Developmental Biology 435 (2018) 138–149
Contents lists available at ScienceDirect
Developmental Biology
journal homepage: www.elsevier.com/locate/developmentalbiology
Identification of neural transcription factors required for the differentiation
of three neuronal subtypes in the sea urchin embryo
Leslie A. Slota, David R. McClay
MARK
⁎
Department of Biology, Duke University, Durham, NC 27708, United States
A R T I C L E I N F O
A BS T RAC T
Keywords:
Neurogenesis
Sea urchin
Achaete-Scute
Neurogenin
Orthopedia
Neural progenitor
Correct patterning of the nervous system is essential for an organism's survival and complex behavior.
Embryologists have used the sea urchin as a model for decades, but our understanding of sea urchin nervous
system patterning is incomplete. Previous histochemical studies identified multiple neurotransmitters in the
pluteus larvae of several sea urchin species. However, little is known about how, where and when neural
subtypes are differentially specified during development. Here, we examine the molecular mechanisms of
neuronal subtype specification in 3 distinct neural subtypes in the Lytechinus variegatus larva. We show that
these subtypes are specified through Delta/Notch signaling and identify a different transcription factor required
for the development of each neural subtype. Our results show achaete-scute and neurogenin are proneural for
the serotonergic neurons of the apical organ and cholinergic neurons of the ciliary band, respectively. We also
show that orthopedia is not proneural but is necessary for the differentiation of the cholinergic/catecholaminergic postoral neurons. Interestingly, these transcription factors are used similarly during vertebrate
neurogenesis. We believe this study is a starting point for building a neural gene regulatory network in the
sea urchin and for finding conserved deuterostome neurogenic mechanisms.
1. Introduction
Numerous transcription factors and signaling pathways regulate
neurogenesis, and changes in neurogenic gene regulatory networks
underlie the diversity in patterning of nervous systems. At the same
time, there are examples of common signaling pathways and shared
gene families that are essential for the specification and differentiation
of neurons throughout metazoans (Marlow et al., 2014; Sinigaglia
et al., 2013; Wei et al., 2009). When considering the evolution of the
nervous system, there are many questions left unanswered such as
which regulatory networks, signaling pathways and developmental
mechanisms were part of the “toolkit” of the bilaterian ancestor
(Hartenstein and Stollewerk, 2015). A thorough understanding of the
mechanisms that drive neural development in diverse taxa can enable
us to reconstruct the ancestral bilaterian nervous system and infer how
nervous systems evolved (Hartenstein and Stollewerk, 2015).
In bilaterians, the acquisition of a neural fate involves several steps.
The first is early expression of proneural transcription factors in the
ectoderm to select neural progenitors from the rest of the ectoderm
(Huang et al., 2014). In this initial specification process, some cells in
the ectoderm begin to express a proneural transcription factor at a
higher level relative to surrounding cells which triggers increased
⁎
expression of the Notch ligand Delta (Bertrand et al., 2002; Huang
et al., 2014). This elevated expression of Delta in the presumptive
neural progenitors initiates Notch-mediated lateral inhibition, which
causes a salt-and-pepper pattern of neuroblasts within the ectoderm
(Artavanis-Tsakonas et al., 1999; Castro et al., 2006; Kageyama et al.,
2009). Downstream of Delta expression, neural transcription factors
direct progenitors toward a neuronal fate, and control differentiation of
precursors into specific neuronal subtypes (Bertrand et al., 2002;
Simionato et al., 2008; Huang et al., 2014).
To understand how these pathways come together during development
it has been of value to explore organisms that are relatively simple. As such,
the sea urchin embryo, with relatively few neurons to consider, provides a
unique opportunity to study regulatory networks that drive neurogenesis in
a basal deuterostome. The sea urchin nervous system is made up of the
apical organ, which is a neuroepithelium located at the anterior end of the
embryo and the ciliary band, an ectodermal region made up of neurons and
ciliated cells positioned between the oral and aboral ectoderm. It is believed
that the apical organ acts as a central nervous system, since it expresses a
set of genes that are similar to those expressed in the developing vertebrate
forebrain (Range, 2014; Wei et al., 2009) and because axonal tracts lead
from the ciliary band to the apical organ (Burke et al., 2014). The ciliary
band is the functioning peripheral nervous system in the sea urchin embryo
Correspondence to: Department of Biology, Duke University, 124 Science Dr. Box 90338, Durham, NC 27708, United States.
E-mail address: dmcclay@duke.edu (D.R. McClay).
https://doi.org/10.1016/j.ydbio.2017.12.015
Received 20 December 2017; Accepted 20 December 2017
Available online 10 January 2018
0012-1606/ © 2018 Elsevier Inc. All rights reserved.
Developmental Biology 435 (2018) 138–149
L.A. Slota, D.R. McClay
essential for the synthesis of catecholamines and acetylcholine, respectively (Fig. 1B, E). Expression of Lv-chat and Lv-th mRNA begins at
late gastrula stage at 18 hour post fertilization (hpf) in cells that make
up two symmetric patches in the oral ectoderm (Fig. S1A,E). As
development proceeds, Lv-chat and Lv-th mRNA expression expands
to a line of neurons in the postoral ectoderm (Fig. 1B, E, Fig. S1A-D’, EG). This neuronal subtype, identified previously by a pan neural
marker, has been referred to as the “postoral neurons” because of
their relative position in the sea urchin embryo (Burke et al., 2014). It
was shown previously that neurons near the base of the larval arms of
sea urchin embryos express TH (Adams et al., 2011), but at the time
the postoral neurons had not been defined and the fact that they also
synthesize acetylcholine was unknown. Double whole mount in situ
hybridizations confirm that expression of Lv-chat in the postoral
neurons coincides with expression of Lv-th, which shows that these
neurons are both cholinergic and catecholaminergic (Fig. 1E).
The third neuronal subtype in the L. variegatus embryo is found
throughout the ciliary band. Once differentiated, these neurons express
Lv-chat, which first appears in the ciliary band at about 39 hpf (Fig. 1C,
Fig. S1H-H’). By 48 hpf, additional Lv-chat expressing cells are added to
the ciliary band and are found in a more oral position in the ciliary band
relative to the serotonergic neurons. Cells of the fourth neuronal subtype
in the sea urchin embryo are found in the gut. Some of these neurons (2–
4 cells surrounding the mouth and anus) express Lv-th at pluteus stage
(Fig. S1C’-C’’). Neurons in the gut have been shown to be specified de
novo in the endoderm of sea urchin embryos and will not be the focus in
this paper (Wei et al., 2011). Taken together, we show that by 48 hours of
development, there are only 40–50 neurons present in the L. variegatus
larva. This small number of neurons is formed and patterned without
complicated tissue layer movements which can allow for a clear dissection
of the gene regulatory network inputs required for nervous system
patterning (Angerer et al., 2011; Burke et al., 2014, 2006).
and is thought to contain a variety of neurons which control the coordinated
beating of cilia (Mackie et al., 1969; Satterlie and Cameron, 1985;
Strathmann, 2007). Recent studies have shown that the early sea urchin
larval nervous system consists of about 40–50 neurons (Wei et al., 2015). It
has also been shown that all neural progenitors express the transcription
factors SoxB, SoxC and then Brn1/2/4 and that this particular order of
expression is required for the specification and differentiation of all neurons
(Garner et al., 2016). However, it is unclear how many subtypes of neurons
are present in the sea urchin embryo and how neural subtype identity is
determined. Also unknown is the extent to which Delta/Notch signaling
functions in L. variegatus neural development, which transcription factors
are proneural, and which transcription factors control differentiation of
neuron subtypes.
Here we provide an overview of the types of neurons present in the
L. variegatus larval nervous system based on the expression of several
enzymes required for neurotransmitter synthesis. Through differential
gene expression, we show that there are at least 4 subtypes of neurons
present by 48 hours of development. We then focus on the three
subtypes that are specified and differentiate in the ectoderm, and show
that all three are under the influence of Delta/Notch signaling. We
provide an example of a transcription factor that is expressed exclusively in a single neuronal subtype and show by perturbations that each
transcription factor is required for the proper specification or differentiation of only that subtype. These data suggest that Lv-achaetescute (Lv-ac/sc) is proneural and is required for the specification of
serotonergic neurons in the apical organ. Lv-neurogenin (Lv-ngn) is
also a proneural transcription factor, being required for the specification of the ciliary band neurons. Lv-orthopedia (Lv-otp) is expressed in
the postoral neurons, which we show are both cholinergic and
catecholaminergic. Perturbations of Lv-otp show that orthopedia is
required for the differentiation of the postoral neurons. Interestingly,
these transcription factors function in a similar manner during
vertebrate neural patterning, which suggests that there are conserved
modes of neurogenesis between sea urchins and chordates. This study
can be used as a starting point to expand the sea urchin developmental
gene regulatory network (GRN) to include neurogenesis and the
specification of different populations of neurons.
2.2. All three neural subtypes are subject to Delta/Notch signaling
A conserved aspect of neurogenesis in metazoans, the Notch signaling
pathway controls when and where in the neuroectoderm neurons arise
(Hartenstein and Stollewerk, 2015). Expression of the Notch ligand delta in
L. variegatus is initially restricted to endomesoderm until about 12 hpf
when it begins to be expressed in neural progenitors in the oral ectoderm
(Fig. 2B). By 14 hpf, delta is expressed in neural progenitors in the apical
organ as well (Fig. 2C). As development proceeds, additional cells in the
oral ectoderm express delta (Fig. 2D-H).
Treatment with the γ-secretase inhibitor DAPT (N- [N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester) to inhibit Notch
signaling or inhibition of Delta using a morpholino (MO) results in an
increase in the number of neurons and the neural progenitors in
related echinoderm species (Wei et al., 2011; Yaguchi et al., 2012;
Yankura et al., 2013; Mellott et al., 2017). However, it is unclear
whether Delta/Notch signaling effects all neural subtypes in the sea
urchin embryo and the effect of Notch signaling on neurogenesis has
not been shown in L. variegatus. We therefore used a Delta morpholino (MO) to specifically inhibit translation of the Notch-ligand and
assessed the effect on individual neuron subtypes in the larval nervous
system. Injection of Delta MO results in an increase in the number of
neurons for all three subtypes (serotonergic, postoral, and ciliary band
neurons) compared to controls (Fig. 2I-P). We conclude that DeltaNotch signaling is used by all three neural subtypes as a lineage
restriction mechanism in L. variegatus.
2. Results
2.1. Overview of embryonic L. variegatus neuronal fates
The sea urchin larval nervous system is composed of two ectodermal territories: the neuroepithelial apical organ which functions as a
central nervous system and peripheral neurons that differentiate in and
near the ciliary band (Fig. 1D) (Garner et al., 2016). Previous studies
using histochemical and immunological techniques showed expression
of several neurotransmitters in cells and axonal tracts of the ciliary
band of late stage plutei of other sea urchin species (Bisgrove and
Burke, 1987; Katow et al., 2016; Sutherby et al., 2012). Those studies
did not attempt to examine the molecular mechanisms that led to the
diversification of neurons. Before determining how correct patterning
of the nervous system is achieved, we first defined different subpopulations of neurons present in the embryonic nervous system of
L. variegatus. We did this by examining the spatial expression of
several enzymes essential for the synthesis of neurotransmitters which
we use as markers for fully differentiated neurons. Our analysis
demonstrates that there are at least four subtypes of neurons present
in the L. variegatus larval nervous system (Fig. 1, Fig. S1). One subtype
is the previously identified serotonergic neurons in the apical organ
which express tryptophan 5-hydroxylase (Lv-tph), an enzyme required
for serotonin synthesis (Yaguchi and Katow, 2003). Lv-tph mRNA
expression begins at late gastrula stage and persists through development in 2–4 bilaterally symmetric serotonergic neurons in the
apical organ (Fig. 1A). A second neuronal subtype expresses tyrosine
hydroxylase (Lv-th) and choline acetytransferase (Lv-chat), enzymes
2.3. Lv-achaete-scute is proneural for serotonergic neurons in the
apical organ
In the neuroectoderm of animal embryos, expression of proneural
transcription factors is required to select neural progenitors from the
rest of the ectoderm. To determine how the three identified neuronal
139
Developmental Biology 435 (2018) 138–149
L.A. Slota, D.R. McClay
Fig. 1. Overview of the L. variegatus larval nervous system. (A-C) Fluorescent whole mount in situ hybridization shows 3 different neural subtypes: serotonergic neurons express Lv-tph
(A), postoral neurons express Lv-chat (B) and ciliary band neurons also express Lv-chat (C). (D) Schematic showing overview of neurons present in the ectoderm of 48 hour pluteus
larvae of L. variegatus. (E) Double fluorescent in situ hybridization shows co-expression of Lv-chat with Lv-th in the postoral neurons in the maximum intensity Z projection. Area in
square shown in panels as composite or single channel of a single confocal section. (F) Double fluorescent in situ (maximum intensity Z projection) shows the serotonergic neurons and
the ciliary band cholinergic neurons are different cell types and do not co-express Lv-chat and Lv-tph. Area in rectangle shown in panels as composite or single channel of maximum
intensity projection. Nuclei (blue) in fluorescent images stained with Hoechst. hr- hour post fertilization, PL-Pluteus, Oral-oral view, Aboral- aboral view. Scale bars: 50 µm.
in a rescue of the serotonergic neurons, confirming the specificity of the
morpholino (Fig. S3). In situ hybridization with probes for the other
neuronal subtypes (in the rest of the ciliary band and the postoral
neurons) showed that these neuronal subtypes are unaffected by Lvachaete-scute knockdowns (Fig. S4). This suggests that in the sea
urchin, achaete-scute is a proneural gene that is necessary for the
specification of only the serotonergic neurons in the apical organ.
To test whether ectopic expression of Lv-achaete-scute is sufficient
to specify additional ectopic serotonergic neurons, we injected single
cell zygotes with full length capped Lv-achaete-scute RNA. Embryos
injected with 50 ng/ul of RNA exhibited an increase in the number of
serotonergic neurons in the apical organ when fixed at 27 hpf (Fig. 4EF) and 48 hpf (Fig. S5). This increase in neuron number is specific only
to serotonergic neurons in the apical organ because embryos injected
with Lv-achaete-scute RNA do not show an increase in the number of
postoral neurons (Fig. S5D-G). This along with the knockdown
experimental data, shows that Lv-achaete-scute is necessary to drive
specification of the serotonergic neural subtype in the apical organ and
confirms that Lv-achaete-scute is proneural for the serotonergic
neurons. In the embryos injected with full length RNA, additional
serotonergic neurons were not randomly specified throughout the
ectoderm but were found in increased numbers only in the apical
organ. This suggests that cells must be competent to receive the
proneural cue from Lv-achaete-scute, again supporting the conclusion
that its proneural role is specific to the serotonergic neurons.
To confirm that the effects of knockdown and overexpression of Lvachaete-scute are likely cell autonomous in the serotonergic neurons,
we performed double whole mount in situ hybridization with delta and
subtypes are differentially specified in L. variegatus, we focused on
three transcription factors that were expressed in only one subtype of
neuron. To determine whether those transcription factors operate as
proneural specifiers or downstream in differentiation of a subtype of
neural precursors, we determined whether that transcription factor
acted upstream of Delta signaling.
We focused on an achaete-scute family ortholog in the sea urchin,
Lv-achaete-scute (Burke et al., 2006). In situ hybridizations over a time
course of developmental stages showed that Lv-achaete-scute is
expressed beginning at mesenchyme blastula stage (14 hpf) in 1–2
cells in the developing apical organ (Fig. 3A). This is the same time
point at which delta begins to be expressed in neural progenitors of the
apical organ (Fig. 2C). Lv-achaete-scute expression remains in the
apical organ through pluteus stage (Fig. 3A-D).
In order to examine whether a transcription factor is proneural,
knockdowns must result in a loss of delta expression (Huang et al.,
2014). To determine if Lv-achaete-scute is proneural, we used a
translation blocking morpholino antisense oligonucleotide (MO) designed to target the translation start site and looked for expression of
delta by whole mount in situ hybridization. We found that Lv-achaetescute knockdown embryos retain expression of delta in the ventral
ectoderm, but lose expression of delta in the apical organ domain
(Fig. 4A-B’). This suggests that Lv-achaete-scute is upstream of delta
expression in the apical organ and therefore is proneural in that
location. Confirming a role in the serotonergic neurons, we find that
embryos injected with achaete-scute MO lose Lv-tph mRNA expression
in the apical organ (Fig. 4C-D). Co-injection of full length Lv-achaetescute RNA coding sequence with Lv-achaete-scute morpholino resulted
140
Developmental Biology 435 (2018) 138–149
L.A. Slota, D.R. McClay
Fig. 2. Delta-notch signaling regulates the correct number and location of neurons (A-H) Whole mount in situ hybridization of delta expression. (A) At 10 hpf (hour post fertilization),
delta expression is strictly endomesodermal. (B) At 12 hpf, cells in the oral ectoderm begin to express delta. (C) By 14 hpf expression extends to the apical organ. Delta-expressing cells
are continually added to the ectoderm through 24 hpf and beyond. (I-P) Perturbations using a delta morpholino result in an increased number of neurons belonging to all three neural
subtypes. (I-J) Delta knockdown results in more serotonergic neurons in the apical organ, marked by Lv-tph expression (n= 84, 76%). (K-N) Delta knockdown results in more postoral
neurons marked by Lv-chat (n= 78, 78%) and Lv-th (n= 52, 69%). (O-P) Embryos injected with a Delta MO have an increased number of ciliary band neurons at 48 hpf marked by Lvchat (n= 75, 89%). ‘n’ represents the total number of embryos scored, and the percentage indicates the percent of embryos scored with the shown effect. See Fig. S2 for explanation of
focal plane shown in (O). Scale bars: 50 µm. Embryos cultured at 22 °C. Endo- endomesoderm expression, Oral ecto- oral ectoderm, Ap. Organ- apical organ. Nuclei (blue) in fluorescent
images stained with Hoechst.
2.4. Lv-neurogenin is proneural for ciliary band neurons
Lv-tph. These experiments show that at 14 hpf there are cells in the
apical organ that co-express Lv-achaete-scute and delta (Fig. 4G). At
the pluteus stage there are cells in the apical organ that co-express Lvachaete-scute and Lv-tph (Fig. 4H), suggesting that Lv-achaete-scute
acts in the serotonergic neurons themselves to specify fate. There are
examples, however of cells in the apical organ which express Lv-ac/sc
but not Lv-tph, and often cells that express Lv-ac/sc are directly
adjacent to a cell that expresses Lv-tph (arrowhead in Fig. 4H). The
expression of Lv-ac/sc and Lv-tph in adjacent cells could be because 1)
Lv-ac/sc is expressed in some serotonergic neural precursors that do
not yet express Lv-tph but will later in development, 2) Lv-ac/sc is
expressed in some neural progenitors that will divide and give rise to
serotonergic neurons 3) Lv-ac/sc is expressed in additional cell types in
the apical organ. Nevertheless, these results confirm that Lv-achaetescute is proneural and acts on a specific subset of neurons in the
developing nervous system.
Based on developmental in situ hybridizations, the L. variegatus
neurogenin ortholog, Lv-ngn, begins to be expressed at the late
gastrula stage in two bilaterally symmetric territories in the oral
ectoderm in an area anterior to the postoral neurons expressing Lvchat (Fig. 3E,M). At prism and pluteus stages, expression is found in a
salt-and-pepper pattern throughout the ciliary band (Fig. 3F-H). The
neural cells that express Lv-ngn are not the postoral or the serotonergic
neurons because they do not co-localize with either Lv-tph or Lv-chat
at pluteus stage (Fig. 3M-O).
To determine whether Lv-ngn is proneural or involved in neural
differentiation we injected zygotes with a translation blocking morpholino designed near the translation start site of Lv-ngn. In neurogenin
knockdown embryos, expression of delta mRNA was diminished at early
pluteus stage particularly in and around the ciliary band (Fig. 5A-B).
141
Developmental Biology 435 (2018) 138–149
L.A. Slota, D.R. McClay
Fig. 3. Expression of three neurogenic transcription factors in L. variegatus. (A-D) Expression of Lv-achaete-scute begins at 14 hours post fertilization (hpf) in the apical organ and
remains there through pluteus stage. (E-H) Expression of Lv-neurogenin begins in two bilaterally symmetric patches in the oral ectoderm at 18 hpf and then appears in the ciliary band
beginning at prism stage. (G-H) Lv-ngn expression remains restricted to cells in the ciliary band in pluteus larva. (I-L) Expression of Lv-orthopedia begins in 2–4 cells in the post oral
ectoderm at mid-gastrula stage and expression is found in the line of postoral neurons through pluteus larval stage. (M) Confocal maximum intensity projection shows expression of Lvngn does not overlap with Lv-chat expression in the oral ectoderm at late gastrula stage. Cells that express Lv-ngn are anterior to the position of the postoral neurons, marked here by
Lv-chat expression. (N) Confocal maximum intensity projection shows at pluteus stage Lv-ngn and Lv-chat are expressed in different neural subtypes with no overlap of expression. (O)
Confocal maximum intensity projection shows Lv-ngn expressing neural cells are not the serotonergic neurons of the apical organ because expression does not overlap with expression of
Lv-tph. To confirm that the two genes are not expressed in the same cells, combined and split channels of the maximum intensity projection are provided (the region of the embryo
shown in the right insets is highlighted by white box). Nuclei (blue) in fluorescent images stained with Hoechst. Scale bars: 50 µm. MB-mesenchyme blastula, MG-mid gastrula, LG-late
gastrula, PR-prism, PL-pluteus.
autonomous, we performed double whole mount in situ hybridization
with Lv-ngn and Lv-delta or Lv-chat. These data show that Lv-ngn is
co-expressed with delta at late gastrula stage, before these cells are in
the ciliary band and at pluteus stage when Lv-ngn expression is in the
ciliary band (Fig. 5I-J). Furthermore, at a later pluteus stage (40 hpf)
cells in the ciliary band that express Lv-ngn also express Lv-chat
(Fig. 5K). This suggests that the effects of neurogenin knockdown on
neurons in the ciliary band are cell autonomous.
To determine whether Lv-ngn is sufficient to drive specification of
ciliary band neurons, we injected zygotes with full-length capped Lvngn mRNA. Embryos injected with Lv-ngn RNA did not show an
increase in the expression of Lv-chat in the ciliary band at 48 hpf, nor
did it show ectopic expression of Lv-chat elsewhere in the embryo
This suggests that Lv-neurogenin is upstream of delta and is proneural
in the ciliary band. Confirming its role in neural specification in the
ciliary band, Lv-neurogenin knockdown embryos showed a decrease of
expression of Lv-chat in the ciliary band at 48 hpf (Fig. 5C-D).
Knockdown of Lv-ngn did not affect expression of Lv-tph, Lv-th, or
Lv-chat in the postoral neurons which shows that the specification of
these neurons does not depend on Lv-ngn (Fig. S6A-F). To confirm
morpholino specificity, we injected embryos with a second morpholino
designed near the translation start site and found the same effects
(Fig. 5E-H, Fig. S6G-L). These results indicate that Lv-ngn is proneural
in the sea urchin and is necessary for the specification of a subtype of
neuron, the cholinergic neurons in the ciliary band.
To confirm whether the effects of neurogenin knockdown are cell
142
Developmental Biology 435 (2018) 138–149
L.A. Slota, D.R. McClay
Fig. 4. Perturbations show Lv-achaete-scute is proneural for serotonergic neurons. (A-D) Perturbations using an Lv-achaete-scute translation-blocking morpholino (MO) shows Lv-ac/
sc is upstream of delta (n= 197, 94%) and tph (n= 130, 72%) in the apical organ which suggests that Lv-achaete-scute is proneural for the serotonergic neurons. (A’) and (B’) are oral
view images the same embryo shown in either (A) or (B). Arrowheads in B’ show delta expressing cells present in the oral ectoderm. Dotted line indicates apical organ. (E-F) Injection of
full length achaete-scute RNA results in increased number of serotonergic neurons in the apical organ. ‘n’ represents the total number of embryos scored, and the percentage indicates
the percent of embryos scored with the shown effect, µ equals the average number of tph-expressing cells per embryo. (G) A single Apotome section shows that Lv-ac/sc expressing cells
in the apical organ also express delta at 14 hpf. (H) A single Apotome section shows that Lv-ac/sc expressing cells in the apical organ also express Lv-tph, confirming Lv-ac/sc is
expressed in the serotonergic neurons of the apical organ. Arrowhead shows an example of adjacent cells where one cell expresses Lv-ac/sc and the other expresses Lv-tph. To confirm
that the two genes are expressed in the same cells in (G) and (H), combined and split channels of a single Apotome section are provided (the region of the embryo shown in the right
insets is highlighted by white box). Scale bars: 50 µm. Nuclei (blue) in fluorescent images stained with Hoechst.
near the start site in the 5’ UTR. When Lv-otp was perturbed using either
morpholino, we saw by in situ hybridization that expression of delta was
unaffected both in the postoral neural precursors as well as in other areas of
the embryo (Fig. 6A-B, G-H). Nevertheless, Otp knockdown embryos
exhibited a loss of Lv-th and Lv-chat when fixed at 24 hpf (Fig. 6C-F,
I-L). These data suggest that Otp is not proneural since it is not upstream of
delta expression in L. variegatus, but it is required for the proper
differentiation of the postoral neurons. Perturbation of Lv-otp had no effect
on the development of the serotonergic neurons or the cholinergic neurons
in the ciliary band when fixed after 48 hpf (Fig. S8). However, when
examining Lv-chat mRNA expression in the Otp knockdown embryos fixed
at 54 hpf, it appears that there may be a rescue of Lv-chat expression in the
postoral neurons. Rescue of expression of Lv-chat in the postoral neurons is
not surprising given that the postoral neurons are still specified and express
delta when Otp is perturbed and the embryos were fixed over 48 hours after
injection. Double whole mount in situ hybridization shows that Lv-otp is coexpressed with delta at 16 hpf (mid gastrula stage), (Fig. 6M). This suggests
that the effects of orthopedia knockdown are cell autonomous.
(Fig. S7). This suggests that Lv-ngn may require co-factors for proper
transcriptional binding or that Lv-ngn is used in combination with
other transcription factors to specify the ciliary band neurons. Taken
together, these data suggest that Lv-ngn is required for the specification of cholinergic ciliary band neurons, but alone is not sufficient to
drive neurogenesis in L. variegatus.
2.5. Lv-orthopedia is required for differentiation of dopaminergic/
cholinergic neurons
In the sea urchin, the homeobox transcription factor orthopedia
was previously shown to be expressed in the ventral ectoderm beginning at mid-gastrula stage in two bilaterally symmetric domains of the
oral ectoderm (Di Bernardo et al., 1999). As development proceeds
through pluteus stage, Lv-otp expressing cells form a line of cells in the
oral ectoderm (Fig. 3I-L). Previous studies in a related sea urchin
species, Paracentrotus lividus, suggested that otp is involved in
ectoderm patterning of skeletal morphogenesis (Di Bernardo et al.,
1999; Cavalieri et al., 2003). We show by double in situ hybridization
that these orthopedia expressing ectodermal cells are in fact the
postoral neurons, which co-express Lv-chat and Lv-th by late gastrula
stage (Fig. 6N). Since Lv-otp is expressed in the postoral neurons, we
asked whether it was involved in specification of this neural subtype.
To determine whether Lv-otp is proneural or involved in downstream
differentiation of the postoral neurons, we injected zygotes with a translation blocking morpholino designed to target the start site and a second MO
3. Discussion
3.1. Towards a sea urchin neurogenic gene regulatory network
Until now, the sea urchin larval nervous system was largely treated as a
system that was patterned as unit with 2 types of neurons: serotonergic
neurons and all other neurons that were treated as a single entity. It was
143
Developmental Biology 435 (2018) 138–149
L.A. Slota, D.R. McClay
Fig. 5. Perturbations show Lv-neurogenin is proneural for ciliary band neurons. (A-H) Perturbations using two different Ngn MOs show Lv-ngn is upstream of delta (MO1: n= 83, 86%
downregulated; MO2: n= 60, 82% downregulated) and Lv-chat expression in the ciliary band at 48 hpf (MO1: n = 67, 75% downregulated; MO2: n = 107, 87% downregulated), which
suggests that Lv-ngn is proneural for neurons in the ciliary band. See Fig. S2 for explanation of focal planes shown in (C-D, G-H). ‘n’ represents the total number of embryos scored, and
the percentage indicates the percent of embryos scored with the shown effect. Arrowheads in (D) and (H) show the Lv-chat-expressing postoral neurons are still specified in Ngn
knockdown embryos. (I-J) Fluorescent whole mount double in situ hybridization shows that Lv-ngn co-expresses with delta. (I) A single confocal section shows that Lv-ngn expressing
cells in the ectoderm also express delta at a time before the Lv-ngn cells are in the ciliary band. (J) A maximum intensity projection on the left panel shows that later in development,
once Lv-ngn cells are in the ciliary band, they continue to express Lv-delta. (K) Shows Lv-Ngn cells in the ciliary band express Lv-chat at 40 hpf. To confirm that the two genes are
expressed in the same cells, combined and split channels of a single confocal section are provided (the region of the embryo shown in the right insets is highlighted by white box). Scale
bars: 50 µm. Nuclei (blue) in fluorescent images stained with Hoechst.
Observations made in this study also present new questions that are
unanswered about the patterning of the sea urchin nervous system.
Based on the spatial expression of delta, there are more neural
progenitors in the oral ectoderm than neurons in the larva. It has
recently been shown in the sea urchin S. purpuratus that neural
progenitors divide in the oral ectoderm and produce two daughter
cells: one neural precursor and one cell that will undergo apoptosis
(Mellott et al., 2017). In other systems, such as the developing mouse
brain, apoptosis is essential to avoid hyperproliferation of neuronal
stem cells (Blaschke et al., 1996; Sommer and Rao, 2002). Such a
scenario is likely the case in the L. variegatus embryo, where a
proportion of delta expressing neural progenitors in the ectoderm are
fated to undergo apoptosis. Additionally, many cells that express delta
in the oral ectoderm are located at distances from the ciliary band or
postoral ectoderm where neurons will arise (in some cases ~50 µm).
This presents the question of whether some neural cells undergo a
coordinated migration to their final positions in the embryo. Live
imaging coupled with lineage tracing of neural progenitors will be
required to determine whether this is the case in the sea urchin.
Transcription factors are often used for more than one developmental process in controlling expression of genes in the embryo. Only a
restricted number of them are dedicated to a single process such as
neurogenesis. Of the genes we examined in the sea urchin, achaetescute and neurogenin are largely limited to roles in neurogenesis while
orthopedia is also published as a gene involved in skeletal growth in
the sea urchin. This is surprising given that Otp in most, if not all other
organisms, is associated almost exclusively with neural or neuroendo-
previously shown that there are genes that are expressed in all neurons/
neural progenitors, with certain transcription factors (such as SoxC and
Brn1/2/4) being required broadly for neurogenesis (Garner et al., 2016;
Wei et al., 2015). Here, using a combination of gene expression and
perturbation analysis, we characterize the L. variegatus nervous system as
consisting of at least 4 subtypes of neurons by 48 hours of development,
each with their own unique expression profile. For the 3 neuronal subtypes
that are specified in the ectoderm, we show an example of a single
transcription factor expressed uniquely in that subtype that is necessary
for proper differentiation. Given that these 3 neural subtypes rely on a
different transcription factor for proper development and that they
ultimately go on to express different combinations of neurotransmitters,
they must each have their own unique gene regulatory network subcircuits
(Fig. 7A-C). While these data show differences, we also show shared
features of the gene regulatory network subcircuits for these neuron
subtypes, as all 3 subtypes rely on Delta/Notch signaling to regulate the
correct number and location of neurons.
Together, L. variegatus and a related sea urchin species S.
purpuratus, which have very similar developmental GRNs, represent
one of the most complete experimentally documented deuterostome
developmental GRNs up to and including the time of neurulation
(Davidson, 2010; Hinman and Cheatle Jarvela, 2014; McClay, 2011;
Oliveri and Davidson, 2004). This study, along with ones before it
(Garner et al., 2016; Yaguchi et al., 2012) can be used as a starting
point to create and expand the GRN for sea urchin neurogenesis. Over
time, more transcription factors and signaling molecules can be added
to expand the GRN subcircuits presented here.
144
Developmental Biology 435 (2018) 138–149
L.A. Slota, D.R. McClay
Fig. 6. Perturbations show Lv-orthopedia is necessary for differentiation of postoral neurons. (A-B, G-H) Perturbations using two different Otp MOs show Lv-otp is not upstream of
delta expression in the postoral neuroblasts (MO1: n=131, 96% unchanged; MO2: n= 101, 91% unchanged) or in other neural cells of the embryo. Arrowheads show examples of
postoral neural cells that express delta. (C-F, I-L) Lv-otp is upstream of Lv-chat (MO1: n= 196, 66% downregulated; MO2: n = 201, 75% downregulated) and Lv-th (MO1: n = 104, 76%
downregulated; MO2: n = 31, 97% downregulated) in the oral ectoderm. ‘n’ represents the total number of embryos scored, and the percentage indicates the percent of embryos scored
with the shown effect. These data suggest that Orthopedia is required for the differentiation of the dopaminergic/cholinergic postoral neurons in L. variegatus. (M) A single confocal
section shows that Lv-otp expressing cells in the oral ectoderm also express delta. (N) A maximum intensity projection on the left panel shows that later in development, the Lv-otp
expressing cells in the oral ectoderm will become the postoral neurons, which express Lv-chat. To confirm that the two genes are expressed in the same cells, combined and split
channels of a single confocal section are provided (the region of the embryo shown in the right insets is highlighted by white box). Scale bars: 50 µm. Nuclei (blue) in fluorescent images
stained with Hoechst.
been largely excluded from studies on the origins of neurogenesis
because adults have pentaradial symmetry, a trait thought to be highly
derived (Angerer et al., 2011; Burke et al., 2006). However, echinoderm embryos and larva are bilaterally symmetric, can be experimentally perturbed, and have simple embryonic development (Angerer
et al., 2011; McClay, 2011). When taken together, the phylogenetic
position, along with the tractability to molecular techniques, the ease
with which developmental GRNs can be created and the simplicity of
their development at the time of neurogenesis make echinoderms an
excellent model to study the origins of the deuterostome nervous
system GRN.
Achaete-scute, neurogenin, and orthopedia function in three
neuronal subtypes in the sea urchin, and their apparent function is
strikingly similar to their function in vertebrates. Lv-achaete-scute and
Lv-neurogenin belong to the bHLH family of transcription factors and
have differing roles during neurogenesis between ecdysozoan and
vertebrate models (Simionato et al., 2008). In Drosophila, achaetescute (Ac/Sc) genes are essential for specification of neural identity in
ectodermal cells and are the main proneural bHLH genes for the
central nervous system (Ghysen and Dambly-Chaudière, 1988;
Simionato et al., 2008; Skeath and Carroll, 1994). In the nematode
C. elegans, there are two Ac/Sc genes involved in neurogenesis, hlh-3
and hlh-14, one of which, hlh-14, is proneural and is necessary for the
specification of neuroblast lineages that will generate neurons of
distinct functions (Doonan et al., 2008; Frank et al., 2003). In mice,
there are two achaete-scute genes, one of which, acsl1/mash1, is
expressed in the developing nervous system (Huang et al., 2014). While
the vertebrate ortholog, acsl1 is also proneural, it only functions as a
neural specification gene in certain cellular contexts, and contributes to
neural specification only in a small subset of cells in the central and
enteric nervous systems (Huang et al., 2014). Functional differences of
crine development (Fernandes et al., 2013; Ryu et al., 2007; Simeone
et al., 1994). Two publications in a related sea urchin embryo
concluded that Otp governs skeletal patterning by possibly triggering
an ectodermal signaling pathway to positively promote skeletogenesis
(Di Bernardo et al., 1999; Cavalieri et al., 2003). By in situ analysis, the
authors saw a similar sequential pattern of otp expression in the
ectoderm as we report here. However, here we show that these otpexpressing ectodermal cells are neurons based on co-expression
analysis with neurotransmitter synthesis enzymes. Consistent with
previous data, we found that knockdown of Otp resulted in no apparent
effect on the expression levels of the skeletal marker msp130 (Fig. S9AB). We also found that the higher volumes of MO delivered resulted in
embryos that were severely delayed and lacked skeletal spicules (Fig.
S9E-F), and Otp knockdown embryos had shorter arms compared to
controls (Fig. S9C-D). At a molecular level, these skeletal phenotypes
could be an off-target effect or it could be a neural input to skeletal
patterning. There is evidence that dopamine signaling in the sea
urchin, which we show here is acting at least in part through the otp
expressing postoral neurons, can affect arm length in pre-feeding sea
urchin larvae in response to food abundance (Adams et al., 2011).
More work is required to determine the mechanism by which neural
patterning and function can elicit a morphogenic response in the sea
urchin.
3.2. The evolution of neural gene regulatory networks
Gene regulatory network (GRN) analyses have the potential for
revealing ancestral modes of neurogenesis used by bilaterians and
therefore is a major focus in studies of the evolution of the nervous
system. As echinoderms, sea urchins are a basally branching deuterostome group that are closely related to chordates. Echinoderms have
145
Developmental Biology 435 (2018) 138–149
L.A. Slota, D.R. McClay
Fig. 7. Gene regulatory network subcircuits operating in each neural subtype. (A-C) Schematics show the effect of transcription factor perturbations on the L. variegatus nervous
system. Biotapestry models show the gene regulatory network subcircuit each gene is acting in Longabaugh et al. (2005). (A) Knockdown and overexpression of Lv-ac/sc results in less or
more serotonergic neurons in the L. variegatus apical organ, respectively. (B) Knockdown of Lv-ngn results in a loss of ciliary band cholinergic neurons (C) Knockdown of Lv-otp results
in loss of cholinergic/catecholaminergic postoral neurons. (D) Phylogenetic tree showing relative positions of vertebrates, echinoderms, and some protostome groups. Shapes represent
the different transcription factors; colors represent function found in each clade. Data from Platynereis, vertebrates, and sea urchins suggest shared functions of Achaete-Scute and
Neurogenin. We propose the GRN subcircuit containing Orthopedia is conserved with vertebrates and is likely ancient to the deuterostome lineage, however further analyses need to be
carried out with Orthopedia orthologues in protosome groups to determine if the subcircuit evolved earlier (blue triangle). Data taken from Simionato et al. (2008), Lu et al. (2012), Stolfi
et al. (2015), Vervoort and Ledent (2001), Huang et al. (2014), Bertrand et al. (2002), Ghysen and Dambly-Chaudière (1988), Skeath and Carroll (1994), Ma et al. (1998, 1999, 1996),
Sommer et al. (1996), Roybon et al. (2010), Bush et al. (1996), Yuan et al. (2016), Ryu et al. (2007), Fernandes et al. (2013), Mummery-widmer et al. (2009).
146
Developmental Biology 435 (2018) 138–149
L.A. Slota, D.R. McClay
in the sea urchin, we will have a better understanding of the
transcriptional targets of neural transcription factors and how that
gives rise to the nervous system in the pluteus larva. Together, the ease
of creating GRNs in the sea urchin combined with the simple
development of the embryo at the time of neurogenesis gives the sea
urchin the potential to become a deuterostome model for the molecular
mechanisms that occur during neural patterning.
orthologues between species also exist for genes belonging to the
neurogenin family. The vertebrate neurogenin genes (neurog1, neurog2, and neurog3) are essential for broad neuronal specification and
are the main proneural bHLH genes in the central and peripheral
nervous systems of vertebrate embryos (Ma et al., 1996; Sommer et al.,
1996; Ma et al., 1998, 1999; Roybon et al., 2010; Huang et al., 2014).
In contrast to the broad specification roles of neurogenin genes in
vertebrates, the single Drosophila neurogenin ortholog, tap/biparous,
has no apparent role in specification and is only involved in differentiation (downstream of Delta signaling) and axon outgrowth in a
small subset of neural cells (Bush et al., 1996; Yuan et al., 2016). The
sea urchin, as a basally branching deuterostome can be an informative
model to clarify when these differences arose in evolution and can help
reconstruct ancestral features of neurogenesis.
This study confirms that Lv-achaete-scute is proneural in the sea
urchin and acts only on a specific subset of neurons in the developing
nervous system, a role more similar to vertebrates. Data presented here
also indicates that Lv-ngn is proneural in the sea urchin, which is a
function conserved with vertebrates and different from Drosophila.
Expression data for neurogenin and achaete-scute in the protostome
annelids Platynereis dumerilii and Capitella suggests that these genes
are also proneural (Meyer and Seaver, 2009; Simionato et al., 2008;
Sur et al., 2017). In fact, it has been proposed based on expression data
that Platynereis uses its achaete-scute ortholog as a proneural gene
specifically for its population of serotonergic neurons, the exact role we
find in the sea urchin (Simionato et al., 2008). This expression data in
annelid models along with our experiments in the sea urchin suggests
that the use of achaete-scute and neurogenin as proneural genes could
have evolved in the common ancestor of all bilaterians. We propose
that this ancestor developed its nervous system with achaete-scute
being used to specify a population of serotonergic neurons and
neurogenin used to specify another neural subtype(s) (Fig. 7D).
In the postoral neurons we focused on orthopedia, a homeobox
transcription factor expressed in areas of the central nervous system of
mice and in the hypothalamus of tetrapods shown to have a prominent
role in ventral diencephalic dopaminergic differentiation (Ryu et al.,
2007). Otp knockout zebrafish and mice exhibit a loss of th expression
in the hypothalamus but these perturbations do not eliminate markers
for neural precursors, suggesting that Otp is used not in a proneural
fashion but in the differentiation of neurons in vertebrates (Ryu et al.,
2007). In Drosophila, orthopedia is expressed throughout the ventral
nerve cords and in the hindgut (Gramates et al., 2017). It is suggested
from a Drosophila screen that orthopedia has a role upstream of DeltaNotch lateral inhibition, but the function of orthopedia in the fly
embryo during neurogenesis is still unclear (Mummery-widmer et al.,
2009). However, the nearly identical role of Otp in the differentiation of
dopaminergic neurons in both sea urchins and vertebrates suggests
that this transcription factor may be a component of an ancient
deuterostome GRN used by the common ancestor of echinoderms
and chordates. In Platynereis, otp is expressed in neurosecretary cell
types but the role of otp in these cells is untested (Tessmar-Raible et al.,
2007). The role of orthopedia orthologs in arthropods and other
species outside of deuterostomes needs to be examined to determine
if this function evolved earlier (Fig. 7D).
Comparisons of nervous system GRNs in several model organisms
suggests that neurogenesis across the animal kingdom is generally well
conserved. How well conserved across metazoans is still an open
question. Up to this point, neural development studies in non-traditional model organisms have been largely descriptive and lack functional data because functional analyses are only now gaining traction in
many organisms. While the three GRN subcircuits presented here are
likely conserved along the deuterostome lineage, these depictions
represent a fraction of GRNs operating during neurogenesis. As the
sea urchin neural GRN expands, there certainly will be more opportunities for comparative studies to find conserved and derived modes of
neurogenesis. Furthermore, through the expansion of the neural GRN
4. Materials and methods
4.1. Adult animals and embryo culture
Adult L. variegatus were from the Duke University Marine Lab
(Beaufort, NC, United States), Reeftopia (Key West, FL, United States),
or Pelagic Corp. (Sugarloaf Key, FL, United States). Gametes were
harvested by injection of 0.5 M KCl into the adult and embryos were
cultured at 22 °C in filtered artificial seawater (ASW).
4.2. Cloning and whole mount in situ hybridization
The full length or partial coding sequences for transcription factors
and neurotransmitter genes were obtained by designing primers
against a transcriptome data set. PCR was carried out with High
Fidelity Phusion Master Mix (NEB). Accession numbers: AchaeteScute: KY766875, Neurogenin: KY766876, Orthopedia: AY445031.1,
Chat: KY766877, TH: KY766878, Tph: KY766879. In situ hybridization (ISH) was performed using antisense RNA probes labeled with
Digoxigenin-11-UTP (Roche). Embryos were fixed overnight at 4 °C in
4% paraformaldehyde made in filtered artificial sea water (FASW),
washed with FASW, and stored in methanol at −20 °C. RNA probes
were synthesized in vitro and hybridized at 65 °C. Probes were
visualized using AP-conjugated anti-DIG antibody (1:1500, Roche
[Indianapolis, IN, United States]). Color was developed using NBT/
BCIP (Roche). For double fluorescent in situ hybridization, a second
probe labeled with Fluorescein-12-UTP was hybridized. For all double
in situ hybridization except those featuring Lv-achaete-scute, expression of both the Dig and Flu labeled probes were detected using a
Tyramide Signal Amplification system (TSA-plus kit, Perkin Elmer
[Waltham, MA, United States]). Double in situ hybridization were
visualized with a Zeiss LSM 510 inverted confocal microscope. For
double ISH with Lv-achaete-scute probe, Dig-labeled Lv-ac/sc probes
were developed using NBT/BCIP and the Flu-labeled probe was
detected with the TSA kit. These Lv-achaete-scute double ISH were
visualized using the far red autofluorescence of the NBT/BCIP precipitate on a Zeiss Axio Imager with an Apotome.2. DIC images were
taken with a Zeiss upright Axio Imager.
4.3. Morpholino and RNA microinjections
Morpholino antisense oligonucleotides were designed against the
start site of translation or 5’ UTR by GeneTools. Morpholino sequences
and concentrations are as listed in Table 1. Morpholinos and mRNA
were diluted in molecular-grade H20 and FITC injectable dye. All
experiments were carried out at least twice and cultured at 22 °C. For
embryos injected with standard control morpholino, images shown for
each experiment are representatives of observed in greater than 90% of
injected embryos. To test the specificity of the Ngn and Otp morpholinos, we ordered a second, distinct morpholino to the 5′ UTR and
verified using in situ hybridization (Figs. 5 and 6; Figs. S6 and S8). Full
length Lv-achaete-scute RNA was synthesized using the mMessage
mMachine Kit (Invitrogen) and injected at a concentration of 50 ng/ul.
For rescue experiments, full length Lv-achaete-scute RNA was coinjected at 100 ng/ul with morpholino concentration listed in Table 1.
Full length Lv-neurogenin was also synthesized with mMessage kit and
injected at concentrations of 250, 500, and 700 ng/ul, none of which
produced a phenotype.
147
Developmental Biology 435 (2018) 138–149
L.A. Slota, D.R. McClay
Table 1
Sequences and concentrations of morpholinos used in this study.
MO
MO Sequence
MO Type
Lv-Delta
Lv-AcSc
Lv-Ngn MO1
Lv-Ngn MO2
Lv-Otp MO1
Lv-Otp MO2
Control MO
GTGCAGCCGATTCGTTATTCCTTT
ACAATGTTCTCCATTTTGTGTCTTT
GCGCTGTTGACCCATCGTTTTGTTC
ATGGATATGCCCTTCTCCTCTAATT
ACATGGGCTAGAGTTCGCTCCATTC
ATACCCGGAGACAAGTCCTGAGGAA
CTTCTTACCTCAGTTACAATTTATA
Translation
Translation
Translation
Translation
Translation
Translation
Translation
Working Concentration
Blocking
Blocking
Blocking
Blocking
Blocking
Blocking
Blocking
.75 mM
.75 mM
.75 mM
.75 mM
.75 mM
.75 mM
.75 mM
Bush, A., Hiromi, Y., Cole, M., 1996. Biparous: a novel bHLH gene expressed in neuronal
and glial precursors in Drosophila. Dev. Biol. 180, 759–772. https://doi.org/10.
1006/dbio.1998.9154.
Castro, D.S., Skowronska-Krawczyk, D., Armant, O., Donaldson, I.J., Parras, C., Hunt, C.,
Critchley, J.A., Nguyen, L., Gossler, A., G??ttgens, B., Matter, J.M., Guillemot, F.,
2006. Proneural bHLH and Brn proteins coregulate a neurogenic program through
cooperative binding to a conserved DNA motif. Dev. Cell 11, 831–844. https://doi.
org/10.1016/j.devcel.2006.10.006.
Cavalieri, V., Spinelli, G., Di Bernardo, M., 2003. Impairing Otp homeodomain function
in oral ectoderm cells affects skeletogenesis in sea urchin embryos. Dev. Biol. 262,
107–118. https://doi.org/10.1016/S0012-1606(03)00317-8.
Davidson, E.H., 2010. Emerging properties of animal gene regulatory networks. Nature
468, 911–920. https://doi.org/10.1038/nature09645.
Di Bernardo, M., Castagnetti, S., Bellomonte, D., Oliveri, P., Melfi, R., Palla, F., Spinelli,
G., 1999. Spatially restricted expression of PlOtp, a Paracentrotus lividus orthopediarelated homeobox gene, is correlated with oral ectodermal patterning and skeletal
morphogenesis in late-cleavage sea urchin embryos. Development 126, 2171–2179.
Doonan, R., Hatzold, J., Raut, S., Conradt, B., Alfonso, A., 2008. HLH-3 is a C. elegans
Achaete/Scute protein required for differentiation of the hermaphrodite-specific
motor neurons. Mech. Dev. 125, 883–893. https://doi.org/10.1016/j.mod.2008.06.
002.
Fernandes, A.M., Beddows, E., Filippi, A., Driever, W., 2013. Orthopedia transcription
factor otpa and otpb paralogous genes function during dopaminergic and
neuroendocrine cell specification in larval zebrafish. PLoS One 8, e75002. https://
doi.org/10.1371/journal.pone.0075002.
Frank, C.A., Baum, P.D., Garriga, G., 2003. HLH-14 is a C. elegans achaete-scute protein
that promotes neurogenesis through asymmetric cell division. Development 130,
6507–6518. https://doi.org/10.1242/dev.00894.
Garner, S., Zysk, I., Byrne, G., Kramer, M., Moller, D., Taylor, V., Burke, R.D., 2016.
Neurogenesis in sea urchin embryos and the diversity of deuterostome neurogenic
mechanisms 286–297. ⟨http://dx.doi.org/10.1242/dev.124503⟩.
Ghysen, A., Dambly-Chaudière, C., 1988. From DNA to form: the achaete-scute complex.
Genes Dev. 2, 495–501. https://doi.org/10.1101/gad.2.5.495.
Gramates, L.S., Marygold, S.J., dos Santos, G., Urbano, J.-M., Antonazzo, G., Matthews,
B.B., Rey, A.J., Tabone, C.J., Crosby, M.A., Emmert, D.B., Falls, K., Goodman, J.L.,
Hu, Y., Ponting, L., Schroeder, A.J., Strelets, V.B., Thurmond, J., Zhou, P., the
FlyBase Consortium, 2017. FlyBase at 25: looking to the future. Nucleic Acids Res.
45 (D1), D663–D671.
Hartenstein, V., Stollewerk, A., 2015. The evolution of early neurogenesis. Dev. Cell 32,
390–407. https://doi.org/10.1016/j.devcel.2015.02.004.
Hinman, V.F., Cheatle Jarvela, A.M., 2014. Developmental gene regulatory network
evolution: insights from comparative studies in echinoderms. Genesis 52, 193–207.
https://doi.org/10.1002/dvg.22757.
Huang, C., Chan, J.A., Schuurmans, C., 2014. Proneural bHLH Genes in Development
and Disease., 1st ed, Current topics in developmental biology. Elsevier Inc. ⟨https://
doi.org/10.1016/B978-0-12-405943-6.00002-6⟩.
Kageyama, R., Ohtsuka, T., Shimojo, H., Imayoshi, I., 2009. Dynamic regulation of Notch
signaling in neural progenitor cells. Curr. Opin. Cell Biol. 21, 733–740. https://doi.
org/10.1016/j.ceb.2009.08.009.
Katow, H., Katow, T., Yoshida, H., Kiyomoto, M., Uemura, I., 2016.
Immunohistochemical and ultrastructural properties of the larval ciliary bandassociated strand in the sea urchin Hemicentrotus pulcherrimus. Front. Zool. 13, 27.
https://doi.org/10.1186/s12983-016-0159-8.
Longabaugh, W.J.R., Davidson, E.H., Bolouri, H., 2005. Computational representation of
developmental genetic regulatory networks. Dev. Biol. 283, 1–16. https://doi.org/
10.1016/j.ydbio.2005.04.023.
Lu, T.-M., Luo, Y.-J., Yu, J.-K., 2012. BMP and Delta/Notch signaling control the
development of amphioxus epidermal sensory neurons: insights into the evolution of
the peripheral sensory system. Development 139, 2020–2030. https://doi.org/10.
1242/dev.073833.
Ma, Q., Chen, Z., Barrantes, I.D.B., De La Pompa, J.L., Anderson, D.J., 1998.
Neurogenin1 is essential for the determination of neuronal precursors for proximal
cranial sensory ganglia. Neuron 20, 469–482. https://doi.org/10.1016/S08966273(00)80988-5.
Ma, Q., Fode, C., Guillemot, F., Anderson, D.J., 1999. NEUROGENIN1 and
NEUROGENIN2 control two distinct waves of neurogenesis in developing dorsal
root ganglia. Genes Dev. 13, 1717–1728. https://doi.org/10.1101/gad.13.13.1717.
Ma, Q., Kintner, C., Anderson, D.J., 1996. Identification of neurogenin, a vertebrate
neuronal determination gene. Cell 87, 43–52. https://doi.org/10.1016/S00928674(00)81321-5.
Mackie, G.O., Spencer, A.N., Strathmann, R., 1969. Electrical activity associated with
Acknowledgements and funding sources
We would like to thank the members of the McClay lab as well as
Drs Megan Martik, Deirdre Lyons and Gregory Wray for providing
constructive and insightful feedback on the manuscript and Brianna
Peskin for contributions to the paper during her laboratory rotation.
This material is based upon work supported by the National Science
Foundation Graduate Research Fellowship Program under Grant No.
(NSF DGF 1106401) (to LAS) and NIH (RO1-HD-14483 and NIH
PO1-HD-037105) (to DRM).
The funder had no role in study design, data collection and
interpretation, or the decision to submit the work for publication.
Competing interests
The authors declare no competing interest or financial
interests.Funding sources
This work was supported by: National Science Foundation GRFP
grant DGF 1106401 to Leslie A. Slota.
National Institute of Child Health and Human Development
(NICHD) NIH RO1-HD-14483 to David R McClay.
National Institute of Child Health and Human Development
(NICHD) NIH PO1-HD-037105 to David R McClay.Author contributions
L.A.S conducted and designed experiments, wrote manuscript and
prepared figures. D.R.M supervised the study and revised/reviewed
manuscript and figures.
Appendix A. Supporting information
Supplementary data associated with this article can be found in the
online version at doi:10.1016/j.ydbio.2017.12.015.
References
Adams, D.K., Sewell, M.A., Angerer, R.C., Angerer, L.M., 2011. Rapid adaptation to food
availability by a dopamine-mediated morphogenetic response. Nat. Commun. 2, 592.
https://doi.org/10.1038/ncomms1603.
Angerer, L.M., Yaguchi, S., Angerer, R.C., Burke, R.D., 2011. The evolution of nervous
system patterning: insights from sea urchin development. Development 138, 3613–
3623. https://doi.org/10.1242/dev.058172.
Artavanis-Tsakonas, S., Rand, M., Lake, R., 1999. Notch signaling: cell fate control and
signal integration in development. Science 284 (80-), 770–776. https://doi.org/10.
1126/science.284.5415.770.
Bertrand, N., Castro, D.S., Guillemot, F., 2002. Proneural genes and the specification of
neural cell types. Nat. Rev. Neurosci. 3, 517–530. https://doi.org/10.1038/nrn874.
Bisgrove, B.W., Burke, R.D., 1987. Development of the nervous system of the pluteus
larva of Strongylocentrotus droebachiensis. Cell Tissue Res. 248, 335–343. https://
doi.org/10.1007/BF00218200.
Blaschke, A.J., Staley, K., Chun, J., 1996. Widespread programmed cell death in
proliferative and postmitotic regions of the fetal cerebral cortex. Development 122,
1165–1174.
Burke, R.D., Angerer, L.M., Elphick, M.R., Humphrey, G.W., Yaguchi, S., Kiyama, T.,
Liang, S., Mu, X., Agca, C., Klein, W.H., Brandhorst, B.P., Rowe, M., Wilson, K.,
Churcher, A.M., Taylor, J.S., Chen, N., Murray, G., Wang, D., Mellott, D., Olinski, R.,
Hallböök, F., Thorndyke, M.C., 2006. A genomic view of the sea urchin nervous
system. Dev. Biol. 300, 434–460. https://doi.org/10.1016/j.ydbio.2006.08.007.
Burke, R.D., Moller, D.J., Krupke, O.A., Taylor, V.J., 2014. Sea urchin neural
development and the metazoan paradigm of neurogenesis. Genesis 14, (n/a–n/a).
https://doi.org/10.1002/dvg.22750.
148
Developmental Biology 435 (2018) 138–149
L.A. Slota, D.R. McClay
bHLH transcription factors, are putative mammalian neuronal determination genes
that reveal progenitor cell heterogeneity in the developing CNS and PNS. Mol. Cell.
Neurosci. 8, 221–241. https://doi.org/10.1006/mcne.1996.0060.
Sommer, L., Rao, M., 2002. Neural stem cells and regulation of cell number. Prog.
Neurobiol. 66, 1–18. https://doi.org/10.1016/S0301-0082(01)00022-3.
Stolfi, A., Ryan, K., Meinertzhagen, I.A., Christiaen, L., 2015. Migratory neuronal
progenitors arise from the neural plate borders in tunicates. Nature 527, 371–374.
https://doi.org/10.1038/nature15758.
Strathmann, R.R., 2007. Time and extent of ciliary response to particles in a non-filtering
feeding mechanism. Biol. Bull. 212, 93–103. https://doi.org/10.2307/25066587.
Sur, A., Magie, C.R., Seaver, E.C., Meyer, N.P., 2017. Spatiotemporal regulation of
nervous system development in the annelid Capitella teleta. Evodevo 8, 13. https://
doi.org/10.1186/s13227-017-0076-8.
Sutherby, J., Giardini, J.-L., Nguyen, J., Wessel, G., Leguia, M., Heyland, A., 2012.
Histamine is a modulator of metamorphic competence in Strongylocentrotus
purpuratus (Echinodermata: echinoidea). BMC Dev. Biol. 12, 14. https://doi.org/10.
1186/1471-213X-12-14.
Tessmar-Raible, K., Raible, F., Christodoulou, F., Guy, K., Rembold, M., Hausen, H.,
Arendt, D., 2007. Conserved sensory-neurosecretory cell types in annelid and fish
forebrain: insights into hypothalamus evolution. Cell 129, 1389–1400. https://doi.
org/10.1016/j.cell.2007.04.041.
Vervoort, M., Ledent, V., 2001. The evolution of the neural basic helix-loop-helix
proteins. Sci. World J. 1, 396–426. https://doi.org/10.1100/tsw.2001.68.
Wei, Z., Angerer, L.M., Angerer, R.C., 2015. Neurogenic gene regulatory pathways in the
sea urchin embryo. Dev. Dev. 125989. https://doi.org/10.1242/dev.125989.
Wei, Z., Angerer, R.C., Angerer, L.M., 2011. Direct development of neurons within
foregut endoderm of sea urchin embryos. Proc. Natl. Acad. Sci. USA 108, 9143–
9147. https://doi.org/10.1073/pnas.1018513108.
Wei, Z., Yaguchi, J., Yaguchi, S., Angerer, R.C., Angerer, L.M., 2009. The sea urchin
animal pole domain is a Six3-dependent neurogenic patterning center. Development
136, 1583. https://doi.org/10.1242/dev.037002.
Yaguchi, J., Angerer, L.M., Inaba, K., Yaguchi, S., 2012. Zinc finger homeobox is required
for the differentiation of serotonergic neurons in the sea urchin embryo. Dev. Biol.
363, 74–83. https://doi.org/10.1016/j.ydbio.2011.12.024.
Yaguchi, S., Katow, H., 2003. Expression of tryptophan 5-hydroxylase gene during sea
urchin neurogenesis and role of serotonergic nervous system in larval behavior. J.
Comp. Neurol. 466, 219–229. https://doi.org/10.1002/cne.10865.
Yankura, K.A., Koechlein, C.S., Cryan, A.F., Cheatle, A., Hinman, V.F., 2013. Gene
regulatory network for neurogenesis in a sea star embryo connects broad neural
specification and localized patterning. Proc. Natl. Acad. Sci. USA 110, 8591–8596.
https://doi.org/10.1073/pnas.1220903110.
Yuan, L., Hu, S., Okray, Z., Ren, X., De Geest, N., Claeys, A., Yan, J., Bellefroid, E.,
Hassan, B.A., Quan, X.-J., 2016. The Drosophila Neurogenin, Tap, functionally
interacts with the Wnt-PCP pathway to regulate neuronal extension and guidance.
Dev. Dev. 134155. https://doi.org/10.1242/dev.134155.
ciliary reversal in an echinoderm larva. Nature 223, 1384.
Marlow, H., Tosches, M.A., Tomer, R., Steinmetz, P.R., Lauri, A., Larsson, T., Arendt, D.,
2014. Larval body patterning and apical organs are conserved in animal evolution.
BMC Biol. 12, 7. https://doi.org/10.1186/1741-7007-12-7.
McClay, D.R., 2011. Evolutionary crossroads in developmental biology: sea urchins.
Development 138, 2639–2648. https://doi.org/10.1242/dev.048967.
Mellott, D.O., Thisdelle, J., Burke, R.D., 2017. Notch signaling patterns neurogenic
ectoderm and regulates the asymmetric division of neural progenitors in sea urchin
embryos. Development. https://doi.org/10.1242/dev.151720.
Meyer, N.P., Seaver, E.C., 2009. Neurogenesis in an annelid: characterization of brain
neural precursors in the polychaete Capitella sp. I. Dev. Biol. 335, 237–252. https://
doi.org/10.1016/j.ydbio.2009.06.017.
Mummery-widmer, J.L., Yamazaki, M., Stoeger, T., Novatchkova, M., Bhalerao, S., Chen,
D., Dietzl, G., Dickson, B.J., Knoblich, J.A., 2009. Genome-wide analysis of Notch
signalling in Drosophila by transgenic RNAi. Nature 458, 987–992. https://doi.org/
10.1038/nature07936.
Oliveri, P., Davidson, E.H., 2004. Gene regulatory network controlling embryonic
specification in the sea urchin. Curr. Opin. Genet. Dev. 14, 351–360. https://doi.org/
10.1016/j.gde.2004.06.004.
Range, R., 2014. Specification and positioning of the anterior neuroectoderm in
deuterostome embryos. Genesis 52, 222–234. https://doi.org/10.1002/dvg.22759.
Roybon, L., Mastracci, T.L., Ribeiro, D., Sussel, L., Brundin, P., Li, J.-Y., 2010.
GABAergic differentiation induced by Mash1 is compromised by the bHLH proteins
Neurogenin2, NeuroD1, and NeuroD2. Cereb. Cortex 20, 1234–1244. https://doi.
org/10.1093/cercor/bhp187.
Ryu, S., Mahler, J., Acampora, D., Holzschuh, J., Erhardt, S., Omodei, D., Simeone, A.,
Driever, W., 2007. Orthopedia homeodomain protein is essential for diencephalic
dopaminergic neuron development. Curr. Biol. 17, 873–880. https://doi.org/10.
1016/j.cub.2007.04.003.
Satterlie, R.A., Andrew Cameron, R., 1985. Electrical activity at metamorphosis in larvae
of the sea urchin Lytechinus pictus (Echinoidea: Echinodermata). J. Exp. Zool. 235,
197–204. https://doi.org/10.1002/jez.1402350206.
Simeone, A., D’Apice, M.R., Nigro, V., Casanova, J., Graziani, F., Acampora, D.,
Avantaggiato, V., 1994. Orthopedia, a novel homeobox-containing gene expressed in
the developing CNS of both mouse and drosophila. Neuron 13, 83–101. https://doi.
org/10.1016/0896-6273(94)90461-8.
Simionato, E., Kerner, P., Dray, N., Le Gouar, M., Ledent, V., Arendt, D., Vervoort, M.,
2008. Atonal- and achaete-scute-related genes in the annelid Platynereis dumerilii:
insights into the evolution of neural basic-Helix-Loop-Helix genes. BMC Evol. Biol.
8, 170. https://doi.org/10.1186/1471-2148-8-170.
Sinigaglia, C., Busengdal, H., Leclère, L., Technau, U., Rentzsch, F., 2013. The bilaterian
head patterning gene six3/6 controls aboral domain development in a cnidarian.
PLoS Biol., 11. https://doi.org/10.1371/journal.pbio.1001488.
Skeath, J.B., Carroll, S.B., 1994. The achaete-scute complex: generation of cellular
pattern and fate within the Drosophila nervous system. FASEB J. 8, 714–721.
Sommer, L., Ma, Q., Anderson, D.J., 1996. Neurogenins, a novel family of atonal-related
149