n in itiatio n as a differen t
se t o f c o n tro ls o p e ra te s to in h ib it cdc2p at th is stag e. H o w e v e r, e x p o n e n tia lly
g ro w in g cells d o n o t a c c u m u la te w ith a 1C D N A c o n te n t a fte r d e p le tio n of
w ild ty p e c d c l8 p . Lack of a c h eck p o in t signal w o u ld m e a n th a t the D N A w as n o t
reco g n ised as in co m p letely rep lica ted b y the ch ec k p o in t ra d p ro te in s w h ic h could
in d ic a te a d ire c t lin k b e tw e e n c d c l8 p fu n c tio n a n d th e c h e c k p o in t sig n al. In
s u p p o r t of th is, a cu t5 / r a d 4 m u ta n t allele, rad4-116, is ab le to in itia te D N A
re p lic a tio n b u t is d e fic ie n t in th e c h e c k p o in t (M c F a rla n e e t ah, 1997). T he
im p lic a tio n of th ese re su lts co u ld le a d to the h y p o th e s is th a t a c o m p lex o n th e
D N A is in v o lv e d in se n d in g a ch eck p o in t signal, ra th e r th a n rep lica tio n stru ctu res.
T he ch eck p o in t co u ld be in itiated b y a com plex on the D N A th at is eith er a ltere d or
a b se n t w h e n th e cdcl8-W B -3H A p is ex p ressed . A lte rn a tiv e ly A T P h y d ro ly sis m ay
re s u lt in the rem o v a l of c d c l8 p fro m the c h ro m a tin a n d it m ay be a lack of c d c l8 p
th a t is re q u ire d to se n d a c h ec k p o in t signal. A c arefu l c h a ra c te riz a tio n of w h ich
p ro te in s are b o u n d to c h ro m a tin w h e n b o th the cdc 18-W A -3H A p a n d cdcl8-W B 3 H A p are ex p re ssed m ay facilitate o u r u n d e rs ta n d in g of h o w the ch eck p o in t signal
is sent.
125
C h ap ter 4 M u tatio n a l a n a ly s is of
cdc18
T h ere is still m u ch to u n d e rs ta n d a b o u t the fu n ctio n of c d cIS p a n d th e analysis
p e rfo rm ed so far has su g g ested a w ay to p ro ceed ra th e r th a n so lv ed any problem s.
C d c IS p fu n c tio n a n d re g u la tio n w ill be d isc u sse d in m o re d e ta il in the n ex t
ch ap ter, p a rticu la rly in relation to results from o th er organism s.
126
B
A a
ar
a
-T
1 ho u r+ T
E
I h o u r+ T
2 hours +T
2 hours +T
d
3 hours +T
3 hours +T
c
I
<
Q
U
4 hours +T
4 hours +T
Forward Scatter
DNA content (C)
+T
wt
-T
1hr
2 hr
3 hr
4 hr
83
62
—
anti-cdclS p
47.5
anti-a-tubulin
Figure 4.1
Characterization of the 81-cdcl8 S/O strain
Thiamine was added to an exponentially growing 81-cdcJ8 S/O culture and the phenotype
of the cells was followed for 4 hours by FACS analysis (A) and DAPI staining (B) Bar 15
pm. Protein levels were determined by Western blotting with anti-cdcl8p antibody (C top
panel) and anti-a-tubulin antibody (C bottom panel). 50pg of protein was loaded per lane.
pJK 148-gcdcl8 -T
pJK148-T
a
g
pJK 1 4 8 + T Ih r
pJK 148-gcdcl8 +T 5hr
h
p JK 1 4 8 + T 2 h r
pJK 148-gcdcl8 +T lOhr
p JK 1 4 8 + T 3 h r
pIR T 2-gcdcl8 -T
p JK 1 4 8 + T 5 h r
p IR T 2 -g c d c l8 + T 5 h r
pJK 1 4 8 + T lOhr
pIR T 2-gcdcl8 +T lOhr
I
I
I
I I
I
1 2
4
DNA content (C)
Forward Scatter
1 2
4
DNA content (C)
Forward Scatter
Figure 4.2
A 5.2kb genomic fragment of cdcl8 (gcdclS) complements the 81-cdcl8 S/O strain
both when integrated and when expressed from a multicopy plasmid
The 8 1-cdc 18 S/O strain was transformed with pJK148, pJK 148-gcdcl8 and pIRT2gcdcl8. Thiamine was added to exponentially growing cultures and the ability to comp­
lement the switch off phenotype was exam ined for 10 hours by FACS analysis (A).
B
100000
Cell num ber
81-cdcl8 S/O pJK148
81-cdcl8 S/O pJK148-cdcl8
10000
-
•O- - - -
8l-cdcl8 S/O pIRT2-cdcl8
1000
T im e (hr)
81-cdcl8S/OpJK148-T
81-cdcl8 S/OpJK148-gcdcl8 -T
\
••
81-cdcl8 S/O pJK148 +T 5hr
81-cdcl8 S/OpJK148 +T lOhr
81-cdcl8 S/OplRT2-gcdcl8 -T
V
81-cdcl8 S/OpJK148-gcdcl8 +T 5hr
81-cdcl8 S/OpIRT2-gcdcl8 +T 5hr
f
i
81-cdcl8 S/OpJK148-gcdcl8 +T lOhr
81-cdcl8 S/OpIRT2-gcdcl8 +T lOhr
Figure 4.2 B and C
Cell number was followed for 10 hours after the addition of thiamine (B). Cells were fixed
and stained with DAPI (C). Bar 15(xm.
-2 5 0
AG G TTCG CG C G TA GA ACG CG ACA CG ACACG TAG AG TTG AACGCGACATCTCA TTTA CTCTTCGTG ATTA A
-1 8 0
TTA GA TTTC GCG TTTA CG TGTCGC GTC GC GTA TATTTATA AA AG ACA TA TCTG CTC TTAA AC AA AAC TTA AA CAC CA AGC AC GAA GTTAA
-9 0
TA TTA C TTA G TA G C C C TT TTA T C A A A T TTA C CTG A C TTG TCTA TTG G TA A A TA A C A TA A TTA G TA A A CG G G G TTA CTA TA A A G TA TCG A T
1
1
A TG TG TG A A A CTC CA A TA G G TTG TC A lA C A CC TCG A A G A rG C A A TC G TTTT A TA G A T TC TG C A G C C TTG A TT G A C TG T A C T A A C A A A A C T
M C
E
T
P
G
C
H
r
P
R
R
:
n
r
f
i
d
s
a
a
l
i
d
c
t
n
k
t
91
31
A A TC A A A G G G A G C A T T C A C C T T C C T T T T C A A T A G A G A T T C C G A d ACACCCAGC AGA lUWVCGTACGCTGGCTAGCTCACATTTCCAA A C /
K
R
T L A
S S H
F Q
N
Q
R
E
B
S
181
61
C C CA CA A A / AGAATAAAA rATGAA CTA GGA GA ACTGCAAG AG GA GA AAA CTG ACCTTTATCCTA ATTTTCCTGCTCA GTTA AA GG AGA AT
f
E
L
G
E
L
Q
E
E
K
T
D
L
Y
P
N
F
P
A
Q
L
K
E
N
P
T
K
R
I
K
271
91
AAGA AA CCTAAA TTA CCCACAACACCTCAAA CTCCTA A/ ACCCCCAAAAGC kcC A TTC A A A TTG TTA C A C C C A A A TC A TTA A A TC G TA C A
t
l
Q
I
V
T
P
K
S
L
N
R
T
K
K
P
K
L
P
T
T
P
Q
T
P
K
T
P
K
R
361
TG TA A TCC TG TT CCA TTTG CTA CTC G C CTTT TG C A A T CG lA C A C CTC A CC
C
N
P
V
P
F
A
T
R
L
L
Q
S
121
:a a c t t t t t c c t c c c a c t c c t t c g a c a c c c t c c a c t c c g
L
F
P
P
T
P
S
T
P
S
T
P
451
151
tcctataattctactgccaaattgagtttacgtaaatcatatcgttcagcaggagtcgtgggtcgtgaaaatgagaagtcaattgtggaa
541
181
T C TTTC TTTC G TC A A C A TC TTG A TG CTA A TG CTG G A G G TG CA TTG TA C G TA A G TG G TG C CCC TG G CA CA G G A A A G A CC3TTCTG CTTC A C
S
F
F
R
Q
H
L
D
A
N
A
G
G
A
L
Y
V
S
G
A
P
G
T
G
K
T
V L L H
631
211
A A CG TGCTGG ATC A TG TA G TG A G C G A TTA TCCC A A A G TTA A TG TTTG TTA C A TTA A TTG TA TG A CTA TTA A TG A A CCA A A A G CA A TTTTT
N
V
L
D
H
V
V
S
D
Y
P
K
V
N
V
C
Y
I
N
C
M
T
I
N
E
P
K
A
I
F
721
241
GAAA AA ATTCACTCTA AA ATTGTTA AA GA GGA AA TTTTAGA AA ATG AA GA TCA TCA CATCAA TTTCCA ATG TGA ACTAG AGTCGCATTTC
E
K
I
H
S
K
I
V
K
E
E
I
L
E
N
E
D
H
H
I
N
F
Q
C
E
L
E
S
H
F
811
271
A C C C A G T C C G CC A A TG A A TTA TA TA A C CC A G TCA TTA TTG TTTTA 3A T G A A A TG G A T:A CTTG A TTG CTCG CG A A CA G CA G G TTCTG TA C
A R E Q Q V L Y
A N
E
L
Y
N P
V
I
D E
H
D
T
Q
901
301
A C G C TTTTT G A A TG G C C CTC TCG A CC G A CTTC G A G A TTA A TTTTG G TA G G CA TTG CA A A TG CC TTA G A C A TG A C A G A TCG A TTTCTCCC T
T
L
F
E
W
P
S
R
P
T
S
R
L
I
L
V
G
I
A
N
A
L
D
M
T
D
R
F
L
P
991
331
CG TTTA CG A A CA A A G CA TA TTA CTC CC A A A TTA CTC TCTTTTA C G C CTTA TA C TG C TCA A G A A A TC TCA A CA A TTA TA A A A G C G C G TTTG
R
L
R
T
K
H
I
T
P
K
L
L
S
F
T
P
Y
T
A
Q
E
I
S
T
I
I
K
A
R
L
1081
361
A A A A C C G C C G C T A C C A C A T C A G A A A A A A A C A A T C C T m ACTCCTATTAA A rCAA TCTCTG AA GTA AGC GA TGA TAG TATAA ATG TTGTA
D
S
I
N
V
V
T
A
A
T
T
1171
391
TCTCA GCA TGCTGA TG AAA CA CCTTTTA TA C A TC CTG CTG CA A TTG A A TTA TG TG CCC G G A A A G TTG C A G C TTC A A G TG G TG A CTTG A G A
S
Q
H
A
D
E
T
P
F
I
H
P
A
A
I
E
L
C
A
R
K
V
A
A
S
S
G
D
L
R
1261
421
AAAGCATTAGACATATGTAGGCATGCAA TTGA ACTTGCGG AA AGA GA ATG GA AA GCTCAA CA TGA CAA CA CA TTATCTTCTGTTGA TATA
K
A
L
D
I
C
R
H
A
I
E
L
A
E
R
E
W
K
A
Q
H
D
N
T
L
S
S
V
D
I
1351
451
CCAA GAG CA TCA ATTGCTCATGTTG TCCGA G CG A C A TC TG C TA TG A G CC A A TCTG CTA G TG CTC G TTTA A A A A A C CTTG G TC TTC A A C A G
P
R
A
S
I
A
H
V
V
R
A
T
S
A
M
S
Q
S
A
S
A
R
L
K
N
L
G
L
Q
Q
1441
481
AA AG CCA TCC TTTG TA CG C TTG TTG T TTG T G A A A A A A CCT CA T TG A G TG TTG CCG A TG TA T TTG A A A A A TA C A G T TCTT TG TG TCT TCG A
K
A
I
L
C
T
L
V
V
C
E
K
T
S
L
S
V
A
D
V
F
E
K
Y
S
S
L
C
L
R
1531
511
G A TC G TTTG A T TTA T C C A TTA A C A A G TTCG G A A TTTTG C G A TG TC G C G A A TTC TTTA G A A A C TCTTG C A A TCA TTCG TTTG CG C A C G A A G
D
R
L
I
Y
P
L
T
S
S
E
F
C
D
V
A
N
S
L
E
T
L
A
I
I
R
L
R
T
K
1621
541
CA G C G TA A CG G A A A G CC TCA G G A CCGA ATCATTAGTTTG CTTG TTCCAG AA ATG GA TGTCATTACA GCTGTTGGA GA CA TTGG TA CCTTA
Q
R
N
G
K
P
Q
D
R
I
I
S
L
L
V
P
E
M
D
V
I
T
A
V
G
D
I
G
T
L
1711
571
AA ACGA TTTTTTGA CAG AA GA TAG TACTATCATTTCTTTCTCATTCTTTTTTTCTATTCATTATA TTTTTATTTCA CG CGTTACGGTTTT
K
R
F
F
D
R
R
1801
C A A A TTTTG C C G A A A G G A TC A A A TTA G A A CA TCCT TTCA A TT TCG TTG T TTG G A T TA C A TA A A TTTG A A C A A TA TT A TTT A TC CA A CTT G
1891
G T G T T T A A A C T TTTC A G G TTG A TC TTTA C TA A TTT TA C TA A C TA TA C A A TTA A TA A A C A C TTTA A TC TA A G TT
S
Y
N
S
T
A
K
L
S
L
R
K
S
Y
R
S
A
G
V
V
G
R
E
N
E
K
S
I
V
E
Figure 4.3
cdc 18 DNA and protein sequences and motifs
=W alker A box (WA) CZl =W alker B box (W B) \Z3 =Putative nuclear localization
signal (N l) I
I ^Putative nuclear localization signal (N2) I
phosphorylation site (P I-6)
I^Putative cdc2p consensus
cdclS locus
nm t cassette
4
9.1 kb
cdc 18
r
t
B am H l
B am H l
leul locus
B am H l
B am H l
leul
14.8kb
B am H l
pJK 148-gcdc 18-3HA
le u l
B am H l
10.4kb
c d cl8 -3 H A
B am H l
leul locus with pJK148-gcdcl8-3HA integrated
leul
I
B am H l
B am H l
4.2kb
leul
cd cl8 -3 H A
B am H l
1.4kb
a
B am H l
B am H l
2.9kb
17.7kb
Figure 4.4
pJK148 and pJK148-gcdcl8-3HA and mutants are all integrated at the leul locus in
the 81-cdcl8 SIO strain
Map to demonstrate the altered band pattern on integration of pJK 148-gcdc 18-3HA and
mutants (A).
B
I
i
00
I
â
oo
00
kb
11
7
-
6
—
5
-
4
—
3
-
leul
kb
11
10,
E
8
-
7
-
5
-
4
-
3
-
2
-
6 cdcl8
Figure 4.4 B
Southern blets o f the integrated strains probed with either leuJ (top panel) or cd cl8
(bottom panel) (B).
100000
C ell num ber
-O
<y
Sl-cdclS S /O -JK -l
8 1 -cd cl8 S /0 -J K + l
10000-
.O
T im e (hrs)
B
a
81-cdcl8S/0-JK -i:
81-cdc 18 S/O-JK +T 5hrs
81-cdcl8S/0-JK + l 1 hr
81-cdcl8 S/O-JK +T lOhrs
u
1 2
4
D N A content (C)
Forw ard Scatter
1 2
4
D N A content (C)
F orw ard Scatter
Figure 4.5
The vector pJK148 does not complement the 81-cdcl8 SIO strain when integrated
at the leul locus
The 81 -cd cl8 S/O strain containing the pJK148 vector integrated at the leu l locus (81cd cI8 S/O-JK) was grown exponentially before the cultures were split and thiamine was
added to half. Cells were then followed for 10 hours by cell number (A) and FACS analysis
(B).
81-cdcI8 S/O-JK -T
8 l-cd cl8 S /0 -JK V Ï5 h xs
8l-cdcl8 S/O-JK+ T \\ïr
81-cdcI8 S/O-JK+T lOhrs
I
cdc 18-HA
cd cIS p (w t)
cross reacting band
anti-cdcIS p
anti-H A
anti-a-tu b u lin
Figure 4.5 C and D
DAPI staining was perform ed both before thiam ine was added and 1, 5 and 10 hours
after the addition o f thiamine (C). Bar 15pm. Protein levels were determined by Western
blotting both before the addition of thiamine and 1 hour after. 50pg o f protein was loaded
per lane. Blots were probed with an ti-cd cl8 p antibody (top panel), anti-H A antibody
(middle panel) and anti-a-tubulin antibody (bottom panel) (D).
100000
C ell num ber
-O
81-cdcl8 S/O-wt -T
•O -
81-cdcl8S/0-w t+T
10000-
T im e (hrs)
B
1
u
81 -cdc 18 S/O-wt +T 1hr
b
3
1
81-cdcl8 S/O-wt +T 5hrs
81-cdc 18 S/O-wt -T
1 1
1
1 2
4
D N A content (C)
1
I
(d
81-cdcl8 S/O-wt +T lOhrs
!
I■d
1a
3
Forw ard Scatter
1 1
1
1 2
4
D N A content (C)
Forw ard Scatter
Figure 4.6
pJK148-gcdcl8-3HA does complement the 81-cdcl8 S/O strain when integrated at
the leul locus
The 81-cdcl8 S/O strain containing pJK 148-gcdc 18-3HA integrated at the leul locus (81c d cl8 S/O-wt) was grown exponentially before the cultures were split and thiamine was
added to half. Cells were followed for 10 hours by cell number (A) and FACS analysis
(B).
cdcl8 S/O-wt-1
cdcIS S/O-wt +T 5hrs
cdclS S/O-wt +T Ihr
cdcIS S/O-wt+1 lOhrs
cdc 18-HA
anti-cdcISp
cdcIS p (wt)
cross reacting band
anti-HA
anti-tubulin
Figure 4.6 C and D
DAPI staining was performed both before thiamine was added and 1, 5 and 10 hours
after the addition of thiamine (C). Bar 15pm. Protein levels were determined by Western
blotting both before the addition of thiamine and 1 hour after. 50pg of protein was loaded
per lane. Blots were probed with anti-cdcl8p antibody (top panel), anti-HA antibody
(middle panel) and anti-a-tubulin antibody (bottom panel) (D).
100000
Cell num ber
cdcl8S/0-W A -l
cdcl8S/0-WA+Y
— O - - - cdcl8 S/O-JK +T
10000-
Tim e (hrs)
B
1 2
cdcl8S/0-WA-T
cdc18 S/O-WA +T 5hrs
cdcI8 S/O-WA +T Ihr
cdcl8S/0-WA+T lOhrs
1 2
4
DNA content (C)
Forward Scatter
4
DNA content (C)
Forward Scatter
Figure 4.7
pJK148-gcdcl8-3HA WA does not complement the 81~cdcl8 SIO strain when integrated
at the leul locus
The 81-cdcl8 S/O strain containing pJK 148-gcdc 18-3HA WA integrated at the leul locus
{81-cdcl8 S/O-WA) was grown exponentially before the cultures were split and thiamine
was added to half. Cells were then followed for 10 hours by cell number (A) and FACS
analysis (B).
cdcI8 S/O-WA -T
cdcl8SIO -W A+T5\as
•
cdcl8 S/O-WA +T Ih r
cdcl8 S/O-WA +T lOhrs
cdc 18-HA
c d cIS p (w t)
cross reacting
eacting band
anti-cdcIS p
anti-H A
anti-tubulin
F igure 4.7 C and D
DAPI staining was performed both before thiam ine was added and 1, 5 and 10 hours after
the addition o f thiam ine (C). B ar 15pm. Protein levels w ere determ ined by W estern
blotting both before the addition o f thiamine and 1 hour after. 150pg o f protein was loaded
per lane. Blots w ere probed w ith an ti-cd cl8 p antibody (top panel), anti-H A antibody
(middle panel) and anti-a-tubulin antibody (bottom panel) (D).
100000
C ell num ber
81-cdcl8 S/O-WB-T
81-cdcl8 S/O-WB+T
O
. . . O - - - 81-cdcl8 S/O-JK +T
f-o -^
10000-
T im e (hrs)
B
8 l-cd cl8 S/O-WB-T
81-cdcl8 S/O-WB +T 5hrs
81-cdcl8 S/O-WB +T Ih r
81-cdcl8 S/O-WB +T lOhrs
I
I
I
1 2
4
D N A content (C)
1 2
F orw ard Scatter
4
D N A c ontent (C)
Forw ard S catter
Figure 4.8
pJK148-gcdcl8-3HA WB does not complement the 81-cdcl8 S/O strain when integrated
at the leul locus
The 81-cd cl8 S/O strain containing pJK 148-gcdc 18-3HA WB integrated at the leu l locus
{81-cdcl8 S/O-W B) was grown exponentially before the cultures were split and thiamine
was added to half. Cells were then follow ed for 10 hours by cell num ber (A) and FACS
analysis (B).
cdcl8 S/O-WB-T
cdcl8 S/O-WB-^TShrs
cdcl8 S/O-WB-^-T Ihr
cdcl8 S/O-WB-^T lOhrs
cdc 18-HA
anti-cdcISp
cdcISp (wt)
cross reacting band
anti-HA
anti-tubulin
1
2
Figure 4.8 C and D
DAPI staining was performed both before thiamine was added and 1, 5 and 10 hours after
the addition of thiamine (C). Bar 15pm. Protein levels were determined by Western
blotting both before the addition of thiamine and 1 hour after. 150pg of protein was
loaded per lane. Blots were probed with anti-cdcl8p antibody (top panel), anti-HA
antibody (middle panel) and anti-a-tubulin antibody (bottom panel) (D).
100000
C ell num ber
-O
cd c l8 S /0 -N l -T
O-
cd cl8S /0-N l +T
10000 -
T im e (hrs)
B
1 2
cdcl8S /0-N l -T
cdcl8S /0-N l + T 5 h rs
cdcl8S /0-N l +T Ih r
cdcl8 S/O-Nl +T lOhrs
1 2
4
DN A content (C)
F orw ard Scatter
4
D N A content (C)
Forw ard Scatter
Figure 4.9
pJK148-gcdcl8-3HA NLSl does complement the 81-cdcl8 S/O strain when integrated
at the leul locus
The 81 -cd clS S/O strain containing pJK 148-gcdc 18-3HA N L S l integrated at the le u l
locus {8 1 -cd cl8 S /O -N l) was grown exponentially before the cultures were split and
thiamine was added to half. Cells were then followed for 10 hours by cell number (A) and
FACS analysis (B).
cdc 18 S/O-NI -T
cdcIS S/O-Nl +T 5hrs
cdcl8 S/O-Nl +T Ih r
cdcl8 S/O-Nl +T lOhrs
c d cl8 -H A
c d cIS p (wt)
cross reacting band
a nti-cdcIS p
anti-H A
anti-tubulin
Figure 4.9 C and D
DAPI staining was performed both before thiamine was added and 1, 5 and 10 hours after
the addition o f thiam ine (C). B ar 15p,m. Protein levels w ere determ ined by W estern
blotting both before the addition of thiamine and 1 hour after. 50pg of protein was loaded
per lane. Blots w ere probed w ith an ti-cd cl8 p antibody (top panel), anti-HA antibody
(middle panel) and anti-a-tubulin antibody (bottom panel) (D).
100000-
C ell num ber
-O —
c d c l8 S /0 -N 2 -l
O
cdcl8 S/0-N 2+1
10000-
T im e (hrs)
B
a
cdcl8S/0-N 2-i:
cdcl8 S/0-N2 +T Ih r
C
cdcl8 S/0-N2
5\as
cdcl8 S/0-N2 +T lOhrs
I
8
<
-m
Q
1 2
4
D N A content (C)
Forw ard Scatter
1 2
4
DN A content (C)
Forw ard Scatter
Figure 4.10
pJK148-gcdcl8-3HA NLS2 does complement the 81-cdcl8 SIO strain when integrated
at the leul locus
The 81 -cd cl8 S/O strain containing pJK 148-gcdc 18-3HA NLS2 integrated at the leu l
locus {81-cd cl 8 S /0 -N 2 ) was grown exponentially before the cultures were split and
thiamine was added to half. Cells were then followed for 10 hours by cell number (A) and
FACS analysis (B).
cdcI8 S/0-N2 -T
cdcI8 S/0-N2 +T 5hrs
cdcI8S/0-N 2+T Ihr
cdcl8 S/0-N2 +T lOhrs
cdc 18-HA
cd cIS p (wt)
cross reacting band
an ti-cd clS p
anti-H A
anti-tubulin
Figure 4.10 C and D
DAPI staining was performed both before thiamine was added and 1, 5 and 10 hours after
the addition o f thiam ine (C). Bar 15p.m. Protein levels were determ ined by W estern
blotting both before the addition o f thiamine and 1 hour after. 150pg of protein was loaded
per lane. Blots were probed with an ti-cd cl8 p antibody (top panel), anti-HA antibody
(middle panel) and anti-a-tubulin antibody (bottom panel) (D).
100000-
C ell num ber
81-cdcl8 S/O-Nl +N2 -T
10000-
T im e (hrs)
B
81-cdcl8 S/O-Nl +N 2 -T
81-cdcl8 S/O-Nl +N2 +T Ih r
81-cdc18 S/O-Nl +N2 +T 5hrs
81-cdcl8S/0-NUN2-i-T lOhrs
I
i
I
1 2
4
D N A content (C)
F orw ard Scatter
1 2
4
D N A content (C)
Forw ard Scatter
Figure 4.11
gcdcl8-3HA-Nl+N2 does complement the 81-cdcl8 SIO strain when integrated at the
leul locus
The 81-cd cl 8 S/O strain containing pJK 148-gcdc 18-3 HA-N1+N2 integrated at the leu l
locus {81-cdc 18 S/0-N 1+ N 2) was grown exponentially before the cultures were split and
thiamine was added to half. Cells were then followed for 10 hours by cell number (A) and
FACS analysis (B).
81-cdcI8 S/O-Nl+N2-1:
81-cdc!8 S/O-Nl+N2 +T 5hrs
81-cdcl8 S/O-Nl+N2 +T Ihr
81-cdcl8 S/O-Nl+N2 +T lOhrs
§
Ô
Co
00
1
1^'
cdc 18-HA
anti-cd clS p
cd cIS p (w t)
cross reacting band
m
anti-H A
anti-tubulin
Figure 4.11 C and D
DAPI staining was performed both before thiamine was added and 1, 5 and 10 hours after
the addition o f thiamine (C). Bar 15p.m. Protein levels were determined by Western blotting
both before the addition o f thiamine and 1 hour after. 150p,g o f protein was loaded per lane.
Blots were probed with anti-cdcISp antibody (top panel), anti-HA antibody (middle panel)
and anti-a-tubulin antibody (bottom panel) (D).
looooa
Cell num ber
□ — 81-cdcl8 SIO-Pl-6 -T
-0
..... 81-cdcl 8 SIO-Pl-6 +T
10000-
T im e (hrs)
B
81-cdcl8S/0-P l-6-T
81-cdcl8S/0-Pl-6+T Ihr
1 2
4
DNA content (C)
Forw ard Scatter
c
81-cdcl8 SIO-Pl-6 +T 5hrs
81-cdcl8S/0-Pl-6+T lOhrs
1 2
4
DNA content (C)
Forw ard Scatter
Figure 4.12
gcdcl8-3H A-Pl-6 does complement the 81-cdcl8 SIO strain when integrated at the
leul locus
The 81-c d c l8 S/O strain containing pJK 148-gcdcl8-3H A -P l-6 integrated at the leu l
locus {81-cdc 18 S/O -P l-6) was grown exponentially before the cultures were split and
thiamine was added to half. Cells were then followed for 10 hours by cell number (A) and
FACS analysis (B).
81-cdcl8 S/O-Pl-6 -T
81-cdcl8 S/O-Pl-6 +T 5hrs
8I-cdcl8 S/O-Pl-6 +T Ih r
8I-cdcl8 SIO-Pl-6 +T lOhrs
VO
Q,
6
Co
00
c d cl8 -H A
6
Co
00
5Y
Y
00
00
»
an ti-cd c l8 p
c d c lS p (w t)
cross reacting band
anti-HA
anti-tubulin
1
2
Figure 4.12 C and D
DAPI staining was performed both before thiamine was added and 1, 5 and 10 hours after
the addition o f thiam ine (C). Bar 15pm. Protein levels were determ ined by W estern
blotting both before the addition of thiamine and 1 hour after. 50pg of protein was loaded
per lane. Blots were probed with an ti-cd cl8 p antibody (top panel), anti-HA antibody
(middle panel) and anti-a-tubulin antibody (bottom panel) (D).
40 Septation index (%)
81-cdcl8S/0-JK
30 -O
81-cdcl8S/0-WA
O
81-cdcl8S/0-WB
o
T im e (hrs)
B
100
80 -
O'
Abnorm al nuclei
81-cdcl8S/0-JK
60 -
40 -
20
-O
81-cdcl8S/0-WA
O
81 -cdcl 8 SIO- WB
-
o
Tim e (hrs)
Figure 4.13
Comparison of the kinetics of 81-cdcl8 SIO-JK, 81-cdcl8 SIO-WA and 81-cdcl8
SIO-WB
Cells fixed in 70% ethanol from the experiments described in Figures 4.5, 4.7 and 4.8
were rehydrated in water. They were then stained with either calcofluor to determine
the septation index (A) or with DAPI to follow the accumulation of abnormal nuclei
(B). 200 cells were counted for each timepoint.
cdcl8-K46
81-cdcl8S/0-W B ^-l
8
7
6
5
Tim e (hrs)
T im e (hrs)
4
3
2
1
0
2C
DNA content
D NA content
B
Cell num ber
10000
-
81-cdcl8 S/O-WB +T
cdcl8-K46
1000
00
CN
T im e (hrs)
Figure 4.14
The cdcl8-K46 mutant arrests with similar kinetics as 81-cdcl8 SIO-WB but with a
different terminal phenotype
The S l-c d c lS S/O-WB and cdcl8-K 46 strains were grown at 25°C to exponential phase.
The cultures were then shifted to 36°C and thiamine was added to 81 -cd cl8 S/O-WB.
Cells were then follow ed for 8 hours by FACS analysis (A) and cell num ber (B).
50
40
I
30
I
20
81-cdcl8 S/O-WB+ Ï
cdcl8-K46
o
m
o
00
T im e (hrs)
100
75
<u
1
81-cdcl8 S/O-WB +T
50
I
•O’....... cdcl8-K46
25
o
m
00
On
T im e (hrs)
F igure 4.14 C and D
Cells were rehydrated and stained with calcofluor to determine septation index (C) or
DAPI to determ ine the percentage of cells with abnormal nuclei (D). 200 cells were
scored for each tim epoint
8I-cdcl8 S/O-JK
81-cdcl8 S/O-wt
81-cdcl8 S/O-WB
180
160
140
120
100
a
a 80
80
80
60
40
20
HU
-T
1C
2C
4C
DNA content
1C
2C
4C
D N A content
1C
2C
4C
D N A content
Figure 4.15
The 81-cdcl8 SIO-WB strain completes S phase after release from an HU block then
initiates a second round of replication after a 60 minute delay
The 8 1 -c d c l8 S/O -JK , 8 1 -c d c l8 S/O -w t and 8 1 -c d c l8 S/O -W B strains w ere grow n to
exponential phase. HU was then added to the cultures to block the cells at the beginning
o f S phase. Thiam ine was added after 3 hours to switch o ff the wild type c d c l8 and cells
were released 30 m inutes later. Samples w ere taken for FACS analysis every 20 m inutes
for a further 3 hours.
B
40
30
81-cdcl8 S/O-JK
Septation index (%)
20
-T
HU 20
40
60
80
••O........
81-cdcl8 S/O-wt
-O - - - -
81-cdcl8 S/O-WB
100 120 140 160 180
T im e (m ins)
40
30
81-cdcl 8 S/O-JK
Binucleates (% )
O
20
81-cdcl 8 S/O-wt
•O *- ■• 81-cdcl 8 S/O-WB
10
0
-T
HU 20
40
60
80
100 120 140 160 180
Tim e (m ins)
F igure 4.15 B an d C
Cells were rehydrated and stained with calcofluor to determine septation index
(B) and DAPI to determine the percent of binucleate cells (C). 200 cells were
scored for each timepoint.
Total extract
IP
5
s
i
o
o
o
o
on
00
on
00
on
00
on
00
sS
ssS
s
^
Oh
o rp l-H A
a-H A
c d c l 8-HA
f
c d cl 8-HA
a - c d c l8
c d c l8 p (wt)
a-cdc21
cdc21p
IF
Total extract
B
S’S
cdc21p
c d cl 8-HA
On o
a-cdc21
a -H A
Figure 4.16
An interaction between cdcISp and cdc21p can not be detected in exponentially
growing cells
81-cdcl8 S/O-JK, 81-cdcl8-w t and orpl-H A cells were grown exponentially. Protein
extracts were made and immunoprécipitations were performed with either an a-H A
antibody (A), or an a-cdc21 antibody (B).
81-cdcl8 S/O-JK
81-cdcl 8 S/O-wt
100
100
80
80
60
60
T im e (m ins)
T im e (m ins)
40
40
20
20
HU
HU
1C 2C
1C 2C
4C
— o — 81-cdcl 8 S/O-JK
-a — 81-cdcl8 S/O-JK
B
o
4C
D N A content
DN A content
81-cdcl 8 S/O-wt
— o-
81-cdcl 8 S/O-wt
40
50
40
20
c^
1 20
-T
lot.
HU 20
40
60
80 100
T im e (m ins)
-T
HU 20
40
60
8 0 100
T im e (mins)
Figure 4.17
An interaction between cdcISp and cdc21p can not be detected in an HU block, or
80 and 100 minutes after release
The 81-c d c l8 S/O -JK and 81-c d c l8 S/O -w t strains were grown to exponential phase.
Thiam ine was added to 81-cdcl 8 S/O -wt then HU was added 30 minutes later to block
the cells at the beginning of S phase. Cells were released from the block after 3.5 hours
and samples were taken every 20 minutes for FACS analysis (A). 200 cells were counted
for septation index (B) and number of binucleates (C).
IP
Total extract
?
o
cc
00
li ll
a
HU block
6
Cc
00
6
55
00
li r li
odd 8-HA
c d c l 8-H A
c d c l8 p (w t)
a -H A
f W
a -H A
c d c l 8-H A
c d c l 8-H A
a - c d c l8
c d c l8 p (w t)
a -cd c 2 1
cdc21p
100 m inutes after release
cdc 18-H A
c d c l 8-H A
c d c l8 p (w t)
cdc21p
a - c d c l8
a-cdc21
cdc21p
80 m inutes after release
Ô
55
00
a-HA
IF
i«—
a - c d c l8
a-cdc21
Figure 4.17 D
Protein extracts were made from cells in the HU block (a), and 80 (b) and 100 minutes
(c) after the release. Immunoprécipitations were performed with an a-H A antibody.
IP
Total extract
a
?
s
6
Co
o
Co
9 o
CO ^
?
o
Co
■2-i
si
si
■gn
si si
HU block
cdc21p
a-cdc21
a -H A
cdc 18-HA
1
2
3
4
5
6
80 m inutes after release
a-cdc21
cdc21p
a -H A
cdc 18-HA
4
5
6
100 m inutes after release
cdc21p
a-cdc21
a -H A
cdc 18-HA
1
2
3
4
5
6
Figure 4.17 E
Protein extracts were made from cells in the HU block (a), and 80 (b) and 100 minutes
(c) after the release. Immunoprécipitations were performed with an a-cdc21 antibody.
Chapter 5
General Discussion
Introduction
In this chapter I discuss m y results in a w ider context. I will com pare how cdcl8p
is reg u la te d in Schizosaccharomyces pombe w ith o th er organism s a n d discuss the
consequences th at regulation has on restricting S phase to only once per cell cycle. I
w ill go on to discuss the function of cdcISp in b o th D N A replication an d the
checkpoint th at ensures S ph ase is com pleted before m itosis is initiated. Finally I
w ill discuss the req u irem en t for the N TP b in d in g a n d h y d ro ly sis m otifs an d
com pare the effect of m utating these in fission yeast a nd other organism s.
Chapter 5 G eneral D iscussion
5.1 Regulation of cdcISp
Cdcl 8 is an essential gene, required for both initiation of DNA replication and the
checkpoint that inhibits mitosis until S phase has been successfully completed.
Deletion of the gene results in cells entering mitosis w ithout previously replicating
their DNA. This results in a cut phenotype as the DNA can not be properly
segregated into the tw o daughter cells. O verexpression of cdclS causes re­
replication of the DNA as cdcISp is able to block mitosis and to re-initiate DNA
replication (Kelly et al., 1993; Nishitani and Nurse, 1995). It is therefore imperative
that cdclS protein levels are carefully controlled throughout the cell cycle. In
fission yeast, this is done in two ways: transcription and proteolysis.
The S phase transcriptional m achinery is composed of cdclOp, reslp , res2p and
rep2p (Aves et al., 1985; Baum et al., 1997; Caligiuri and Beach, 1993; Miyamoto et
al., 1994; Nakashim a et al., 1995; Tanaka et al., 1992; Zhu et al., 1994b). Targets of
this complex are expressed periodically in the cell cycle and include cdtl, cdc22 and
cig2 in addition to cdclS. It has been shown that cdcl8 transcription is activated at
the onset of mitosis and continues until cells pass into S phase (Baum et al., 1998;
Kelly et al., 1993). The protein does not, however, accumulate until cells exit from
mitosis (Baum et al., 1998). This is due to the second type of regulation, proteolysis.
It has been know n for some time that cdcl8p is highly unstable (Muzi-Falconi et
al., 1996) and that phosphorylation by the cdc2 protein kinase directly targets it for
degradation (Baum et al., 1998; Jallepalli et al., 1997). The phosphorylated protein
is specifically recognised by p o p lp and p o p 2 p /su d lp , proteins that form part of
the SCF (Skpl-cullin-F-box) complex. The ubiquitination of cdcl8p by this complex
results in its subsequent degradation via the 26S proteasom e (Jallepalli et al., 1998;
Kominami et al., 1998a; Kominami and Toda, 1997; Wolf et al., 1999b).
C dcl8p m utated in all six cdc2p consensus phosphorylation sites (cdcl8-Pl-6p) is
m ore stable than the w ildtype protein, as w ould be expected if phosphorylation
targets it for degradation (Baum et al., 1998; Jallepalli et al., 1997). It is also known
that p o p lp and p o p 2 p /su d lp m utants result in the accumulation of both cdcl8p
and ru m lp which allows an additional round of replication (Jallepalli et al., 1998;
159
C h a p te r 5 G eneral D iscussion
Kominami et al., 1998a; Kominami and Toda, 1997; Wolf et al., 1999b). It was not
know n how ever, w hether cdcl8-P l-6 expressed from the endogenous c d c l8
prom oter w ould disturb the norm al cell cycle progression that leads from G1 to S
phase to G2 and w ould perm it an additional round of replication due to its G2
stability, or w ould complement a lack of cdcISp function. I showed that the cdclSPl-6p m utant was able to fully complement the 81-cdcl8 S /0 strain w hen thiamine
was added to deplete the cells of w ildtype protein (Fig. 4.12). Cells m aintain a 2C
DNA content which shows that a diploid population does not accumulate (Fig.
4.12 B). These results indicate that phosphorylation m ediated degradation of
cdcISp is only one of the redundant controls that restrict DNA replication to once
per cell cycle and is not sufficient in itself to disrupt norm al cell cycle progression.
A nother factor such as the presence of ru m lp m ay also be required before re­
initiation of S phase can occur.
This conclusion is som ew hat contradictory to results obtained by Wolf and co­
workers (Wolf et al., 1999a). They found that titration of the proteolytic machinery
by overproduction of ScCdc6p resulted in the stabilization of cdcISp so it
accum ulates to a level that is sufficient to induce an additional round of
replication, even in the absence of ru m lp . The experim ents I perform ed and
described in C hapter 3 show ed that overproduction of ScCdc6p induces re­
replication w ithout a subsequent increase in the level of cdclS protein (Fig. 3.7).
This suggests that re-replication is induced due to an intrinsic function of Cdc6p,
not just through interfering with proteolysis (Chapter 3).
The cdc2p consensus phosphorylation sites are found in the N -term inus of the
protein. An N-terminal truncation of cdcISp that results in five out of the six cdc2p
consensus phosphorylation sites being deleted is also m ore stable than the
w ildtype protein (Baum et al., 199S). The cdclS-150-577p m utant is able to induce
both re-replication and the checkpoint w hen overexpressed (Fig. 2.2) and is
therefore able to perform both of the essential functions of cdclSp. However it is
unable to complem ent a cdcl8-K46 tem perature sensitive m utant w hen expressed
at the restrictive tem perature (Chapter 2). This suggests that the N-term inus of
cdclSp is required to perform a function that is essential for cell viability which is
separate from its requirement for degradation of the protein in S phase.
160
C h a p te r 5 G eneral D iscussion
One possible function for the N-term inal region of cdcl8p could be the physical
rem oval of cdclSp from origins. There is evidence in Xenopus laevis that Cdc6p
m ust be rem oved from origins before initiation can occur and that this removal
m ay require cdk2 activity (Hua and N ew port, 1998). It has also been suggested
from chromatin binding studies using synchronous budding yeast cultures that the
majority of Cdc6p is unloaded from origins before firing (Weinreich et al., 1999).
Chrom atin assays in fission yeast indicate that cdclSp is probably not rem oved
from origins prior to S phase initiation (Nishitani et al., 2000). However depletion
of cdclSp from chrom atin during S phase could still be necessary to signal that
DNA replication has been completed, thus ensuring cell viability.
Cdc2p interacts strongly w ith the N -term inus of cdclSp (Fig. 2.4), perhaps more
strongly than w ould be expected for a norm al kinase/ substrate interaction. It is
possible that an essential first step is the binding of cdc2p to cdclSp thus removing
it from origins; phosphorylation and degradation may be a non-essential later step.
Some support for this hypothesis comes from the fact that intact cdc2p consensus
phosphorylation sites are not required for a cdc2p/cdclS p interaction (Brown et
al., 1997). This could explain w hy the cdclS-Pl-6p m utant is fully functional, as it
could still be rem oved from chromatin via a cdc2p/cdclSp interaction, despite not
being phosphorylated and degraded. To investigate this hypothesis it w ould be
necessary to see w hether cdclS-150-577p remained bound to chromatin in G2 cells.
Cell cycle regulated expression of cdclSp is common to both fission and budding
yeasts. ScCDCS is transcribed in C l (Piatti et al., 1995; Zhou and Jong, 1990;
Zwerschke et al., 1994) and is degraded on entry into S phase after Cdc2Sp/Clb
phosphorylation (Elsasser et al., 1999). The hum an Cdc6p is regulated som ewhat
differently. CDC6 is expressed selectively in proliferating b u t not quiescent
mam m alian cells and this regulated transcription is dependent on E2F (Hateboer et
al., 199S; Ohtani et al., 199S; Yan et al., 199S). The mRNA levels have been shown to
peak at the G l/S boundary but the protein levels rem ain constant throughout the
cell cycle (Saha et ah, 199S). Controls used by m am m alian cells to prevent re­
initiation of DNA replication in G2 do not therefore include degradation of Cdc6p.
H um an cells have evolved a different mechanism to ensure that Cdc6p is removed
from the vicinity of chromatin after S phase initiation. Cdc6p has been show n to be
161
C h a p te r 5 G en eral D iscussion
nuclear in G1 b u t is then selectively excluded from the nucleus after S phase
initiation (Saha et al., 1998). Intriguingly, the subcellular localization of Cdc6p is
regulated by phosphorylation. It has been show n that phosphorylation of Cdc6p
on three N-term inal serine residues by C dk2/C yclin A results in the translocation
of Cdc6p from the nucleus to the cytoplasm (Jiang et al., 1999b; Otzen Petersen et
al., 1999). Phosphorylation is therefore essential for the local depletion of Cdc6/18p
from the nucleus after S phase initiation. H ow ever, w hether this is done by
degradation or re-localization is dependent on the organism.
As phosphorylation of hum an Cdc6p affected localization it was possible that a
similar re-localization occurred in response to phosphorylation in fission yeast and
it was only after cdcl8p had been transported to the cytoplasm that it could be
ubiquitinated and degraded. Some support for this hypothesis came from the fact
that m utation of two basic residues K57 and R58 inhibited the nuclear localization
of HsCdc6p and m utation of S54 which is one of the sites phosphorylated by Cdk2
also partially inhibits nuclear localization (Takei et al., 1999). This could suggest a
general mechanism whereby phosphorylation of C dc6/18p by C dk2/cdc2p next to
a nuclear localization signal could prevent its nuclear accum ulation. The two
putative bipartite nuclear localization signals in cdcl8p are both close to cdc2p
consensus phosphorylation sites (Fig. 4.3). NLSl is adjacent to P2 and contains P3
w ithin it and NLS2 contains P4. In m utating the nuclear localization signals of
cdcl8p I hoped to see a lack of complem entation of the 81-cdcl8 S /0 strain w hen
the w ildtype cdcl8p was depleted by the addition of thiamine. However, as that
was not the case and even cdcl8p m utated in both nuclear localization signals was
able to com plem ent the depletion of w ildtype cdcl8p (Fig. 4.9-4.11) I did not
pursue a link between phosphorylation and localization. In fact there is evidence to
suggest that proteolysis occurs in the nucleus rather than the cytoplasm as the 26S
proteasom e has been localized to the nuclear periphery near the inner side of the
nuclear envelope (Wilkinson et al., 1998).
As the nuclear localization signals of cdcl8p were not essential for cdcl8p function,
it indicates that either the mutagenesis did not inactivate the NLS, that I was not
m utating the correct motif, or that cdcl8p enters the nucleus through binding to
other nuclear bound proteins. It is known that a similar m utation of the cytokine
162
C h a p te r 5 G eneral D iscussion
interleukin-5 bipartite NLS did prevent nuclear localization (Jans et al., 1997) and
that there are no other obvious NLSs in the protein. I m ust therefore conclude that
cdclSp enters the nucleus by binding to other proteins. This is supported by the
fact that m utation of the only putative bipartite nuclear localization signal of
HsCdc6p does not alter its nuclear localization (Saha et ah, 1998) and that
recombinant XlCdc6p can not cross the nuclear m em brane despite the presence of
a putative bipartite NLS (Coleman et al., 1996). A n obvious candidate for the
protein that transports cdclSp into the nucleus w ould be c d tlp which forms a
complex w ith cdclSp, acts co-operatively in a DNA re-replication assay and
possesses a putative NLS (Hofmann and Beach, 1994; N ishitani et al., 2000). An
interesting point is that only ScCdc6p has been conclusively show n to have a
functional NLS (Elsasser et al., 1999; Jong et al., 1996) and this organism appears
not to possess a cdtl homologue. However, as cdclSp is able to bind chromatin in
the absence of cd tlp function (Nishitani et al., 2000), it indicates that other proteins
m ust also be involved in the nuclear localization of cdclSp.
5.2 Function of cdclSp
CdclSp has been shown to be required for the loading of the MCM complex onto
chrom atin prior to DNA replication in a num ber of organism s. This allows
formation of the pre-replicative complex (Aparicio et al., 1997; Coleman et al., 1996;
Donovan et al., 1997; Liang and Stillman, 1997; Nishitani et al., 2000; Stoeber et al.,
199S; Tanaka et al., 1997). The precise m echanism is som ew hat less clear and
several groups have w orked to understand how cdclSp perform s this role. A
common approach has been to perform site-directed m utagenesis on the Walker A
motif, required for NTP binding, and Walker B motif required for NTP hydrolysis
(Guenther et al., 1997; Story and Steitz, 1992; Walker et al., 19S2). This could lead to
identification of a stepwise mechanism for MCM loading.
H ow ever, the results of these analyses have been difficult to interpret due to
experiments being perform ed in:
1) different organisms
2) using different amino acid substitutions
3) using different assays to assess function
163
C h a p te r 5 G eneral D iscussion
I will discuss the findings from other groups w hen first, the W alker A motif is
m utated and second, the Walker B motif is m utated, relating their results to my
own. I will then attem pt to come to some conclusions as to how cdclSp acts to load
MCMs onto origins.
A m utation of the conserved lysine residue to glutam ate in the W alker A motif
(GxxGxGKT) of Saccharomyces cerevisiae Cdc6p has been show n to produce a non­
functional protein that is unable to complement the cdc6-l tem perature sensitive
m utant at the restrictive tem perature of 37°C (Perkins and Diffley, 1998). Genomic
footprinting shows that the Cdc6-K114Ep m utant is unable to generate any aspect
of the pre-replicative footprint norm ally visualised in G l. These results are
consistent w ith m y own, which also involved a K-)E m utation of the Walker A
motif. The 81-cdcl8 S/O-WA strain was unable to complem ent a depletion of the
w ildtype protein (Fig. 4.7). The cells arrested and accum ulated abnorm al nuclei
w ith similar kinetics to the 81-cdcl8 S/O-JK strain which possessed no cdclSp after
switching off expression of wildtype cdcl8 by the addition of thiamine (Fig. 4.13).
Another group m utated the same lysine residue to three amino acids, all of which
produced different phenotypes w hen expressed from the endogenous CDC6
prom oter (Weinreich et al., 1999). A substitution to arginine, which changed the
configuration of the positive charge, resulted in a functional protein as there is no
effect on cell grow th and S phase progression. However, a m utation to the neutral
amino acid alanine results in a tem perature sensitive phenotype and a substitution
to glutam ate, a negatively charged am ino acid, is lethal. This stresses the
im portance of the exact am ino acid substitution m ade w hen interpreting
experiments perform ed w ith m utated proteins. Interestingly, the phenotype of the
Cdc6-K114Ep m utant in budding yeast is somewhat different to that obtained with
the same m utation in fission yeast cdclSp (Chapter 4). After depletion of wildtype
Cdc6p, cells producing Cdc6-K114Ep accumulate w ith a 1C DNA content as they
do not initiate S phase. Cells then arrest and do not undergo an aberrant mitosis as
w ould occur in the complete absence of Cdc6p or after depletion of the w ildtype
cdclS protein in the 81-cdcl8 S/O-WA strain (Fig. 4.7), W hen the N-term inus of the
Cdc6-K114E m utant protein is deleted, cells also accum ulate w ith a 1C DNA
content b u t then undergo mitosis in the absence of DNA replication. The N164
C h a p te r 5 G eneral D iscussion
term inus of Cdc6p is therefore required to inhibit prem ature entry into mitosis. It
has been show n that the Cdc6-K114Ep is capable of binding to chrom atin but is
unable to load MCMs (Weinreich et al., 1999). I m ust therefore assum e that the
presence of the Cdc6-K114Ep on chromatin, perhaps w ith other initiation proteins
b u t w ithout the MCM complex, is sufficient to initiate a checkpoint signal and
consequently that the ability to bind chromatin is located in the N-term inus of the
protein. Given this, it is im portant to know w hether the cdcl8 Walker A m utant is
able to bind to chromatin in fission yeast. Both outcomes w ould be informative and
tell us som ething about how the two yeasts differ. If the cdcl8-W A-3HAp does
bind to chrom atin it indicates that the checkpoint signal is initiated differently in
budding and fission yeast. However, if the protein is not bound it indicates that the
mechanism for chromatin binding is different in the two organisms. It is somewhat
surprising that the N -term inus is required to send the checkpoint signal in
budding yeast as m y w ork (Chapter 2) dem onstrated that the C-terminus alone
was sufficient to induce both replication and the checkpoint to prevent mitosis
(Fig. 2.2, 2.7 and 2.11).
The lysine residue of the Walker A motif of budding yeast Cdc6p was m utated to
five different amino acids by another group (Wang et al., 1999). Again, a range of
phenotypes w ere obtained depending on the precise m utation m ade. Lysine
m utated to leucine (a neutral amino acid), glutam ine (resulting in the substitution
of an amide) or arginine (a positively charged amino acid) produced a functional
protein that was capable of com plem enting the cdc6-l m utant at the restrictive
tem perature. H ow ever a lysine to proline (causing a general disruption) or
glutam ate (a negatively charged amino acid) m utation resulted in a protein that
was unable to com plem ent the cdc6-l m utation at the restrictive tem perature.
Further analysis was perform ed on the Cdc6-K114Ep as it appeared to have the
m ost severe phenotype. It was found that the m utant was unable to stably bind
chrom atin and effectively load Mcm5p. The defect w as therefore due to an
inability to form functional pre-replicative complexes. This result is som ewhat
different to results obtained by W einreich et al. w ho found that Cdc6-K114Ep
bound to origins w ith the same kinetics as the w ildtype protein. W ang et al. claim
that the m utant is able to bind to chromatin but not as stably as w ildtype Cdc6p so
the results are not totally inconsistent.
165
Chapter 5 G eneral D iscussion
It was also show n that Cdc6p could interact w ith O rclp in vitro and in vivo (Wang
et ah, 1999) and that the in vivo interaction was com prom ised w hen the Cdc6K114Ep was expressed. This could explain w hy the m utant protein appears to have
a problem binding to chrom atin. Recent data from experim ents using purified
budding yeast proteins in an in vitro assay confirms the O rclp /C d c6 p interaction
but states that the presence of functional ARS DNA is required for the interaction
(M izushima et ah, 2000). The apparent instability of the O rclp/C dc6-K 114Ep
interaction could therefore be a ttrib u te d to the lack of chrom atin in an
immunoprécipitation. The interaction m ay not be detected as there is no ARS DNA
present to stabilize the weak interaction.
Experiments w ith baculovirus purified hum an Cdc6 proteins has led to a better
characterization of ATP binding and hydrolysis (Herbig et ah, 1999). A lysine to
alanine m utation in the W alker A motif, K208A, produces a protein that has a
m uch reduced ATP binding activity and barely detectable ATPase activity. It was
previously show n that hum an Cdc6p was able to bind to O rclp (Saha et ah, 1998)
and Herbig et ah confirm this result, adding to it by reporting that the Cdc6-K208A
protein is still able to bind to O rclp. Microinjection of the Cdc6-K208A m utant
protein into HeLa-S3 cells blocks DNA synthesis indicating that the m utant is
defective in S phase entry.
A study of the Walker A and B motifs of cdcl8p has previously been perform ed in
Schizosaccharomyces pombe (DeRyckere et ah, 1999). They state that a lysine to
alanine m utation of the W alker A m otif displays a m ixed phenotype w hen the
wildtype protein is depleted. Some cells block w ith a DNA content of 1C and <1C,
as is found w ith our experiments (Fig. 4.7 B), however, a proportion of the cells
also block w ith a 2C DNA content. The cell cycle block point has been shown to be
dependent on the cell cycle stage at w hich cells are depleted of w ildtype cdcl8p. If
cells are blocked at the beginning of S phase w ith HU and are then released from
the block after w ildtype cdcl8p has been depleted, cells will arrest w ith a 1C and
<1C DNA content. H ow ever, if cells are blocked in 0 2 using a cdc25-22
tem perature sensitive m utant and released in the absence of w ildtype cdcl8p, cells
will block after the next S phase w ith a 2C DNA content. As this result is different
166
Chapter 5 G eneral D iscussion
both from mine and from those obtained in other organisms, I presum e that this
specific m utation results in a partially functional protein. The specific amino acid
substitution m ade has been show n to be critical for w hether the protein is
functional (Wang et al., 1999; W einreich et al., 1999) and a K->A m utation in the
Walker A motif of budding yeast Cdc6p has been show n to produce a tem perature
sensitive m utant (W einreich et al., 1999) providing further evidence that the
m utant protein could be partially active.
To sum m arise, cells m utated in the Walker A m otif of C dc6/18p are defective in
initiating DNA replication. This occurs in both budding and fission yeast and in
hum an cells. My work also indicates that cells are unable to initiate a checkpoint
signal (Fig. 4.7). This result is different to that obtained in budding yeast which
states that the same m utant is able to m aintain a checkpoint in the absence of
replication (Weinreich et al., 1999). This could be due to a difference in the ability
to bind the ORC complex and chromatin. A lternatively it could be related to the
different nature of the checkpoint signal. In fission yeast, the ability to initiate
replication is not generally separated from the ability to initiate a checkpoint. A
lack of replication therefore tends to be coupled to a deficient checkpoint and an
aberrant mitosis. However, in budding yeast this m ay not always be the case as
destruction of m em bers of the MCM complex prior to S phase using the heatinducible Degron causes cells to arrest w ith a 1C DNA content w ithout entering
m itosis (Labib et al., 2000). This result provides us w ith an example w here the
replication and checkpoint functions are separated. A nother difference betw een
the S phase checkpoint in the two yeasts is the checkpoint target. The checkpoint
signal results in the inhibitory phosphorylation of the tyrosine-15 residue of cdc2p
in fission yeast. The situation is a little more complicated in budding yeast and
there are thought to be two pathw ays, a M eclp/R ad53p pathw ay that operates in
early S phase and a M e c lp /P d s lp pathw ay that operates later, both pathw ays
ultim ately act to inhibit spindle elongation (reviewed in Clarke and GiminezAbian, 2000).
A m utation in the W alker B m otif of Saccharomyces cerevisiae CDC6 w as first
isolated as a dom inant negative m utant w hen overexpressed. It was found to be a
glutam ate to glycine (E-^G) substitution of the DExD motif. The Cdc6-E224Gp
167
Chapter 5 G eneral D iscussion
does not com plem ent the cdc6-l m utant w hen expressed at the restrictive
tem perature and cells block in S phase w ith a 1C-2C DNA content (Perkins and
Diffley, 1998). These results are similar to those obtained by myself (Fig. 4.8) with
the same amino acid substitution. A DE-^AA m utation of the W alker B motif of
fission yeast cdcl8p also produced cells which arrested w ith a 1C-2C DNA content
after depletion of the wildtype protein (DeRyckere et al., 1999).
Further characterization of the Cdc6-E224Gp m u tan t show ed that it allow ed
form ation of a G l specific footprint by genomic footprinting b u t that this was not
the same footprint as form ed by the pre-replicative complex. Chrom atin assays
show ed that this was due to a lack of MCMs bound to origins and explains why
the m utant protein was unable to complement the cdc6-l m utant at 37°C (Perkins
and Diffley, 1998). I presum e that binding of the Cdc6-E224Gp m utant to
chrom atin allows binding of other proteins as Cdc6p binding alone has been
show n not to affect the pattern of DNasel protection at ARSl (Mizushima et al.,
2000). This is interesting as the Cdc6-K114E m utant protein has been show n to
bind DNA (Weinreich et al., 1999) but not generate a G l specific footprint (Perkins
and Diffley, 1998) im plying that it is unable to recruit other proteins to origins.
However, it is still capable of sending a checkpoint signal (Weinreich et al., 1999)
indicating that the presence of Cdc6p on chromatin could be the sole requirement
for initiation of a signal to block mitosis.
Experim ents using hum an baculovirus purified proteins dem onstrated that an
E->Q substitution in the Walker B box of Cdc6p had no effect on the ATP binding
ability of the protein or the ability to interact w ith O rc lp b u t resulted in a clear
decrease in the ATPase activity (Herbig et al., 1999). Microinjection of the Cdc6E285Q m utant protein into HeLa-S3 cells led to a reduction of DNA synthesis
indicating that S phase progression m ust be either slowed or halted.
ATP hydrolysis appears to be required for norm al S phase progression. W ithout it
some replication can occur but it is not complete. The indication is that replication
is either occurring at a slower rate or at only a subset of origins. My data w ould
support this hypothesis as a HU block and release experim ent w ith the cdcl8-WB3HA protein dem onstrated that DNA replication initiation w as delayed and S
168
Chapter 5 G eneral D iscussion
phase progression appeared slow compared to that induced by the wildtype cdcl8
protein (Fig. 4.15). The obvious possibility for the lim iting factor w ould be loading
of the MCM complex onto chromatin. As some DNA replication occurs when the
W alker B m utants are expressed in the absence of w ildtype protein function I
w ould presum e that some MCM proteins m ust be bound to chrom atin as a recent
paper shows that cells lacking a single member of the MCM complex fail to initiate
DNA replication (Labib et al., 2000). I therefore hypothesise that the MCM proteins
are b ound to DNA w hen the Cdc6-E224G protein is expressed in budding yeast
b u t it is below detectable levels w hen assessed using a chrom atin assay (Perkins
and Diffley, 1998).
The m echanism for cdcl8p d ependent loading of the MCM complex onto
chrom atin is unknown. I have been unable to detect an interaction between cdc21p
(mcm4p) and cdcl8p (Fig. 4.16 and 4.17) and others have also tried unsuccessfully
to im m unoprecipitate cdcl8p with members of the MCM complex (Sherman et al.,
1998). This suggests that cdcl8p does not load the MCM proteins by binding to the
complex and bringing it to chromatin. However, a recent report has suggested a
possible m echanism for how this role is perform ed. A n in vitro system was
developed to look at the origin specific interaction betw een Cdc6p and the ORC
complex in Saccharomyces cerevisiae (Mizushima et al., 2000). Baculovirus purified
ORC proteins (Bell et al., 1995) and Escherichia coli purified Cdc6p were shown to
interact b u t require a functional ARS to do so, as m utations in the A and B1
elem ents of ARSl abolishes the interaction. Two Cdc6p m utants w ere also
purified, both of which have previously been characterized (Weinreich et al., 1999).
The W alker A m utant, Cdc6-K114Ep, was described earlier and the W alker B
m utant, Cdc6-DE223-224AAp, produced a completely functional protein that had
little effect on cell growth allowing the authors to conclude that an intact Walker B
m otif is not essential for Cdc6p activity. The fact that this m utation produces a
functional protein is not too surprising as it is know n that the specific m utation
m ade can have a great effect on the ability of the protein to rescue depletion of the
w ildtype protein. How ever it is w orth rem em bering that the same m utation in
Schizosaccharomyces pombe w as defective as cells arrested w ith a 1C-2C DNA
content (DeRyckere et al., 1999). Despite the fact that that the earlier report stated
that the W alker B m utant was functional in vivo and the W alker A m utant non­
169
Chapter 5 G eneral D iscussion
functional (Weinreich et al., 1999), the two Cdc6 m utant proteins were shown to act
identically to each other and differently to the w ildtype protein in the latter report
(Mizushima et al., 2000). This throws doubt on the validity of the results obtained
using this assay but still provides us w ith an interesting hypothesis w orth further
analysis.
M izushima et al. propose that the ATPase activity of Cdc6p is required to prevent
non-specific binding of ORC to chrom atin. Lack of this activity due to either
expression of a m utant protein or presence of a non-hydrolyzable analogue of ATP
(ATP-y-S) allows ORC to bind along the chromatin. This non-specific chrom atin
binding is not due to an inability of the Cdc6 m utant protein to bind ORC as these
interact as strongly w ith ORC as the w ildtype Cdc6 protein. Partial protease
d igestion indicates th at w ild ty p e Cdc6p b u t n o t Cdc6-K114Ep causes a
conform ational change in ORC that increases the binding specificity of ORC to
DNA. Cdc6p w ould therefore specify binding of ORC to functional origins by
inducing a conform ational change which m ay then allow MCMs to bind to
chromatin. This model provides a mechanism for how Cdc6p can allow loading of
the MCM complex w ithout a direct interaction. However, the problem of whether
Cdc6-DE223-224AAp acts like the w ildtype protein or the W alker A m utant and
issues relating to how ORC proteins are specified to origins of both sister
chromatids after replication w hen Cdc6p has been degraded need to be resolved.
The m utational analysis of the Walker A and Walker B motifs of both fission yeast
cdclSp, and budding yeast and hum an Cdc6p has provided some insight into the
m echanism that allows initiation of DNA replication. How ever, it also provides
som e insight into the checkpoint role of C dc6/18p, as has been m entioned
previously. In fission yeast, DNA replication and the S phase checkpoint are not
generally separated. If replication is inhibited, the checkpoint signal is not sent and
cells enter an aberrant mitosis. The Walker A m utant is no exception as expression
of cdcl8-W A-3HAp in the absence of w ildtype cdcl8p results in cells that are
unable to initiate DNA replication or the S phase checkpoint and so enter an
aberrant m itosis (Fig. 4.7). However, this is not the case in budding yeast. The
Cdc6-K114Ep does not initiate DNA replication b u t the S phase checkpoint is
activated so cells arrest w ith a 1C DNA content (W einreich et al., 1999). This
170
Chapter 5 G eneral D iscussion
reflects a fundam ental difference between the two yeasts and possible explanations
for this w ere discussed earlier in the chapter. Interestingly the intra-S phase
checkpoint w hich is required to prevent late origins from firing w hen the
progression of replication forks from early origins has been blocked by HU, is
thought to involve a M eclp/R ad53p pathw ay which inhibits late origin firing via a
signal initiated by the stalled replication forks (Santocanale and Diffley, 1998). This
is slightly at odds with the idea that it is a Cdc6p containing complex that initiates
a checkpoint signal and not the presence of replication intermediates. This suggests
that a diverse range of events can send the S phase checkpoint signal.
The phenotype of the cdcl8-WB-3HAp m utant has been discussed in some detail
in Chapter 4. The protein is capable of initiating replication albeit with some delay
(Fig. 4.15). S phase progression could also be slow and these phenotypes are not
dissim ilar from those found in the budding yeast and hum an Cdc6p W alker B
motif m utants (Herbig et al., 1999; Perkins and Diffley, 1998). One thing that is
currently unclear is w hether the W alker B m u tan t is capable of initiating a
checkpoint signal. Cells accum ulate abnorm al nuclei w ith a few hours delay
com pared to the null and W alker A m utants (Fig. 4.13 B) but at a m uch earlier
stage than the cdcl8-K46 m utant at the restrictive tem perature (Fig. 4.14 D). There
is therefore an indication that the cells are capable of undergoing an initial cell
cycle arrest w hich can not be m aintained allow ing cells to enter an aberrant
mitosis. As cells arrest with a 2C DNA content it w ould be surprising if they were
unable to initiate a checkpoint. This could indicate a direct link betw een cdcl8p
function and the checkpoint (discussed in Chapter 4).
A nother possibility is that the cells progress slowly through the initial events in
m itosis w ithout having properly left S phase and G2. This is the case w ith the
cdcl3-117 m utant w hen shifted to the restrictive tem perature as it arrests w ith a
granular nuclear structure, often w ith three condensed chromosomes. M any cells
are septated bu t the septa are aberrant and irregular in structure. How ever the
cells possess cytoplasmic m icrotubules rather than short m itotic spindles which
enables them to continue growing (Hagan et al., 1988). The cdc2p/cdcl3p kinase is
sufficiently active to bring about some but not all aspects of mitosis. This is similar
to the phenotype observed w hen thiamine is added to the 81-cdcl8 S/O-WB strain
171
Chapter 5 G eneral D iscussion
and could account for w hy the cells grow so long despite appearing to enter
mitosis. It could also explain w hy there appears to be a time lag w hen comparing
the accumulation of abnormal nuclei w ith the increase in septation index (Fig. 4.14
C and D) as the cdcl8-WB-3HAp is only able to partially activate a checkpoint so
some events of mitosis proceed but others are inhibited.
Alternatively, it is possible that a critical num ber of active replication initiation
complexes are required to establish the checkpoint signal. This hypothesis could
certainly fit w ith the proposed defect of the cdcl8-WB-3HAp which m ay initiate
replication from only a subset of origins an d could account for the three
phenotypes, delay in initiation, slow progression through S phase and lack of
checkpoint function.
Summary
Over the last four years m uch progress has been m ade in the DNA replication
field, particularly in relation to the role played by cdcl8p. Hom ologues in higher
eukaryotes, such as Xenopus and hum ans, have been identified and a clear
functional role has been defined for cdcl8p, which appears to be common to all
hom ologues. The work presented in this thesis has contributed to our current
knowledge of cdcl8p, particularly in relation to the checkpoint function (Chapter
2). I have perform ed a com parative study of the c d c l8 hom ologues to assess
w hether they can complem ent loss of cd cl8 function in fission yeast (Chapter 3)
and have discussed the differences between results obtained by myself and other
investigators. Finally, I have produced an experimental system that uses m utated
copies of cdcl8 to im prove understanding of cdcl8p regulation and function
(Chapter 4). W ith some modification, this system could be used in the future to
produce a detailed stepwise analysis of cdcl8p function in the form ation of the
pre-replicative com plex and generation of the S phase checkpoint signal.
172
Chapter 6
Materials and Methods
6.1 Fission yeast physiology and genetics
6.1.1 N om enclature
The genetic nom enclature of Schizosaccharomyces pombe is reviewed in (Kohli and
N urse, 1995). Fission yeast gene names consist of three italicised lower-case letters
and a num ber, e.g. cdcl8. M utant alleles of genes are denoted by a hyphen and a
num ber, or a combination of letters and numbers, e.g. cdcl8-K46. Alleles conferring
tem perature sensitivity can be m arked with a superscript, e.g. cdcl8-K46^^. The wild
type allele can be designated w ith a superscript plus w hen the context requires
specification of the w ild type allele. Phenotypes are denoted by a non-italicised
three-letter abbreviation corresponding to a gene nam e e.g. cdc. Gene deletions are
indicated by the gene nam e followed by a "A", e.g. cdcl8A. Integrated DNA is
indicated w ith a
A gene deletion m arked w ith an integrated auxotrophic
m arker in indicated w ith a "A::marker", e.g. m iklA::ura4^. Gene products are
denoted by the lower-case, non-italicised gene name followed by "p" for protein,
e.g. cdcl8p. Truncated and m utated gene products carry a non-italicised tag
denoting the alteration, for example cdcl8-150-577p and cdcl8-l-577 (NTP)p. Due
to the complicated nature of certain strains and plasmids, a shorthand version may
be used. These will be explained fully, both in the strain list and plasm id
explanation and in the results chapters as they are first described.
Saccharomyces cerevisiae genes are designated w ith three italicised upper-case letters
e.g. CDC6. Recessive m utants alleles are in low er case. B udding yeast gene
products are denoted by the non-italicised gene name w ith the first letter in upper
case and a "p" at the end, e.g. Cdc6p. The nom enclature used for m am m alian
genes is identical to that used for budding yeast. Due to the use of homologous
Chapter 6 M aterials an d M ethods
genes of the same nam e in Chapter 3, the gene nam e will be prefixed w ith the
initials of the organism, e.g. the Saccharomyces cerevisiae gene CDC6 will be called
ScCDC6.
6.1.2 Strain grow th and m aintenance
Techniques used to grow and m aintain fission yeast strains, to store and revive
frozen cultures, to check phenotypes and to perform and analyse crosses by tetrad
dissection or random spore analysis were perform ed as previously described
(MacNeill and Fantes, 1993; Moreno and N urse, 1994) and will not be further
described.
T able 6.1
F ission yeast strains p reviou sly constructed
Genotype
Strain location
K leul-32
O ur collection
h' leul-32 ura4-D18
O ur collection
h' leul-32 ura4-D18 cdcl8-K46
O ur collection
h' leul-32 ura4-D18 radl-1
T. Carr
k leul-32 radS-192
T. Carr
leul-32 rad3-136
O ur collection
leul-32 radl7-H21
O ur collection
k^ leul-32 husl-14
O ur collection
k leul-32 ade6-M210 cdc2-3w
O ur collection
k leul-32 cut5-580
O ur collection
k leul-32 miklA::ura4^ weel-50
O ur collection
leul-32 ade6-M210 rumlA:: ura4^ ura4-D18
O ur collection
k leul-32 cdc2-3w cdc25A:: ura4^ ura4-D18
O ur collection
k / k leul-32/leul-32 ade6-M210/ade6-M216
O ur collection
174
Chapter 6 M aterials an d M ethods
T able 6.2
F ission yeast strains n e w ly constructed
Genotype____________________________________________ Strain shorthand
h' cdclS:: nmt81-cdcl8 leul-32 ade6-M210
81-cdcl8 S /0
h' cdcl8:: nmt81-cdcl8 leul-32 p]K148 ade6-M210
81-cdcl8 S /0 pJK148
h' cdcl8:: nmt81-cdcl8 leul-32 pJK148-gcdcl8 ade6-M210
81-cdcl8 S /0 p]K148 gcdcl8
h'cdcl8:: nmt81-cdcl8 leul-32 pIRT2-gcdcl8 ade6-M210
81-cdcl8 S /0 pIRT2gcdcl8
h' cdcl8:: nmt81-cdcl8 leul-32:: pJK148 ade6-M210
81-cdcl8 S/O-JK
h' cdcl8:: nmt81-cdcl8 leul-32:: pJK148-gcdcl8-3HA ade6-M210
81-cdcl8 S/O-zut
K cdcl8:: nmt81-cdcl8 leul-32:: pJK148-gcdcl8-3HA-WA ade6-M210
81-cdcl8 S/O-W A
H cdcl8:: nmt81-cdcl8 leul-32:: p]K148-gcdcl8-3HA-WB ade6-M210
81-cdcl8 S/O-WB
h' cdcl8:: nmt81-cdcl8 leul-32:: pJK148-gcdcl8-3HA-Nl ade6-M210
81-cdcl8 S/O -N l
h' cdcl8:: nmt81-cdcl8 leul-32:: pJK148-gcdcl8-3HA-N2 ade6-M210
81-cdcl8 S/0-N 2
h' cdcl8:: nmt81-cdcl8 leul-32:: pJK148-gcdcl8-3HA-N2 ade6-M210
81-cdcl8 S/0-N1+N2
K cdcl8:: nmt81-cdcl8 leul-32:: p]K148-gcdcl8-3HA-Pl-6 ade6-M210
81-cdcl8 S/O-Pl-6
6.1.3 Strain construction
The 81-cdcl8 S/O strain was m ade by using a hom ologous integration technique
(Bahler et al., 1998) to replace the endogenous prom oter w ith that of the nmt81
prom oter. PCR was used to amplify a cassette containing the kanamycin resistance
gene and the nmt81 prom oter flanked by sequence homologous to cdcl8 promoter.
The PCR p ro d u ct w as then transform ed into the IP'/h' leul-32fleul-32 ade6M210/ade6-M216 diploid strain. Presence of the cassette w as selected for by
resistance to G418 and was confirm ed by colony PCR. The diploid was then
175
Chapter 6 M aterials an d M ethods
sporulated and tetrads were pulled to confirm a 2:2 segregation. The other strains
were m ade by transforming 81-cdcl8 S /0 with other plasmids, as described below.
6.1.4 T ransform ation and integration o f plasm id s
Cells w ere transform ed w ith plasm id DNA by either electroporation (using a
Flowgen "Cellject" at 1500V, 40pF, 132^, as described previously (Prentice, 1992)),
the lithium acetate m ethod (Moreno et al., 1991; Okazaki et al., 1990) a modified
lithium acetate m ethod (Bahler et al., 1998) or by protoplasting (Moreno et al.,
1991). Plasmids are maintained by providing a nutritional m arker such as LEU2 or
ura4, which is missing in the auxotrophic strain used for transformation.
Integrants were m ade using the pJK148 vector that does not contain an ars and is
thought to integrate preferentially at the leul locus. Southern blotting was used to
check integration.
6.1.5 Induction and repression o f gen e expression from the nm t prom oter
The nm t prom oter is derived from the n m tV gene which is required for thiamine
biosynthesis and is repressed in the presence of thiam ine (M aundrell, 1990).
M utations in the TATA box of the prom oter gave rise to m odified versions, which
allow ed three different expression levels (Basi et al., 1993; Forsburg, 1993). The
Rep3X vector contains the wildtype, strong nm tl prom oter. Rep41 and Rep42 drive
an interm ediate level of expression and the Rep81 and Rep82 vectors are used for
the lowest expression levels. To induce expression from the nm t prom oter, cultures
were grow n exponentially in m inim al m edium containing thiam ine (5pg/m l)
before being washed three times w ith m edium lacking thiamine and subsequently
grow n in the absence of thiam ine th ro u g h o u t the tim ecourse. To repress
expression from the n m t prom oter, thiam ine w as added back to the culture
growing exponentially in minimal medium.
6.1.6 P h ysiological experim ents w ith Hydroxyurea
H ydroxyurea (HU) is a d rug that acts to inhibit the enzym e ribonucleotide
reductase, and hence results in a depletion of nucleotides and cell cycle arrest in
early S phase. A ddition of HU, at a concentration of llm M , to an exponentially
grow ing population of cells can therefore be used to synchronise a cell culture.
176
Chapter 6 M aterials an d M ethods
Cells were released from the arrest after 3.5 hours at 32°C by w ashing three times
in minimal m edium . The culture then proceeds relatively synchronously through
the next cell cycle.
6.1.7 F low cytom etric analysis
Between 2x10^ and 2x10^ cells were fixed in 70% ethanol. Samples can be stored at
4°C indefinitely. Cells w ere w ashed in 3ml 50mM NagCitrate before being
resuspended in 0.5ml 50mM NagCitrate, O.lmg RNase and incubated at 37°C for 2
hours. 0.5ml NagCitrate, 2pg/m l propidium iodide was then added and cells were
sonicated for 45 seconds at setting 6 (Soniprep 150 sonicator, MSB). Analysis was
carried out w ith a Becton Dickinson FACScan as previously described (Sazer and
Sherwood, 1990).
6.1.8 C ell num ber determ ination
Cell num ber was determ ined by either counting using a haemocytometer, or with
a Coulter Counter. The haemocytometer is a specialised microscope slide w ith an
engraved grid. Once a special coverslip is placed on top of the slide it creates a
region of know n volum e (O.lmm^). A few m icrolitres of culture can then be
pipetted under the coverslip and the num ber of cells in the grid counted. This
num ber multiplied by 10000 gives the num ber of cells/m l.
For more accurate cell counting the Coulter counter was used. Cells were fixed by
adding 0.8ml formol saline (0.9% saline, 3.7% formaldehyde) to 0.2ml cell culture.
Cells can be stored at 4 °C for several weeks. Before processing for cell num ber,
19ml of ISOTON solution was added and cells w ere sonicated as above. Cell
num ber was counted using a Coulter Counter.
6.2 Molecular Biology Techniques
6.2.1 G eneral tech n iq u es
The following techniques were perform ed essentially as described (Sambrook et
al., 1989): preparation of competent bacteria, transform ation of bacteria with DNA,
restriction enzym e digest of DNA, gel electrophoresis of DNA, phosphatase
177
Chapter 6 M aterials a n d M ethods
treatm ent of vector DNA to remove 5' terminal phosphate groups and ligation of
DNA fragments. Both small (miniprep) and large (maxiprep) scale preparation of
DNA from bacteria was done using Qiagen columns (Qiagen).
6.2.2 D N A preparation
5x10® cells were broken using glass bead lysis, in 2% triton X-100,1% SDS, lOOmM
NaC l, lOmM Tris-HCl (pH8.0), Im M EDTA in the presence of 1:1 v / v
phenolrchloroformiisoamyl alcohol (GIBCO-BRL). DNA was precipitated by the
addition of NH^OAc to 0.3M and 2.5 volumes of ethanol.
6.2.3 Southern b lottin g
2pg DNA was digested for 3 hours before being run on a 0.8% agarose gel. The
DNA was transferred to GeneScreen Plus (NEN) hybridisation m em brane using a
PosiBlot 30-30 Pressure Blotter (Stratagene). The DNA was cross-linked to the
m em brane using an UV Stratalinker (Stratagene). The m em brane w as p re­
hybridised for 15 m inutes at 68°C in QuikHyb (Stratagene) before the probe was
added and hybridisation continued for 1 hour. The m em brane was w ashed three
times in O.IX SSC 0.1% SDS at 65°C before being exposed to Fuji autoradiography
film.
6.2.4 D N A probes
Probes for Southern blotting were prepared by random oligo prim ing w ith a(®^P)
dATP using a Prime It II kit (Stratagene). Probes used were a cdcl8 fragment from
Rep3X-cdcl8 (S all/B am H l digest) and a leul fragm ent from pJK148 (X h o l/C lal
digest).
6.2.5 C onstruction o f p lasm id s
The first five plasm ids constructed w ere based on Rep3X-cdcl8 (Nishitani &
N urse, 1995). To construct plasm id cdcl8-l-141, a TAG stop codon and a BamHl
site were introduced after the codon for amino acid 141. The fragm ent was cut out
using a S a ll/B a m H l digest and was cloned into Rep3X. Plasm id cdcl8-150-577
was constructed by introducing a Sail site and ATG start codon before the codon
for am ino acid 150 followed by a S a ll/B a m H l digest and ligation into Rep3X.
Plasm id cdcl8-150-577 (T374A) was constructed by introducing a m utation in
178
Chapter 6 M aterials and M ethods
cdcl8-150-577 at am ino acid 374 using a BioRad m utagenesis kit. ACT was
m utated to GCG thus changing the amino acid from T to A. Plasm id cdcl8-NTP
was constructed by m utating amino acids 204 and 205 from GGA AAG to GCG
GCC, thus altering the codons from GK to AA, using a BioRad m utagenesis kit.
Plasmid cdcl8-150-577-NTP was based on plasmid cdcl8-NTP and the cloning was
perform ed as for plasm id cdcl8-150-577. Plasmids HA cdcl8-l-141 and HA cdcl8150-577 were based on pRHA41, a gift from T. Carr. The fragm ents were cloned
dow nstream of the Rep41 prom oter and HA tag using a S all/B am H l digest.
HsCdc6 was subcloned from pBSKS^ (a gift from A. Dutta) to pUC118 using a
B a m H l/K p n l digest. It was then cloned into both pRep41 and pRep81 on a Sail
digest. A HinDIII digest confirm ed orientation. XlCdc6 w as subcloned from
pVL1393 (a gift from T. Coleman) to pLitmus38 on an EcoRl/EcoRV digest. It was
then cloned in to both pRep41 and pRep81 using a N d e l/S a ll digest. ScCDC6 was
subcloned from pLD3 (a gift from J. Diffley) to pRep41 and pRep81 using a BamHl
digest. Orientation was confirmed using a P stl digest.
The 5.2kb genomic cdcl8 fragm ent (gcdcl8) was subcloned from pIRT2-gcdcl8 to
pJK148 using a S a d / S a il digest. pJK148-gcdcl8 w as tagged w ith 3HA by
introducing a N o tl site in place of the cdcl8 STOP codon using the QuikChange
site-directed m utagenesis kit (Stratagene). The 3HA tag w as then cloned from
pTZ18R-3HAruml using a N o tl digest. Orientation was confirmed by sequencing
the area.
pJK148-gcdcl8-3HA-W A (gcdcl8-W A), pJK148-gcdcl8-3HA-WB (gcdcl8-WB),
pJK 148-gcdcl8-3H A -N l (g cd cl8 -N l), pJK 148-gcdcl8-3H A -N 2 (gcdcl8-N 2),
pJK 148-gcdcl8-3H A -N l+N 2 (gcdcl8-N l+ N 2) an d pJK 148-gcdcl8-3H A -Pl-6
(gcdcl8-Pl-6) were all m ade using the QuikChange site-directed m utagenesis kit
(Stratagene). All constructs were sequenced over the entire gene to check that the
m utation was correct and that no additional m utations had been acquired.
W A-codon 205 was m utated from AAG to GAG thus changing the amino acid
from K to E.
WB-codon 287 was m utated from GAA to GGA thus changing the amino acid from
E to G.
179
Chapter 6 M aterials an d M ethods
N l-codons 49-51 were m utated from AGA AAA GOT to GGA GGA GCT thus
changing the amino acids from RKR to AAA.
N2-codons 91 and 92 were m utated from AAG AAA to GCG GGA thus changing
the amino acids from KK to A A.
Pl-codon 10 was m utated from AGA to GGA thus changing the amino acid from T
to A.
P2-codon 46 was m utated from AGA to GGA thus changing the amino acid from T
to A.
P3-codon 60 was m utated from AGA to GGA thus changing the amino acid from T
to A.
P4-codon 104 was m utated from ACC to GCC thus changing the amino acid from
T to A.
P5-codon 134 was m utated from AGA to GGA thus changing the amino acid from
T to A.
P6-codon 374 was m utated from ACT to GCT thus changing the amino acid from T
to A.
6.2.6 DNA sequencing
Sequence analysis was carried out using the dideoxynucleotide m ethod (Sanger et
al., 1977). The sequencing reaction was perform ed on either 50ng of purified PCR
product or 0.4pg of double stranded DNA m ade using the Qiagen m iniprep kit.
3.2pmoles of each prim er were used and the term ination ready reaction mix (Adye term inator, C-dye term inator, G-dye term inator, T-dye term inator, dITP,
dATP dCTP dTTP, Tris-HCl [pH9.0], MgClz, therm al stable pyrophosphatase, and
AmpliTaq DNA polymerase, FS). Samples were run on a 4.8% acrylamide gel and
detected using an ABI Prism 377 DNA sequencer.
6.2.7 Cell Extract Preparation
Cell extracts were prepared in several different ways:
Figure 2.4 B
Total boiled extracts were prepared from 2x10^ cells. Cells w ere washed in STOP
b u ffer (150mM N aCl, 50mM N aF, lOmM EDTA, Im M N aN g [pHS.O]),
resuspended in 150pl of RIPA buffer (lOmM NaPO^, 2mM EDTA, 150mM NaCl,
180
Chapter 6 M aterials an d M ethods
50mM NaF, O.lmM sodium orthovanadate, Im M PMSF, 4 |ig /m l leupeptin, 1%
triton and 0.1% SDS) and boiled for 5 minutes. Cells were broken using glass beads
then extracts w ere recovered by washing w ith 250pl of RIPA buffer. The protein
concentration of the extracts was determ ined by the BCA assay kit (Sigma) after
boiling 10 pi of extract for 5 minutes in 2x sample buffer (160mM Tris [pH 6.8], 20%
glycerol and 4% SDS). The rest of the extract was added to 5x sam ple buffer
(400mM Tris [pH 6.8], 50% glycerol, 10% SDS, 500mM DTT and 0.02%
brom ophenol blue) and boiled for 5 minutes.
Figure 2.2, 2.3 and 2.6
Soluble protein extracts were prepared as described previously (Moreno et al.,
1991). Extracts were prepared from frozen or fresh cells, broken in 20 /xl of HB
buffer (60mM fi-glycerophosphate, 25mM MOPS [pH 7.2], O.lmM sodium
orthovanadate, 15mM p-nitrophenylphosphate, 15mM MgCl2,15mM EGTA, ImM
DTT, Im M PMSF, 20pg/m l aprotinin, 20pg/m l leupeptin and 1% triton) with glass
beads before being w ashed w ith another 500pl of HB buffer. The extract was
recovered and protein determ ination was perform ed using 2pl of extract and the
BCA assay kit. The rest of extract was boiled in sample buffer.
Figure 2.4 A
For su clp bead precipitation, 1x10^ cells w ere protoplasted and lysed w ith HB
buffer as described by Grallert and Nurse (1996). Extracts were spun at 15 OOOrpm
for 15 minutes and the supernatant was used for the precipitation.
Figures 3.7. 4.1 and 4.5-4.11
2x10® cells were w ashed in STOP buffer then resuspended in 150pl of HB buffer
(60mM fi-glycerophosphate, 25mM MOPS [pH 7.2], 15mM MgCl2, 15mM EGTA
and 1% triton) before being boiled for 5 minutes. Cells were then either frozen at 70°C before extracts were m ade at a later time (Figure 4.1), or were imm ediately
broken w ith 1ml of glass beads in the FastPrep cell breaker (BiolOl). The extract
was then recovered protein determ ination was perform ed and extract was boiled
in sample buffer.
Figures 4.16 and 4.17 D and E
1x10^ cells were washed once in STOP buffer before being resuspended in 150|xl of
HB buffer (60mM B-glycerophosphate, 25mM MOPS [pH 7.2], O.lmM sodium
orthovanadate, 15mM p-nitrophenylphosphate, 15mM MgCl2,15mM EGTA, ImM
181
Chapter 6 M aterials a n d M ethods
DTT, Im M PMSF, 20p,g/ml aprotinin, 20|Lig/ml leupeptin and 1% triton) and
broken w ith 1ml of glass beads in the FastPrep cell breaker. The extract was then
spun for 5 m inutes at 13 OOOrpm. Protein determ ination was then performed.
6.2.8 W estern B lotting
Protein extracts w ere run on SDS-polyacrylamide gels (Laemmli, 1970). The
protein was then transferred to Immobilon m em brane (Millipore) and detected
using horseradish peroxidase-conjugated anti-rabbit or anti-m ouse antibody and
an ECL kit (Amersham) or Super Signal (Pierce).
T able 6.2
A n tib o d ies u sed for W estern b lottin g and im m unop récipitation
Antibody
Dilution
anti-cdclSp polyclonal (H. Nishitani)
1:2500 w hen overexpressed
anti-cdclSp polyclonal(H. Nishitani)
1:1000 w ildtype expression
anti-C-terminus cdclSp polyclonal (H. Nishitani)
1:2500
anti-rum lp polyclonal (J. Correa-Bordes)
1:500
anti-cdc2p PSTAIR antibody
1:5000
anti-HA 12CA5 monoclonal (ICRF)
1:1000
anti-HA 16B12 monoclonal (Babco)
5pl/IP
anti-cdc21p polyclonal (Z. Lygerou)
1000
anti-a-tubulin monoclonal (Sigma)
10000
anti-rabbit-HRP (Amersham)
2500
anti-mouse-HRP (Amersham)
2500
6.2.9 S u c lp bead precipitation
Extracts were prepared as described above. lOpl of su c lp beads or BSA control
beads were added to the extracts and rotated at 4°C for 1 hour. The precipitated
complexes were washed 3 times in FIB buffer and were boiled in 5x sample buffer
for 5 m inutes at 100°C. W estern blots were perform ed as described above, and
probed w ith anti-HA 12CA5 antibody and anti-cdc2p PSTAIR antibody.
182
Chapter 6 M aterials a n d M ethods
6.2.10 Im m unoprécipitations
Im m unoprécipitations were perform ed on 5mg of soluble protein in a volume of
0.5ml, Either no antibody or 5pl of antibody (16B12 or cdc21) was added to the
extracts and they were rotated at 4°C for 1 hour. 60pl of 1:1 bead suspension in HB
buffer (Protein G beads-16B12 or Protein A beads-cdc21) was then added to the
extracts and they w ere rotated for a further hour at 4°C. The beads w ere then
w ashed 3 times in HB buffer and were boiled in 2x sam ple buffer for 5 m inutes at
100°C.
6.2.11 H iston e k in ase assays
1/xl of rabbit polyclonal anti-cdcl3p antibody SP4 was added to AOOfig of protein
and incubated on ice for 1 hour. The imm unocomplexes were precipitated with
protein A-Sepharose beads (Pharmacia) for 30 m inutes at 4°C before being washed
3 times in HB buffer. The beads were then resuspended in 20 fil of reaction buffer
containing Im g /m l H I histone, 200/xM ATP and 40/xCi/ml [g-^^P]ATP and were
incubated at 30°C for 20 minutes. The reactions were stopped by the addition of
5/xl of 5x sample buffer before boiling for 3 m inutes at 100°C. Samples were run on
a 12% SDS-polyacrylam ide gel. Phosphorylated histone H I w as detected by
autoradiography.
6.2.12 V isu alisation of n u clei b y D A P l stainin g
Cells were fixed in 70% ethanol and stored at 4°C. Cells were then rehydrated in
w ater, heat fixed to a slide and m ounted in Ip g /m l DAPl, Im g /m l parap h en y le n ed iam in e, in 50% glycerol. P h o to g rap h s w ere taken u sin g the
Ham am atsu camera.
6.2.13 V isu alisation of septa b y calcofluor stainin g
Ethanol fixed cells were rehydrated as described above. Cells were left to air dry
on slides before being stained w ith calcofluor diluted lOOOx in water. Cells were
th e n
s c o re d
fo r
s e p ta tio n
u s in g
183
th e
flu o re s c e n t
m ic ro sc o p e .
Bibliography
Adachi, Y., U sukura, J. and Yanagida, M. (1997). A globular complex formation by
N d a l and the other five members of the MCM protein family in fission yeast. Genes
Cells. 2, 467-479.
A dam s, I. R. and K ilm artin, J. V. (2000). Spindle pole body: a m odel for
centrosome duplication. Trends Cell Biol. 10, 329-335.
A l-K hodairy, F. and Carr, A. M. (1992). DNA repair m utants defining G2
checkpoint pathw ays in Schizosaccharomyces pombe. EMBO J. 11,1343-1350.
A paricio, O. M., Stout, A. M. and Bell, S. P. (1999). Differential assem bly of
Cdc45p and DNA polymerases at early and late origins of DNA replication. Proc.
Natl. Acad. Sci. USA. 96,9130-9135.
A paricio, O. M., W einstein, D. M. and Bell, S. P. (1997). C om ponents and
dynamics of DNA replication complexes in S. cerevisiae: redistribution of MCM
proteins and Cdc45p during S phase. Cell. 91, 59-69.
A raki, H., Leem, S. H., Phongdara, A. and Sugino, A. (1995). D p b ll, which
interacts w ith DNA polymerase II (epsilon) in Saccharomyces cerevisiae, has a dual
role in S-phase progression and at a cell cycle checkpoint. Proc. Natl. Acad. Sci.
USA. 92,11791-11795.
Aves, S. J., Durkacz, B. W., Carr, A. and Nurse, P. (1985). Cloning, sequencing and
transcriptional control of the Schizosaccharomyces pombe cdclO 'start' gene. EMBO J.
4,457-463.
184
Aves, S. Jv T ongue, N., Foster, A. J. and H art, E. A. (1998). The essential
Schizosaccharomyces pombe cdc23 DNA replication gene shares structural and
functional homology with the Saccharomyces cerevisiae DNA43 (MCMIO) gene. Curr.
Genet. 34,164-171.
Bahler, J., W u, J.-Q., Longtine, M. S., Shah, N. G., M cKenzie III, A., Steever, A.
B., Wach, A., Philippsen, P. and Pringle, J. R. (1998). Heterologous m odules for
efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe.
Yeast 14, 943-951.
B arbet, N. C. and Carr, A. M. (1993). Fission yeast w eel protein kinase is not
required for DNA dam age-dependent mitotic arrest. Nature. 364, 824-827.
Basi, G. and Draetta, D. (1995). pl3®“‘^^ of Schizosaccharomyces pombe regulates two
distinct forms of the mitotic cdc2 kinase. Mol. Cell. Biol. 15, 2028-2036.
Basi, G., Schm id, E. and M aundrell, K. (1993). TATA box m utations in the
Schizosaccharomyces pombe n m tl prom oter affect transcription efficiency bu t not the
transcription start point or thiamine repressibility. Gene. 123,131-136.
Baum, B., N ishitani, H., Yanow, S. and N urse, P. (1998). Cdcl8 transcription and
proteolysis couple S phase to passage through mitosis. EMBO ]. 17,5689-5698.
B aum , B., W uarin, J. and N urse, P. (1997). C ontrol of S-phase periodic
transcription in the fission yeast mitotic cycle. EMBO J. 16,4676-4688.
Beach, D., Durkacz, B. and N urse, P. (1982). Functionally hom ologous cell cycle
control genes in budding and fission yeast. Nature. 300, 706-709.
Bell, S. P., M itchell, J., Leber, J., K obayashi, R. and Stillm an, B. (1995). The
m ultidom ain structure of O rclp reveals similarity to regulators of DNA replication
and transcriptional silencing. Cell. 83,563-568.
185
B ell, S. P. and S tillm an , B. (1992). A TP-dependent recognition of eukaryotic
origins of DNA replication by a m ultiprotein complex. Nature. 357,128-134.
B en ito, J., M artin-C astellanos, C. and M oreno, S. (1998). Regulation of the G1
phase of the cell cycle by periodic stabilization and degradation of the p25^^^^
CDK inhibitor. EMBO J. 17,482-497.
B en tley, N . J., H oltzm an, D . A., Flaggs, G., K eegan, K. S., D eM a g g io , A., Ford, J.
C., H oek stra, M . and Carr, A. M . (1996). The Schizosaccharomyces pombe rad3
checkpoint gene. EMBO J. 15, 6641-6651.
Berger, C., Strub, A., Staib, C., L epke, M ., Z isim o p o u lo u , P., H oeh n , K., N anda,
I., S cm id , M . and G rum m t, F. (1999). Identification and characterization of a
mouse homolog to yeast Cdc6p. Cytogenet. Cell Genet. 86,307-316.
B od d y, M . N ., Furnari, B., M on d esert, O. and R u sse ll, P. (1998). Replication
checkpoint enforced by kinases C dsl and C hkl. Science. 280, 909-912.
B ooher, R. and Beach, D . (1987). Interaction betw een cdcl3+ and cdc2+ in the
control of mitosis in fission yeast; dissociation of the G1 and G2 roles of the cdc2+
protein kinase. EMBO J. 6, 3441-3447.
B ooher, R. and B each, D . (1988). Involvem ent of cdcl3+ in mitotic control in
Schizosaccharomyces pombe: possible interaction of the gene p ro d u ct w ith
microtubules. EMBO J. 7, 2321-2327.
B ooher, R. N ., A lfa, C. E., H yam s, J. S. and Beach, D . H. (1989). The fission yeast
c d c 2 /c d c l3 /s u c l protein kinase: regulation of catalytic activity and nuclear
localization. Cell. 58, 485-497.
B ostock, C. J. (1970). DNA synthesis in the fission yeast Schizosaccharomyces pombe.
Exp. Cell Res. 60,16-26.
186
Breeding, C. S., H udson, J., Balasubram anian, M. K., H em m ingsen, C. S., Young,
P. G. and G ould, K. L. (1998). The cdr2+ gene encodes a regulator of G 2/M
progression and cytokinesis in Schizosaccharomyces pombe. Mol. Biol. Cell. 9, 33993415.
Brewer, B. J. and Fangm an, W. L. (1987). The localization of replication origins on
ARS plasmids in S. cerevisiae. Cell. 51, 463-471.
Broek, D., Bartlett, R., Crawford, K. and N urse, P. (1991). Involvement of
in establishing the dependency of S phase on mitosis. Nature. 349, 388-393.
Brown, G. W., Jallepalli, P. V., Huneycutt, B. J. and Kelly, T. V. (1997). Interaction
of the S phase regulator cdcl8 w ith cyclin-dependent kinase in fission yeast. Proc.
Natl. Acad. Sci. USA. 94, 6142-6147.
Brown, G. W. and Kelly, T. J. (1998). Purification of H sk l, a m inichrom osom e
maintenance protein kinase from fission yeast. J. Biol. Chem. 273, 22083-22090.
Brown, G. W. and Kelly, T. J. (1999). Cell cycle regulation of D fpl, an activator of
the H skl protein kinase. Proc. Natl. Acad. Sci. USA 96, 8443-8448.
Bueno, A., R ichardson, H., Reed, S. I. and R ussell, P. (1991). A fission yeast Btype cyclin functioning early in the cell cycle. Cell. 66,149-159.
Bueno, A., Richardson, H., Reed, S. I. and Russell, P. (1993). A fission yeast Btype cyclin functioning early in the cell cycle (Erratum). Cell. 73,1050.
Bueno, A. and Russell, P. (1993). Two fission yeast B-type cyclins, Cig2 and Cdcl3,
have different functions in mitosis. Mol. Cell. Biol. 13, 2286-2297.
Byers, B. and Goetsch, L. (1974). Duplication of spindle plaques and integration of
the yeast cell cycle. Cold Spring Harbor Symp. Quant. Biol. 38,123-131.
187
C aligiuri, M. and Beach, D. (1993). Sctl functions in partnership w ith CdclO in a
transcription complex that activates cell cycle START and inhibits differentiation.
Cell 72, 607-619.
Chong, J. P. J., M ahbubani, H. M., Khoo, C. and Blow, J. J. (1995). Purification of
an M CM -containing complex as a com ponent of the DNA replication licensing
system. Nature. 375,418-421.
C hristensen, P. U., Bentley, N. J., M artinho, R. G., N ielsen, O. and Carr, A. M.
(2000). M ikl levels accum ulate in S phase and m ay m ediate an intrinsic link
between S phase and mitosis. Proc. Natl. Acad. Sci. USA. 97,2579-2584.
C huang, R. and Kelly, T. J. (1999). The fission yeast hom ologue of Orc4p binds to
replication origin DNA via m ultiple AT-hooks. Proc. N a tl Acad. Sci USA. 96, 26562661.
C larke, D. J. and G im inez-A bian, J. F. (2000). Checkpoints controlling mitosis.
BioEssays. 22,351-363.
Clyne, R. K. and Kelly, T. J. (1995). Genetic analysis of an ARS element from the
fission yeast Schizosaccharomyces pombe. EMBO J. 14, 6348-6357.
Cocker, J. H., Piatti, S., Santocanale, C., N asm yth, K. and D iffley, J. F. X. (1996).
An essential role for the Cdc6 protein in forming the pre-replicative complexes of
budding yeast. Nature. 379,180-182.
Colem an, T. R., Carpenter, P. B. and D unphy, W. G. (1996). The Xenopus Cdc6
protein is essential for the initiation of a single round of DNA replication in cellfree extracts. Cell. 87,53-63.
Colem an, T. R., Tang, Z. and D unphy, W. G. (1993). Negative regulation of the
W eel protein kinase by direct action of the n im l/c d r l mitotic inducer. Cell 72,
919-929.
188
Connolly, T. and Beach, D. (1994). Interaction betw een the C igl and Cig2 B-type
cyclins in the fission yeast cell cycle. Mol. Cell. Biol. 14, 768-776.
Correa-Bordes, J. and N urse, P. (1995).
orders S phase and mitosis by
acting as an inhibitor of the p34^^^^ mitotic kinase. Cell. S3,1001-1009.
Correa-Bordes, J. and N urse, P. (1997). p25^^^^ prom otes proteolysis of the
mitotic B-cyclin p56^^^^'^ during G1 of the fission yeast cell cycle. EMBO ]. 16,
4657-4664.
Coue, M., K earsey, S. E. and M echali, M. (1996). C hrom atin binding, nuclear
localization and phosphorylation of Xenopus cdc21 are cell-cycle dependent and
associated w ith the control of initiation of DNA replication. EMBO J. 15,1085-1097.
Coxon, A., M aundrell, K. and Kearsey, S. E. (1992). Fission yeast cdc21+ belongs to
a family of proteins involved in an early step of chrom osome replication. Nucl.
Acids Res. 20, 5571-5577.
D alton, S. and H opw ood, B. (1997). Characterization of Cdc47p-minichromosome
m aintenance complexes in Saccharomyces cerevisiae: Identification of Cdc45p as a
subunit. Mol. Cell. Biol. 17, 5867-5875.
D alton, S. and W hitbread, L. (1995). Cell cycle-regulated nuclear im port and
export of Cdc47, a protein essential for initiation of DNA replication in budding
yeast. Proc. Natl. Acad. Sci. USA. 92,2514-2518.
D ePam philis, M. L. (1999). Replication origins in m etazoan chromosomes: fact or
fiction? BioEssays. 21, 5-16.
DeRyckere, D., Sm ith, C. L. and M artin, G. S. (1999). The role of nucleotide
binding and hydrolysis in the function of the fission yeast cdclS'^ gene product.
Genetics. 151,1445-1457.
189
D iffle y , J. F. X. and C ocker, J. H. (1992). Protein-DNA interactions at a yeast
replication origin. Nature. 357,169-172.
D iffle y , J. F. X., Cocker, J. H., D o w e ll, S. J. and R o w ley , A. (1994). Two steps in
the assembly of complexes at yeast replication origins in vivo. Cell 78,303-316.
D in g , R., W est, R. R., M orphew , D . M ., O akley, B. R. and M cIntosh, J. R. (1997).
The spindle pole body of Schizosaccharomyces pomhe enters and leaves the nuclear
envelope as the cell cycle proceeds. Mol. Biol. Cell. 8,1461-1479.
D o n o v a n , S. and D iffle y , J. F. X. (1996). Replication origins in eukaroytes. Curr.
Opin. Genet. Dev. 6, 203-207.
D o n o v a n , S., H arw ood , J., D rury, L. S. and D iffle y , J. F. X. (1997). Cdc6p-
dependent loading of Mem proteins onto pre-replicative chrom atin in budding
yeast. Proc. Natl. Acad. Sci. USA. 94,5611-5616.
D raetta, G., Luca, F., W esten dorf, J., B rizuela, L., R uderm an, J. and Beach, D.
(1989). cdc2 protein kinase is complexed w ith both cyclin A and B: evidence for
proteolytic inactivation of MPF. Cell. 56, 829-838.
D u b ey , D . D ., K im , S., T odorov, I. T. and H uberm an, J. A. (1996). Large, complex
m odular structure of a fission yeast DNA replication origin. Curr. Biol. 6,467-473.
D u n p h y , W. G., B rizu ela, L., B each, D . and N ew p o rt, J. (1988). The Xenopus
hom olog of cdc2 is a component of MPF, a cytoplasmic regulator of mitosis. Cell.
54, 423-431.
D utta, A. and B ell, S. P. (1997). Initiation of DNA replication in eukaryotic cells.
Annu. Rev. Cell. Dev. Biol. 13,293-332.
E dw ards, R. J., B en tley, N . J. and Carr, A. M . (1999). A Rad3-Rad26 complex
responds to DNA dam age independently of other checkpoint proteins. Nat. Cell
Biol 1,393-397.
190
Elsasser, S., Chi, Y., Yang, P. and Cam pbell, J. L. (1999). Phosphorylation controls
tim ing of Cdc6p destruction: a biochemical analysis. Mol. Biol. Cell. 10,3263-3277.
Enoch, T., Carr, A. and Nurse, P. (1992). Fission yeast genes involved in coupling
mitosis to completion of DNA replication. Genes Dev. 6, 2035-2046.
Enoch, T., G ould, K. and N urse, P. (1991). Mitotic checkpoint control in fission
yeast. In Cold Spring Harbor Symp. Quant. Biol, vol. 56 (ed. 409-416: CSH Laboratory
Press.
Enoch, T. and N orbury, C. (1995). Cellular responses to DNA damage: cell-cycle
checkpoints, apoptosis and the roles of p53 and ATM. Trends Biochem. Sci. 20, 426430.
Enoch, T. and N urse, P. (1990). M utation of fission yeast cell cycle control genes
abolishes dependence of mitosis on DNA replication. Cell. 60, 665-673.
Evans, T., Rosenthal, E., Youngbloom, J., D istel, D. and H unt, T. (1983). Cyclin: a
protein specified by m aternal mRNA in sea urchin eggs that is destroyed at each
cleavage division. Cell. 33,389-396.
Fantes, P. and Nurse, P. (1977). Control of cell size at division in fission yeast by a
growth-m odulated size control over nuclear division. Exp. Cell Res. 107,377-386.
Fantes, P. A. and Nurse, P. (1978). Control of the tim ing of cell division in fission
yeast. Cell size m utants reveal a second control pathw ay. Exp. Cell Res. 115, 317329.
Featherstone, C. and Russell, P. (1991). Fission yeast pl07^^^^ mitotic inhibitor is
a tyrosine/serine kinase. Nature. 349, 808-811.
Feldm an, R. M. R., Correll, C. C., K aplan, K. B. and D eshaies, R. J. (1997). A
complex of Cdc4p, S kplp, and C dc53p/C ullin catalyzes ubiquitination of the
phosphorylated CDK inhibitor Siclp. Cell. 91, 221-230.
191
Fenech, M., Carr, A. M., M urray, J., W atts, F. Z. and A.R., L. (1991). Cloning and
characterisation of the rad4 gene of Schizosaccharomyces pombe: a gene show ing
short regions of sequence similarity to the hum an XRC C l gene. N u cl Acids Res. 19,
6737-6741.
Fisher, D. L. and Nurse, P. (1996). A single fission yeast mitotic cyclin B
kinase promotes both S-phase and mitosis in the absence of G1 cyclins. EMBO /. 15,
850-860.
F orsburg, S. L. (1993). C om parison of Schizosaccharomyces pombe expression
systems. Nuc. Acids Res. 21,2955-2956.
Forsburg, S. L. and Nurse, P. (1991). Identification of a G l-type cyclin pucl'^ in the
fission yeast Schizosaccharomyces pombe. Nature 351,245-248.
Forsburg, S. L. and Nurse, P. (1994a). Analysis of the Schizosaccharomyces pombe
cyclin p u d : evidence for a role in cell cycle exit. /. Cell Sci. 107, 601-613.
Forsburg, S. L. and N urse, P. (1994b). The fission yeast cdcl9+ gene encodes a
m em ber of the MCM family of replication proteins. J. Cell Sci. 107, 2779-2788.
Fujita, M., Kiyono, T., Hayashi, Y. and Ishibashi, M. (1997). In vivo interaction of
hum an MCM heterohexameric complexes w ith chromatin. /. Biol. Chem. 272,1092810935.
Fujita, M., Yamada, C., Goto, C., Yokoyama, N., K uzushim a, K., Inagaki, M. and
T su ru m i, T. (1999). Cell cycle re g u la tio n
of H u m a n
CDC6 p ro te in
INTRACELLULAR LOCALIZATION, INTERACTION WITH THE HUM AN
M CM
COM PLEX,
AND
CDC2
K IN A SE-M ED IA TED
H Y PER PH O S­
PHORYLATION. J. Biol. Chem. 274, 25927-25932.
F unabiki, H., Yamano, H., Kum ada, K., Nagao, K., H unt, T. and Yanagida, M.
(1996). Cut2 proteolysis required for sister-chrom atid separation in fission yeast.
Nature. 381, 438-441.
192
F u n ab ik i, H ., Y am ano, H., N agao, K., T anaka, H ., Y asuda, H ., H unt, T. and
Y anagida, M . (1997). Fission yeast Cut2 required for anaphase has two destruction
boxes. EMBO ]. 16, 5977-5987.
Furnari, B., B lasina, A., B oddy, M. N ., M cG ow an , C. H . and R u ssell, P. (1999).
Cdc25 inhibited in vivo and in vitro by checkpoint kinases C d sl and C hkl. Mol.
Biol Cell 10, 833-845.
G autier, J., N orbury, C., Lohka, M ., N u rse, P. and M ailer, J. (1988). Purified
m aturation-prom oting factor contains the product of a Xenopus homolog of the
fission yeast cell cycle control gene cdc2+. Cell 54,433-439.
G eraghty, D . S., D in g , M ., H ein tz, N . H. and P ederson , D . S. (2000). Prem ature
structural changes at replication origins in a yeast m inichrom osome maintenance
(MCM) mutant. /. Biol Chem. 275,18011-18021.
G o u ld , K. L., M oren o, S., O w e n , D . J., Sazer, S. and N u r se , P. (1991).
Phosphorylation at Thr 167 is required for Schizosaccharomyces pombe p34cdc2
function. EMBO J. 10, 3297-3309.
G ou ld , K. L., M oreno, S., T onks, N . K. and N urse, P. (1990). Com plem entation of
the mitotic activator, p80^^^^^, by a hum an protein-tyrosine phosphatase. Science.
250,1573-1576.
G ou ld , K. L. and N urse, P. (1989). Tyrosine phosphorylation of the fission yeast
cdc2+ protein kinase regulates entry into mitosis. Nature. 342,39-45.
G rallert, B., and P. N urse. (1996). The ORCl homolog o rp l in fission yeast plays a
key role in regulating onset of S phase. Genes Dev. 10,2644-2654.
G riffith s, D ., U chiyam a, M ., N urse, P. and W ang, T. S. F. (2000). A novel m utant
allele of the chrom atin bound fission yeast checkpoint protein R a d i7 separates the
DNA structure checkpoints. J. Cell Sci. 113, 1075-1088.
193
G riffiths, D. J., Barbet, N. C., M cCready, S., Lehm ann, A. R. and Carr, A. M.
(1995). Fission yeast radl7; a hom ologue of b udding yeast R A D 24 that shares
regions of sequence similarity w ith DNA polymerase accessory proteins. EMBO J.
14, 5812-5823.
G uenther, B., O nrust, R., Sali, A., O 'D onnell, M. and K uriyan, J. (1997). Crystal
stru ctu re of the delta' subunit of the clam p-loader com plex of E. coli DNA
polymerase III. Cell. 91, 335-345.
H agan, I., Hayles, J. and Nurse, P. (1988). Cloning and sequencing of the cyclinrelated cdcl3+ gene and a cytological study of its role in fission yeast mitosis. /.
Cell Sci 91,587-595.
H ardy, C. F., Dryga, O., Seematter, S., Pahl, P. M. B. and Sclafani, R. A. (1997).
mcm5/cdc46-bobl bypasses the requirem ent for the S phase activator Cdc7p. Proc.
Natl. Acad. Sci. USA. 94, 3151-3155.
H ardy, C. F. J. (1997). Identification of Cdc45p, an essential factor required for
DNA replication. Gene 187, 239-246.
H artw ell, L. and W einert, T. (1989). Checkpoints: controls that ensure the order of
cell cycle events. Science 246, 629-634.
H ateboer, G., W obst, A., O tzen Petersen, B., Le Cam, L., Vigo, E., Sardet, C. and
H elin , K. (1998). Cell cycle-regulated expression of m am m alian CDC6 is
dependent on E2F. Mol. Cell. Biol. 18, 6679-6697.
H ayles, J., Fisher, D., W oollard, A. and N urse, P. (1994). Tem poral order of Sphase and mitosis in fission yeast is determ ined by the state of the
mitotic
B cyclin complex. Cell. 78, 813-822.
Hayles, J. and Nurse, P. (1995). A pre-start checkpoint preventing mitosis in fission
yeast acts independently of p34^<^^^ tyrosine phosphorylation. EMBO J. 14, 27602771.
194
H endrickson, M., M adine, M., D alton, S. and Gautier, J. (1996). Phosphorylation
of MCM4 by cdc2 protein kinase inhibits the activity of the m inichrom osom e
maintenance complex. Proc. N a tl Acad. Sci USA. 93,12223-12228.
H ennessy, K. M., Clark, C. D. and Botstein, D. (1990). Subcellular localization of
yeast CDC46 varies w ith the cell cycle. Genes Dev. 4, 2252-2263.
Herbig, U., M arlar, C. A. and Fanning, E. (1999). The Cdc6 nucleotide-binding site
regulates its activity in DNA replication in hum an cells. M o l Biol Cell 10, 26312645.
H irano, T., Funahashi, S., U em ura, T. and Yanagida, M. (1986). Isolation and
characterization of Schizosaccharomyces pombe cut m utants that block nuclear
division but not cytokinesis. EMBO J. 5,2973-2979.
H irano, T., H iraoka, Y. and Y anagida, M. (1988). A tem perature-sensitive
m utation of the Schizosaccharomyces pombe gene nuc2+ that encodes a nuclear
scaffold-like protein blocks spindle elongation in mitotic anaphase. J. Cell Biol. 106,
1171-1183.
H ofm ann, J. F. X. and Beach, D. (1994). cdtl is an essential target of the CdclO /Sctl
transcription factor: requirem ent for DNA replication and inhibition of mitosis.
EM BO ]. 13,425-434.
H om esley, L., Lei, M., K aw asaki, Y., Sawyer, S., C hristensen, T. and Tye, B.
(2000). McmlO and the MCM2-7 complex interact to initiate DNA synthesis and to
release replication factors from origins. Cenes Dev. 14, 913-926.
H opw ood, B. and D alton, S. (1996). Cdc45p assem bles into a complex w ith
Cdc46p/M cm 5p, is required for minichromosome maintenance, and is essential for
chromosomal DNA replication. Proc. N a tl Acad. Sci USA. 93,12309-12314.
195
H ua, X. H. and N ew p ort, J. (1998). Identification of a preinitiation step in DNA
replication that is independent of Origin Recognition Complex and cdc6, but
dependent on cdk2. /. Cell Biol. 140, 271-281.
Ishiai, M ., D ean , F. B., O kum ura, K., A be, M ., M oon, K., A m in , A. A., K agotani,
K., T aguchi, H., M urakam i, Y., H anaoka, F. et al. (1997). Isolation of hum an and
fission yeast homologues of the budding yeast origin recognition complex subunit
ORC5: hum an homologue (ORC5L) maps to 7q22. Genomics. 46, 294-298.
Ish im i, Y. (1997). A DNA helicase activity is associated w ith an MCM4, -6 and -7
protein complex. ]. Biol. Chem. 272,24508-24513.
Ish im i, Y., K om am ura, Y., You, Z. and Kimura, H. (1998). Biochemical function of
mouse minichromosome maintenance 2 protein. ]. Biol. Chem. 273, 8369-8375.
Ish im i, Y., K om am ura-K ohno, Y., You, Z., O m ori, A. and K itagaw a, M . (2000).
Inhibition of Mcm4,6,7 helicase activity by phosphorylation w ith Cyclin A /C d k 2 . }.
Biol. Chem. 275,16235-16241.
Jallepalli, P. V., B row n, G. W., M uzi-Falconi, M ., T ien, D . and K elly, T. J. (1997).
Regulation of the replication initiator protein p65^^^^^ by CDK phosphorylation.
Genes Dev. 11, 2767-2779.
Jallep alli, P. V., T ien , D . and K elly, T. J. (1998). sudl'^ targets cyclin-dependent
kinase-phosphorylated C dcl8 and R um l proteins for degradation and stops
unw anted diploidization in fission yeast. Proc. Natl. Acad. Sci. USA. 95, 8159-8164.
Jans, D . A., Briggs, L. J., G ustin, S. E., Jans, P., Ford, S. and Y oung, I. G. (1997). A
functional bipartite nuclear localization signal in the cytokine interleukin-5. FEBS
Lett. 406,315-320.
Jares, P. and B low , J. J. (2000). Xenopus Cdc7 function is dependent on licensing
b u t not on XORC, XCdc6, or CDK activity and is required for XCdc45 loading.
Genes Dev. 14,1528-1540.
196
Jiang, W., M cD onald, D., H ope, T. J. and H unter, T. (1999a). M ammalian Cdc7Dbf4 protein kinase complex is essential for initiation of DNA replication. EMBO J.
18, 5703-5713.
Jiang, W., W ells, N. J. and H unter, T. (1999b). M ultistep regulation of DNA
replication by Cdk phosphorylation of HsCdc6. Proc. Natl. Acad. Sci. USA. 96, 61936198.
Johnston, G. C., Pringle, J. R. and H artw ell, L. H. (1977). Coordination of growth
w ith cell division in the yeast S. cerevisiae. Exp. Cell Res. 105, 79-98.
Jong, A., Young, M., Chen, G., Zhang, S. Q. and Chan, C. (1996). Intracellular
location of the Saccharomyces cerevisiae CDC6 gene product. D N A Cell. Biol. 15, 883895.
K anoh, J. and Russell, P. (1998). The protein kinase Cdr2, related to n im l/c d r l
m itotic inducer, regulates the onset of mitosis in fission yeast. Mol. Biol. Cell 9,
3321-3334.
K earsey, S. E., M ontgom ery, S., Labib, K. and L indner, K. (2000). Chrom atin
binding of the fission yeast replication factor mcm4 occurs during anaphase and
requires ORC and cdcl8. EMBO J. 19,1681-1690.
Kelly, T. J., M artin, G. S., Forsburg, S. L., Stephen, R. J., Russo, A. and Nurse, P.
(1993). The fission yeast cdclS gene product couples S-phase to start and mitosis.
Cell. 74, 371-382.
K im , S. an d H u b erm an , J. A. (1998). M u ltip le o rie n ta tio n -d e p e n d e n t,
synergistically interacting, sim ilar dom ains in the ribosom al DNA replication
origin of the fission yeast, Schizosaccharomyces pombe. Mol. Cell. Biol. 18,7294-7303.
Kim, S. H., Lin, D. P., M atsum oto, S., K itzono, A. and M atsum oto, T. (1998).
Fission yeast slpl: an effector of the m ad2-dependent spindle checkpoint. Science.
279,1045-1047.
197
Kitamura, K., M aekaw a, H. and Shim oda, C. (1998). Fission yeast Ste9, a homolog
of H c tl/C d h l and Fizzy-related, is a novel negative regulator of cell cycle
progression during Gl-phase. M ol Biol Cell 9,1065-1080.
K n u d sen , K. E., K nu dsen , E. S., W ang, J. Y. and Subram ani, S. (1996). p34^^^2
kinase activity is m aintained upon activation of the replication checkpoint in
Schizosaccharomyces pombe. Proc. N a tl Acad. Sci USA. 93, 8278-8283.
K o h li, J. and N u rse, P. (1995). Genetic nom enclature guide. Schizosaccharomyces
pombe. Trends Gen. March, 9-10.
K om in am i, K., O chotorena, I. and T oda, T. (1998a). Two F -box/W D -repeat
proteins P opl and Pop2 form hetero- and homo-complexes together w ith cullin-1
in the fission yeast SCF (Skpl-Cullin-l-F-box) ubiquitin ligase. Genes Cells. 3, 721735.
K om inam i, K., Seth-Sm ith, H. and Toda, T. (1998b). ApclO and S te9/S rw l, two
regulators of the APC-cyclosome, as well as the CDK inhibitor R um l are required
for G1 cell-cycle arrest in fission yeast. EMBO J. 17, 5388-5399.
K o m in a m i, K. and T oda, T. (1997). Fission yeast W D -repeat protein P o p l
regulates genome ploidy through ubiquitin-proteosom e-m ediated degradation of
the CDK inhibitor R um l and the S-phase initiator Cdcl8. Genes Dev. 11,1548-1560.
K ostrub, C. F., K n u d sen , K., Subram ani, S. and E noch, T. (1998). H u s lp , a
conserved fission yeast checkpoint protein, interacts w ith R a d lp and is
phosphorylated in response to DNA damage. EMBO J. 17,2055-2066.
K ubota, Y., M im ura, S., N ish im oto , S., M asuda, T., N ojim a, H. and T akisaw a, H.
(1997). Licensing of DNA replication by a m ulti-protein complex of M C M /P l
proteins in Xenopus eggs. EMBO J. 16,3320-3331.
198
K ubota, Y., M im ura, S., N ish im o to , S., T ak isaw a, H. and N o jim a , H. (1995).
Identification of the yeast MCM3-related protein as a component of Xenopus DNA
replication licensing factor. Cell 81, 601-609.
K u k im oto, I., Igak i, H. and K anda, T. (1999). H um an CDC45 protein binds to
minichromosome maintenance 7 protein and the p70 subunit of DNA polymerase
a. Eur. J. Biochem. 2 6 5 , 936-943.
K um agai, A. and D u n p h y , W. G. (1991). The cdc25 protein controls tyrosine
dephosphorylation of the cdc2 protein in a cell-free system. Cell. 64, 903-914.
Kurjan, J. (1993). The pherom one response pathw ay in Saccharomyces cerevisiae.
Ann. Rev. Genet. 27,147-179.
Labbe, J., C apony, J., Caput, D ., Cavadore, J., D esancourt, M ., K aghad, M ., Lelias,
J. M ., Picard, A. and D oree, M. (1989a). MPF from starfish oocytes at first meiotic
m etaphase is an heterodim er containing one molecule of cdc2 and one molecule of
cyclin B. EMBO J. 8, 3053-3058.
Labbe, J. C., Lee, M . G., N urse, P., Picard, A. and D oree, M . (1988). Activation at
M -phase of a protein kinase encoded by a starfish hom ologue of the cell cycle
control gene cdc2+. Nature. 335, 251-254.
Labbe, J. C., Picard, A., P eaucellier, G., Cavadore, J. C., N urse, P. and D orée, M.
(1989b). Purification of MPF from starfish: identification as the H I histone kinase
p34cdc2 and a possible mechanism for its periodic activation. Cell. 57,253-263.
Labib, K., D iffle y , J. F. X. and K earsey, S. E. (1999). G l-phase and B-type cyclins
exclude the DNA-replication factor Mcm4 from the nucleus. Nat. Cell Biol. 1, 415422.
L abib, K., T ereco, J. A. and D iffle y , J. F. X. (2000). U ninterrupted MCM2-7
function required for DNA replication fork progression. Science 288,1643-1647.
199
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature. 117, 680-685.
Leatherwood, J., Lopez-Girona, A. and Russell, P. (1996). Interaction of Cdc2 and
Cdcl8 w ith a fission yeast ORC2-like protein. Nature. 379, 360-363.
Lee, K. M., Saiz, J. E., Barton, W. A. and Fisher, R. P. (1999). Cdc2 activation in
fission yeast depends on Mcs6 and C skl, two partially redundant Cdk-activating
kinases (CAK)s. Curr. Biol. 9 , 441-444.
Lee, M. G. and N urse, P. (1987). Com plem entation used to clone a hum an
hom ologue of the fission yeast cell cycle control gene cdc2. Nature. 327,31-35.
Lee, M. S., Enoch, T. and Piwinica-W orm s, H. (1994). m ikl+ encodes a tyrosine
kinase that phosphorylates p34^^^^ on tyrosine 15. ]. Biol. Chem. 269, 30530-30537.
Lei, M., Kawasaki, Y., Young, M. R., Kihara, M., Sugino, A. and Tye, B. K. (1997).
Mcm2 is a target of regulation by Cdc7-Dbf4 du rin g the initiation of DNA
synthesis. Genes Dev. 11, 3365-3374.
Liang, C. and Stillm an, B. (1997). Persistent initiation of DNA replication and
chrom atin-bound MCM proteins during the cell cycle in cdc6 m utants. Genes Dev.
11,3375-3386.
Liang, C., W einreich, M. and Stillm an, B. (1995). ORC and Cdc6p interact and
determ ine the frequency of initiation of DNA replication in the genome. Cell. 81,
667-676.
Lieberm an, H. B., H opkins, K. M., Nass, M., D em etrick, D. and Davey, S. (1996).
A hum an hom olog of the Schizosaccharomyces pombe radS"^ checkpoint control gene.
Proc. Natl. Acad. Sci. USA. 93,13890-13895.
200
L indsay, H. D ., G riffiths, D . J., Edwards, R. J., C hristensen, P. U., M urray, J. M.,
O sm an, F., W alw orth, N . and Carr, A. M. (1998). S-phase-specific activation of
C dsl
k in ase
defin es
a s u b p a th w a y
of the
ch ec k p o in t resp o n se
in
Schizosaccharomyces pombe. Genes Dev. 12,382-395.
L isziew icz, J., G odany, A., A gosto n , D . V. and K u n tzel, H. (1988). Cloning and
characterisation of the Saccharomyces cerevisiae CDC6 gene. Nucl. Acids Res. 16,
11507-11520.
Lohka, M . J., H ayes, M . K. and M ailer, J. L. (1988). Purification of m aturation-
prom oting factor, an intracellular regulator of early mitotic events. Proc. Natl. Acad.
Sci. USA 85, 3009-3013.
L o n g h ese, M . P., P aciotti, V ., F rasch ini, R., Z accarini, R., P lev a n i, P. and
L u cch in i, G . (1997). The novel DNA dam age checkpoint protein D d clp is
phosphorylated periodically during the cell cycle and in response to DNA damage
in budding yeast. EMBO J. 16, 5216-5226.
L opez-G irona, A., Furnari, B., M on d esert, O. and R u sse ll, P. (1999). Nuclear
localization of Cdc25 is regulated by DNA dam age and a 14-3-3 protein. Nature.
3 9 7 , 172-175.
L op ez-G iron a, A ., M o n d esert, O ., L ea th erw o o d , J. and R u s se ll, P. (1998).
Negative regulation of cdcl8 DNA replication protein by cdc2. Mol. Biol. Cell. 9, 6373.
L ow ndes, N . F., M cln em y , C. J., Johnson, A. L., Fantes, P. A. and Johnston, L. H.
(1992). Control of DNA synthesis genes in fission yeast by the cell-cycle gene
cdclO+. Nature. 3 5 5 , 449-452.
Lundgren, K., W alw orth, N ., Booher, R., D em b sk i, M ., K irschner, M . and Beach,
D . (1991). m ikl and w eel cooperate in the inhibitory tyrosine phosphorylation of
cdc2. Cell. 64,1111-1122.
201
Lydall, D. and W einert, T. (1995). Yeast checkpoint genes in DNA dam age
processing: implications for repair and arrest. Science. 270,1488-1491.
Lygerou, Z. and N urse, P. (1999). The fission yeast origin recognition complex is
constitutively associated with chromatin and is differentially modified through the
cell cycle. J. Cell Sci. 112, 3703-3712.
M acNeill, S. A. and Fantes, P. (1993). Methods for analysis of the fission yeast cell
cycle,. In in "The Cell Cycle", Practical Approach Series, IRL Press at Oxford University
Press, (ed. 93-125).
M adine, M. A., Khoo, C., M ills, A. D. and Laskey, R. A. (1995). MCM3 complex
required for cell cycle regulation of DNA replication in vertebrate cells. Nature. 375,
421-424.
M aine, G. T., Sinha, P. and Tye, B. (1984). M utants of S. cerevisiae defective in the
maintenance of minichromosomes. Genetics. 106, 365-385.
M aiorano, D., M oreau, J. and M echali, M. (2000). XCDTl is required for the
assembly of pre-replicative complexes in Xenopus laevis. Nature. 404, 622-625.
M aiorano, D., van A ssendelft, G. B. and Kearsey, S. E. (1996). Fission yeast cdc21,
a m em ber of the MCM protein family, is required for onset of S phase and is
located in the nucleus throughout the cell cycle. EMBO J. 15, 861-872.
M artin-C astellanos, C., Blanco, M. A., de Prada, J. M. and M oreno, S. (2000). The
p u d cyclin regulates the G1 phase of the fission yeast cell cycle in response to cell
size. Mol. Biol. Cell. 11, 543-554.
M artin-C astellanos, C., Labib, K. and M oreno, S. (1996). B-type cyclins regulate
G1 progression in fission yeast in opposition to the p25^^^^ cdk inhibitor. EMBO ].
15, 839-849.
202
M artinho, R. G., Lindsay, H. D., Flaggs, G., DeM aggio, A. J., H oekstra, M. P.,
Carr, A. M. and Bentley, N. J. (1998). Analysis of Rad3 and C hkl protein kinases
defines different checkpoint responses. EMBO /, 17, 7239-7249.
M asai, H., M iyake, T. and Arai, K. (1995). hskl'^, a Schizosaccharomyces pombe gene
related to Saccharomyces cerevisiae CDC7, is required for chromosomal replication.
EM BO ]. 14, 3094-3104.
M asui, Y. and M arkert, C. (1971). Cytoplasmic control of nuclear behaviour during
meiotic m aturation of frog oocytes. /. Exp. Zool. 177,129-146.
M aundrell, K. (1990). n m tl of fission yeast: a highly transcribed gene completely
repressed by thiamine. J. Biol. Chem. 265.
M au n d rell, K., H utchison, A. and Shall, S. (1988). Sequence analysis of ARS
elements in fission yeast. EMBO J. 7, 2203-2209.
M cFarlane, R. J., Carr, A. M. and Price, C. (1997). C haracterisation of the
Schizosaccharomyces pombe rad4/cut5 m utant phenotypes: dissection of DNA
replication and G2 checkpoint control function. Mol. Gen. Genet. 255, 332-340.
M erchant, A. M., Kawasaki, Y., Chen, Y., Lei, M. and Tye, B. K. (1997). A lesion in
the DNA replication initiation factor McmlO induces pausing of elongation forks
through chromosomal replication origins in Saccharomyces. cerevisiae. Mol. Cell. Biol.
17, 3261-3271.
M im ura, S. and Takisaw a, H. (1998). Xenopus Cdc45-dependent loading of DNA
polym erase a onto chrom atin under the control of S-phase cdk. EMBO J. 17, 56995707.
M iyake, S., O kishio, N., Sam ejim a, L, H iraoka, Y., Toda, T., Saitoh, I. and
Yanagida, M. (1993). Fission yeast genes ndal'^ and nda4'^, m utations of which lead
to S-phase block, chrom atin alteration and Ca^+ suppression, are members of the
CDC46/MCM2 family. Mol. Biol. Cell. 4,1003-1015.
203
M iyake, S. and Yam ashita, S. (1998). Identification of sna41 gene, which is the
su p p re sso r of n d a 4 m u ta tio n and is in volved in DN A replication in
Schizosaccharomyces pombe. Genes Cells. 3,157-166.
M iyam oto, M., Tanaka, K. and Okayam a, H. (1994). res2+, a new member of the
cdclO+/SW14 family, controls the 'start' of m itotic and meiotic cycles in fission
yeast. EMBO ]. 13,1873-1880.
M izushim a, T., T akahashi, N. and Stillm an, B. (2000). Cdc6p m odulates the
structure and DNA binding activity of the origin recognition complex in vitro.
Genes Dev. 14,1631-1641.
M ondesert, O., M cGow an, C. H. and Russell, P. (1996). Cig2, a B-type cyclin,
prom otes the onset of S in Schizosaccharomyces pombe. Mol. Cell. Biol. 16,1527-1533.
M oon, K., K ong, D., Lee, J., R a y ch au d h u ri, S. and H u rw itz, J. (1999).
Identification and reconstitution of the origin recognition com plex from
Schizosaccharomyces pombe. Proc. Natl. Acad. Sci. USA. 96,12367-12372.
M oreno, S., Hayles, J. and Nurse, P. (1989). Regulation of p34^^^2 protein kinase
during mitosis. Cell. 58,361-372.
M oreno, S., Klar, A. and N urse, P. (1991). M olecular genetic analysis of fission
yeast Schizosaccharomyces pombe. Method. Enzymol. 194, 795-723.
M oreno, S. and N urse, P. (1990). Substrates for p34cdc2: in vivo veritas? Cell. 61,
549-551.
M oreno, S. and N urse, P. (1994). Regulation of progression through the G1 phase
of the cell cycle by the rwml+ gene. Nature. 367, 236-242.
M oreno, S., N urse, P. and R ussell, P. (1990). Regulation of mitosis by cyclic
accumulation of p80^^^^-^ mitotic inducer in fission yeast. Nature. 344,549-552.
204
M organ, D. O. (1999). Regulation of the APC and the exit from mitosis. Nat. Cell
Biol. 1, E47-53.
M urakam i, H. and Nurse, P. (2000). DNA replication and dam age checkpoints and
meiotc cell cycle controls in the fission and budding yeasts. Biochem, J. 349,1-12.
M urakam i, H. and Okayama, H. (1995). A kinase from fission yeast responsible for
blocking mitosis in S phase. Nature. 374, 817-819.
M urray, A. and H unt, T. (1993). The Cell Cycle, an introduction. Freeman and
Com pany .
M urray, A. W. (1992). Creative blocks: cell-cycle checkpoints and feedback control.
Nature. 359, 599-604.
M urray, A. W., Solom on, M. J. and K irschner, M. W. (1989). The role of cyclin
synthesis and degradation in the control of m aturation prom oting factor activity.
Nature. 339, 280-286.
M u sah l, C., Schulte, D., B urkhart, R. and K n ip p ers, R. (1995). A hum an
hom ologue of the yeast replication protein cdc21: interactions w ith other Mem
proteins. Eur. J. Biochem. 230,1096-1101.
Muzi-Falconi, M., Brown, G. W. and Kelly, T. J. (1996). cdclS'^ regulates initiation
of DNA replication in Schizosaccharomyces pombe. Proc. Natl. Acad. Sci. USA. 93,
1566-1570.
M uzi-Falconi, M. and Kelly, T. J. (1995). O rp l, a m em ber of the C dcl8/C dc6
fam ily of S-phase regulators, is hom ologous to a com ponent of the origin
recognition complex. Proc. Natl. Acad. Sci. USA. 92,12475-12479.
N akashim a, N., Tanaka, K., Sturm, S. and Okayam a, H. (1995). Fission yeast Rep2
is a putative transcriptional activator subunit for the cell cycle 'start' function of
Res2-Cdcl0. EMBO J. 14,4794-4802.
205
N guyen, V. Q., Co, C., Irie, K. and Li, J. J. (2000). C lb/C dc28 kinases prom ote
nuclear export of the replication initiator proteins Mcm2-7. Curr. Biol 10,195-205.
N ielsen, O. and Davey, J. (1995). Pheromone comm unication in the fission yeast
Schizosaccharomyces pombe. Semin, Cell Biol 6, 95-104.
N ishitani, H., Lygerou, Z., N ishim oto, T. and Nurse, P. (2000). The C d tl protein is
required to license DNA for replication in fission yeast. Nature. 404, 625-628.
N ishitani, H. and N urse, P. (1995). p65^^^^^ plays a major role controlling the
initiation of DNA replication in fission yeast. Cell. S3,397-405.
N orbury, C. J. and N urse, P. (1992). Animal cell cycles and their control. A n n u .
Rev. Biochem. 61,441-470.
N ougarede, R., D ella Seta, P., Zarzov, P. and Schwob, E. (2000). H ierarchy of Sphase prom oting factors: Yeast Dbf4-Cdc7 kinase requires prior cyclin-dependent
kinase activation. M o l Cell. Biol. 20, 3795-3806.
Nurse, P. and Bissett, Y. (1981). Gene required in Cl for com m itm ent to cell cycle
and in G2 for control of mitosis in fission yeast. Nature. 292, 558-560.
Nurse, P., Thuriaux, P. and Nasm yth, K. (1976). Genetic control of the cell division
cycle in the fission yeast Schizosaccharomyces pombe. Mol. Gen. Genet. 146,167178.
O 'C onnell, M. J., Raleigh, J. M., V erkade, H. M. and N urse, P. (1997). C hkl is a
w e e l kinase in the G2 DNA dam age checkpoint inhibiting cdc2 by Y15
phosphorylation. EMBO ]. 16, 545-554.
O bara-Ishihara, T. and Okayam a, H. (1994). A B-type cyclin negatively regulates
conjugation via interacting w ith cell cycle 'start' genes in fission yeast. EMBO J. 13,
1863-1872.
206
Ogawa, Y., T akahashi, T. and M asukata, H. (1999). Association of fission yeast
O rp l and Mcm6 proteins w ith chromosomal replication origins. Mol. Cell Biol. 19,
7228-7236.
O htani, K., Tsujim oto, A., Ikeda, M. and N akam ura, M. (1998). Regulation of cell
g ro w th -d ep en d en t expression of m am m alian CDC6 gene by the cell cycle
transcription factor E2F. Oncogene. 17,1777-1785.
O kazaki, K., O kazaki, N., Kum e, K., Jinno, S., T anaka, K. and O kayam a, H.
(1990). High-frequency transform ation m ethod and library transducing vectors for
cloning m am m alian cDNAs by trans-com plem entation of Schizosaccharomyces
pombe. Nucl. Acids Res. 18,6485-6489.
O kishio, N., Adachi, Y. and Yanagida, M. (1996). Fission yeast N d a l and Nda4,
MCM hom logs required for DNA replication, are constitutive nuclear proteins. /.
Cell Sci. 109, 319-326.
O tzen Petersen, B., Lukas, J., Storgaard Sorensen, C., Bartek, J. and H elin, K.
(1999). Phosphorylation of m am m alian CDC6 by Cyclin A / CDK2 regulates its
subcellular localization. EMBO J. 18, 396-410.
Owens, J. C., Detw eiler, C. S. and Li, J. J. (1997). CDC45 is required in conjunction
w ith CDC7fDBF4 to trigger the initiation of DNA replication. Proc. Natl. Acad. Sci.
USA. 94,12521-12526.
Parker, L. L., Atherton-Fessler, S. and Piwnica-W orm s, H. (1992). plQ7^^^^ is a
dual-specificity kinase that phosphorylates p34^^^^ on tyrosine 15. Proc. Natl. Acad.
Sci. USA. 89, 2917-2921.
Parker, L. L., W alter, S. A., Young, P. G. and Piw nica-W orm s, H. (1993).
Phosphorylation and inactivation of the mitotic inhibitor W eel by the n im l/cd rl
kinase. Nature. 363, 736-738.
207
Pasion, S. G. and Forsburg, S. L. (1999). Nuclear localization of Schizosaccharomyces
pombe M cm 2p/C dcl9p requires MCM complex assembly. Mol. Biol Cell. 10, 4043-
4057.
Perkins, G. and Diffley, J. F. (1998). Nucleotide-dependent prereplicative complex
assembly by Cdc6p, a homolog of eukaryotic and prokaryotic clamp-loaders. Mol.
Cell. 2, 23-32.
Piatti, S., Lengauer, C. and N asm yth, K. (1995). Cdc6 is an unstable protein whose
de novo synthesis in G1 is im portant for the onset of S phase and for preventing a
'reductional' anaphase in the budding yeast Saccharomyces cerevisiae. EMBO J. 14,
3788-3799.
Planas-Silva, M. D. and W einberg, R. A. (1997). The restriction point and control
of cell proliferation. Curr. Opin. Cell Biol. 9, 768-772.
Prentice, H. (1992). High efficiency transformation of Schizosaccharomyces pombe.
Nucl. Acids Res. 20, 621.
Q uintana, D. G. and Dutta, A. (1999). The m etazoan origin recognition complex.
Front. Biosci. 4, 805-815.
R aleigh, J. M. and O ’C onnell, M. J. (2000). The G2 DNA dam age checkpoint
targets both W eel and Cdc25. J. Cell Sci. 113,1727-1736.
R hind, N., Fum ari, B. and R ussell, P. (1997). Cdc2 tyrosine phosphorylation is
required for the DNA damage checkpoint in fission yeast. Genes Dev. 11, 504-511.
R hind, N. and Russell, P. (1998). Tyrosine phosphorylation of cdc2 is required for
the replication checkpoint in Schizosaccharomyces pombe. Mol. Cell. Biol. 18, 37823787.
208
R o b b in s, J., D ilw o r th , S. M ., L a sk ey , R. A . and D in g w a ll, C. (1991). 2
in terd ep en dent basic dom ains in nucleoplasm in nuclear targeting sequenceidentification of a class of bipartite nuclear targeting sequence. Cell 64, 615-623.
R oss, K. E., K ald is, P. and S olom on , M . J. (2000). Activating phosphorylation of
the Saccharomyces cerevisiae cyclin-dependent kinase, Cdc28p, precedes cyclin
binding. M o l Biol Cell 11,1597-1609.
R o w le y ,
R .,
S u b r a m i,
S ., Y o u n g ,
P.
(1992).
C h eck p o in t co n tro ls in
Schizosaccharomyces pombe: rad l. EMBO J. 1 1 , 1335-1342.
R u ssell, P. and N u rse, P. (1986). cdc25+ functions as an inducer in the mitotic
control of fission yeast. Cell 45,145-153.
R u sse ll, P. and N u rse, P. (1987a). The m itotic inducer n im l+ functions in a
regulatory netw ork of protein kinase homologs controlling the initiation of mitosis.
Cell 49, 569-576.
R u ssell, P. and N urse, P. (1987b). Negative regulation of mitosis by w eel+ a gene
encoding a protein kinase homolog. Cell 49, 559-567.
Saha, P., C hen, J., T hom e, K. C., L aw lis, S. J., H ou, Z., H endricks, M ., Parvin, J.
D . and D u tta, A. (1998). H um an C D C 6 /C d cl8 associates w ith O rel and
C yclin/cdk and is selectively eliminated from the nucleus at the onset of S phase.
M o l Cell Biol 18, 2758-2767.
Saka, Y., Fantes, P., Sutani, T., M cln em y , C., Creanor, J. and Yanagida, M . (1994).
Fission yeast cut5 links nuclear chrom atin and M phase regulation in the
replication checkpoint control. EMBO ]. 13, 5319-5329.
Saka, Y. and Yanagida, M . (1993). Fission yeast cutS'^, required for S phase onset
and M phase restraint, is identical to the radiation-dam age repair gene rad4'^. Cell
74, 383-393.
209
Sam brook, J., Fritsch, E. and M aniatis, T. (1989). Molecular cloning: a laboratory
manual. Second edition. Cold Spring Harbor Laboratory Press .
Sam ejim a, I. and Y anagida, M . (1994). Bypassing anaphase by fission yeast cut9
mutation: requirem ent of cut9+ to initiate anaphase. /. Cell Biol. 127,1655-1670.
San ch ez, M ., C alzada, A. and B ueno, A. (1999). Functionally hom ologous DNA
replication genes in fission and budding yeast. /. Cell Sci. 112, 2381-2390.
S a n ch ez-D ia z, A., G o n za lez, I., A rellan o, M . and M oreno, S. (1998). The Cdk
inhibitors p25^^^^ and p40^^^^ are functional homologues that play similar roles
in the regulation of the cell cycle in fission and budding yeast. /. Cell Sci. I l l , 843851.
Sanders W illia m s, R., S h ohet, R. V. and Stillm an , B. (1997). A hum an protein
related to yeast Cdc6p. Proc. Natl. Acad. Sci. USA. 94,142-147.
Sanger, P., N ic k le n , S. and C o u lso n , A. (1977). DNA sequencing w ith chain
term inating inhibitors. Proc. Natl. Acad. Sci. USA. 74, 5463-5469.
S an tocan ale, C. and D iffle y , J. F. X. (1998). A M e d - and R ad53-dependent
checkpoint controls late-firing origins of DNA replication. Nature. 395, 615-617.
Savitsky, K., Bar-Shira, A., G ilad, S., Rotm an, G., Z iv, Y., V anagaite, L., T agle, D .
A., Sm ith, S., U z iel, T., S fez, S. et al. (1995). A single Ataxia Telangiectasia gene
with a produce similar to PI3-kinase. Science. 268,1749-1753.
Sazer, S. and S h erw ood , S. W. (1990). M itochondrial grow th and DNA synthesis
occur in the absence of nuclear DNA replication in fission yeast. }. Cell Sci. 97, 509516.
S ch w ob , E., B ohm , T., M en d en h a ll, M . D . and N asm yth , K. (1994). The B-type
cyclin kinase inhibitor p40SICl controls the C l to S transition in S. cerevisiae
[published erratum appears in Cell 1996; 84 (l):following 174]. Cell 79, 233-244.
210
Sherm an, D. A. and Forsburg, S. L. (1998). Schizosaccharomyces pombe McmSp, an
essential nuclear protein, associates tightly w ith Nda4p (Mcm5p). N u cl Acids Res.
26, 3955-3960.
Sherm an, D. A., Pasion, S. G. and Forsburg, S. L. (1998). M ultiple Domains of
Fission Yeast C dcl9p (MCM2) Are Required for Its Association w ith the Core
MCM Complex. M o l Biol Cell 9,1833-1845.
Sherr, C. J. (1996). Cancer Cell Cycles. Science. 274,1672-1677.
Shim ada, M., O kuzaki, D., Tanaka, S., Tougan, T., Tam ai, K. K., Simoda, C. and
N ojim a, H. (1999). Replication Factor C3 of Schizosaccharomyces pombe, a small
subunit of Replication Factor C complex, plays a role in both replication and
damage checkpoints. Mol. Biol. Cell. 10, 3991-4003.
Shim om ura, T., Ando, S., M atsum oto, K. and Sugim oto, K. (1998). Functional and
physical interaction betw een Rad24 and Rfc5 in the yeast checkpoint pathw ays.
M o l Cell Biol 18, 5485-5491.
Sim anis, V. and Nurse, P. (1986). The cell cycle control gene cdc2+ of fission yeast
encodes a protein kinase potentially regulated by phosphorylation. Cell. 45, 261268.
Sinha, P., Chang, V. and Tye, B. (1986). A m u tan t that affects the function of
autonom ously replicating sequences in yeast. J. Mol. Biol. 192, 805-814.
Skowyra, D., Craig, K. L., Tyers, M., Elledge, S. J. and H arper, J. W. (1997). F-box
proteins are receptors that recruit phosphorylated substrates to the SCF ubiquitinligase complex. Cell 91,209-219.
Spradling, A. (1993). Developmental genetics of oogenesis. In Drosophila genetics,
(ed. 1-70. CSH, NY.: Cold Spring Harbor Press.
211
S tem , B. and N urse, P. (1996). A quantitative model for the cdc2 control of S phase
and mitosis in fission yeast. Trends Genet. 12, 345-350.
Stoeber, K., M ills, A. D ., K ubota, Y., Krude, T., R o m a n o w sk i, P., M arheinke, K.,
L askey, R. A. and W illiam s, G. H. (1998). Cdc6 protein causes prem ature entry
into S phase in a mammalian cell-free system. EMBO }. 17, 7219-7229.
Story, R. M . and Steitz, T. A. (1992). Structure of the recA protein-ADP complex.
Nature. 355, 374-376.
S trau sfeld , U., Labbé, J. C., F esquet, D ., C avadore, J. C., Picard, A., Sadhu, K.,
R u s se ll, P. and D o rée, M . (1991). D ephophorylation and activation of a
p34cdc2/cyclin B complex in vitro by hum an CDC25 protein. Nature. 351,242-245.
T a k a h a s h i,
K ., Y am ada,
H.
an d
Y a n a g id a ,
M . (1994). Fission
yeast
m inichrom osom e loss m utants mis cause lethal aneu p lo id y and replication
abnormality. Mol. Biol. Cell 5,1145-1158.
T akeda, T., O gin o, K., M atsui, E., Cho, M. K., K um agai, H., M iyake, T., Arai, K.
and M asai, H. (1999). A fission yeast gene, him l'^/dfpl'^, encoding a regulatory
subunit for H skl kinase, plays essential roles in S-phase initiation as well as in Sphase checkpoint control and recovery from DNA damage. Mol. Cell. Biol. 19, 55355547.
T akei, Y., Yam am oto, K. and T sujim oto, G. (1999). Identification of the sequence
responsible for the nuclear localization of hum an Cdc6. FEBS Lett. 447, 292-296.
T anaka, K., O kazaki, K., O kazaki, N ., U eda, T., S u giyam a, A., N ojim a, H. and
O k ayam a, H . (1992). A new
cdc gene re q u ire d for S p h ase en try of
Schizosaccharomyces pom be encodes a protein sim ilar to the cdc 10+ and SWI4
gene products. EMBO J. 11,4923-4932.
Tanaka, T., K napp, D . and N asm yth, K. (1997). Loading of an Mem protein onto
DNA replication origins is regulated by Cdc6p and CDKs. Cell. 90, 649-660.
212
Tang, C. S. L., Bueno, A. and Russell, P. (1994). M /2+ encodes a 6-cysteine zinc
finger-containing transcription factor that regulates the n m tl prom oter in fission
yeast. /. Biol Chem. 269,11921-11926.
T hom m es, P., K ubota, Y., T akisaw a, H. and Blow, J. J. (1997). The RLF-M
com ponent of the replication licensing system forms complexes containing all six
M C M /P l polypeptides. EMBO /. 16,3312-3319.
Tye, B. (1999). MCM proteins in DNA replication. Annu. Rev. Biochem. 68, 649-686.
Verma, R., Annan, R. S., H uddleton, M. J., Carr, S. A., Reynard, G. and Deshaies,
R. J. (1997a). Phosphorylation of Siclp by G1 Cdk required for its degradation and
entry into S phase. Science. 278,455-459.
Verma, R., Feldm an, R. M. and D eshaies, R. J. (1997b). SICl is ubiquitinated in
vitro by a pathw ay that requires CDC4, CDC34, and cyclin/CD K activities. M o l
Biol Cell 8,1427-1437.
Volkm er, E. and K arnitz, L. M. (1999). H um an hom ologs of Schizosaccharomyces
pombe R adl, H u sl, and Rad9 form a DNA dam age-responsive protein complex. J.
Biol. Chem. 274, 567-570.
W alker, J. E., Saraste, M., Runsw ick, M. J. and Gay, N. J. (1982). Distantly related
sequences in the a- and b-subunits of ATP synthase, myosin, kinases and other
ATP-requiring enzymes and a common nucleotide binding fold. EMBO J. 1, 945951.
W alter, J. and N ew port, J. (2000). Initiation of eukaryotic DNA replication: origin
u n w inding and sequential chrom atin association of Cdc45, RPA, and DNA
Polymerase a. Mol. Cell. 5, 617-627.
W alworth, N., Davey, S. and Beach, D. (1993). Fission yeast chkl protein kinase
links the rad checkpoint pathw ay to cdc2. Nature. 363, 368-371.
213
W alw orth, N . C. and B ernards, R. (1996). rad-dependent response of the chkl-
encoded protein kinase at the DNA damage checkpoint. Science. 2 7 1 , 353-356.
W ang, B., Feng, L., H u, Y., H e H uang, S., R eyn old s, C. P., W u, L. and Jong, A. Y.
(1999). The essential role of Saccharomyces cerevisiae CDC6 nucleotide-binding site
in cell growth, DNA synthesis and O rel association. J. Biol Chem. 274, 8291-8298.
Warren, G. and W ickner, W. (1996). Organelle inheritance. Cell 8 4 , 395-400.
W einreich, M ., Liang, C. and S tillm an , B. (1999). The Cdc6p nucleotide-binding
motif is required for loading mcm proteins onto chromatin. Proc. N a tl Acad. Sci
USA. 9 6 , 441-446.
W einreich , M . and S tillm an , B. (1999). Cdc7p-Dbf4p kinase binds to chromatin
during S phase and is regulated by both AFC and the RAD53 checkpoint pathway.
EMBO J. 18, 5334-5346.
W h iteh all, S., Stacey, P., D a w so n , K. and Jones, N . (1999). Cell cycle-regulated
transcription in fission yeast: cdcl0-res protein interactions during the cell cycle
and dom ains required for regulated transcription. Mol. Biol. Cell 10, 3705-3715.
W hittaker, A. J., R oyzm an, I. and Orr-W eaver, T. L. (2000). Drosophila Double
parked: a conserved, essential replication protein that colocalizes w ith the origin
recognition complex and links DNA replication w ith m itosis and the downregulation of S phase transcripts. Genes Dev. 14,1765-1776.
W ilk in so n , C. R. M ., W allace, M ., M orphew , M ., Perry, P., A llsh ire, R., Javersat,
J., M cIn tosh , J. R. and G ordon, C. (1998). Localization of the 26S proteasom e
during mitosis and meiosis in fission yeast. EMBO J. 17, 6465-6476.
W iney, M ., Baum , P., G oetsch, L. and Byers, B. (1991). Genetic determ inants of
spindle pole body duplication in yeast. Cold Spring Harbor Symp. Quant. Biol. 56,
705-708.
214
Wolf, D. A., McKeon, F. and Jackson, P. K. (1999a). Budding yeast Cdc6p induces
re-replication in fission yeast by inhibition of SCF pop-m ediated proteolysis. Mol.
Gen. Genet. 262,473-480.
W olf, D. A., M cKeon, F. and Jackson, P. K. (1999b). F-box/W D -repeat proteins
Pop Ip and S u d lp /P o p 2 p form complexes that bind and direct the proteolysis of
CdclSp. Curr. Biol. 9,373-376.
Wolf, D. A., Wu, D. and McKeon, F. (1996). Disruption of re-replication control by
overexpression of H um an O RCl in Fission Yeast. J. Biol. Chem. 271,32503-32506.
Wu, L. and Russell, P. (1993). N im l kinase prom otes mitosis by inactivating W eel
tyrosine kinase. Nature. 363, 738-741.
Wu, L. and Russell, P. (1997). N ifl, a novel mitotic inhibitor in Schizosaccharomyces
pombe. EMBO J. 16,1342-1350.
Yamada, H., K um ada, K. and Yanagida, M. (1997). Distinct functions and cell
cycle regulated phosphorylation of 20S APC/cyclosom e required for anaphase in
fission yeast. J. Cell Sci. 110,1793-1804.
Yam aguchi, S., M urakam i, H. and Okayam a, H. (1997). A WD Repeat Protein
Controls the Cell Cycle and Differentiation by N egatively Regulating Cdc2/BType Cyclin Complexes. Mol. Biol. Cell. 8, 2475-2486.
Yam am oto, M., Im ai, Y. and W atanabe, Y. (1997). M ating and Sporulation in
Schizosaccharomyces pombe. In The Molecular and Cellular Biology of the Yeast
Saccharomyces: Life Cycle and Cell Biology, (ed. J. R. Pringle, J. R. Broach and E. W.
Jones), pp. 1035-1106. CSH, NY.: Cold Spring Harbor Press.
Yamano, H., G annon, J. and H unt, T. (1996). The role of proteolysis in cell-cycle
progression in Schizosaccharomyces pombe. EMBO J. 15, 5268-5279.
215
Y am ash ita, Y. M ., N a k a sek o , Y., S a m ejim a , I., K um ada, K., Y am ada, H.,
M ich aelson , D . and Y anagida, M. (1996). 20S cyclosome complex form ation and
proteolytic activity inhibited by the cAM P/PKA pathw ay. Nature. 384, 276-279.
Yam ashita, Y. M ., Y ukinobu, Y., N akagaw a, T. and Y anagida, M . (1999). Fission
yeast A PC /cyclosom e subunits, C ut20/A pc4 and C ut23/A pc8, in regulating
metaphase-anaphase progression and cellular responses. Genes Cells. 4,445-463.
Yan, H ., M erchant, A. M . and T y e, B. (1993). Cell cycle-regulated nuclear
localization of MCM2 and MCM3, which are required for the initiation of DNA
synthesis at chromosomal replication origins in yeast. Genes Dev. 7,2149-2160.
Yan, Z., D eG regori, J., S h oh et, R., L eone, G., S tillm a n , B., N e v in s, J. R. and
Sanders W illiam s, R. (1998). Cdc6 is regulated by E2F and is essential for DNA
replication in m ammalian cells. Proc. Natl. Acad. Sci. USA. 96,3603-3608.
Yanagida, M. (2000). Cell cycle mechanisms of sister chrom atid separation; roles of
c u tl/se p a rin and cut2/securin. Genes Cells. 5,1-8.
You, Z., Kom am ura, Y. and Ish im i, Y. (1999). Biochemical analysis of the intrinsic
Mcm4-Mcm6-Mcm7 DNA helicase activity. Mol. Cell. Biol. 19, 8003-8015.
Y oung, P. G. and Fantes, P. A. (1987). Schizosaccharomyces pombe m utants
affected in their division response to starvation. ]. Cell Sci. 88, 295-304
Z eng, Y., Forbes, K. C., W u, Z., M oreno, S., P iw nica-W orm s, H. and Enoch, T.
(1998). Replication checkpoint requires phosphorylation of the phosphatase Cdc25
by C dsl or C hkl. Nature. 395, 507-510.
Z en g , Y. and P iw n ica -W o rm s, H. (1999). DN A D am age an d R eplication
checkpoints in fission yeast require nuclear exclusion of the cdc25 phosphatase via
14-3-3 binding. Mol. Cell. Biol. 19, 7410-7419.
216
Zhou, C., H uang, S. H. and Jong, A. (1989). Molecular cloning of Saccharomyces
cerevisiae CDC6 gene: isolation, identification and sequence analysis. /. Biol Chem.
264, 9022-9029.
Zhou, C. and Jong, A. (1990). CDC6 mRNA fluctuates periodically in the yeast cell
cycle. /. Biol Chem. 265,19904-19909.
Z hu, J., Carlson, D. L., D ubey, D. D., Sharm a, K. and H uberm an, J. A. (1994a).
C om parison of the two major ARS elements of the ura4 replication origin region
w ith o th er ARS elem ents in the fission yeast, Schizosaccharomyces pombe.
Chromosoma. 103, 414-422.
Z hu, Y., Takeda, T., N asm yth, K. and Jones, N. (1994b). pctl+ , which encodes a
new DNA-binding partner of p85cdcl0, is required for meiosis in the fission yeast
Schizosaccharomyces pombe. Genes Dev. 8, 885-898.
Zou, L., M itchell, J. and Stillm an, B. (1997). CD C45, a novel yeast gene that
functions w ith the origin recognition complex and Mcm proteins in initiation of
DNA replication. M o l Cell Biol. 17, 553-563.
Zou, L. and Stillm an, B. (1998). Formation of a Preinitiation Complex by S-phase
Cyclin CDK-Dependent Loading of Cdc45p onto Chromatin. Science. 280, 593-596.
Zou, L. and Stillm an, B. (2000). Assem bly of a complex containing Cdc45p,
Replication Protein A, and Mcm2p at replication origins controlled by S-phase
Cyclin-Dependent Kinases and Cdc7p-Dbf4p Kinase. Mol. Cell. Biol. 20, 3086-3096.
Z w erschke, W., R ottjakob, H. W. and K untzel, H. (1994). The Saccharomyces
cerevisiae CDC6 gene is transcribed at late m itosis and encodes a ATP/GTPase
controlling S phase initiation. J. Biol Chem. 269, 23351-23356.
217