Bio 901 Gene Expression Activity Given the following DNA sequences, determine the final amino acid sequences. Use the codon table given to you in your PowerPoint notes. Answers are upside down below to minimize the temptation to look before you try. :-) 1) TCCTCAGGCTACCGCCGCTAGGACATCGAC 2) 5’ – ACTTTCTCACAGCCATCGACTCGACATCG – 3’ 3) DNA helix 3’ – GCTACGGGGCTAGCCCTAGCATT – 5’ 5’ – CGATGCCCCGATCGGGATCGTAA – 3’ Template Strand Coding Strand MET-SER-SER-ARG-TRP-LEU